It has been postulated that a proneural factor, neurogenin 1 (Ngn1), simultaneously activates the neurogenic program and inhibits the alternative astrogliogenic program when specifying the neuronal fate. While Ngn1 substantially suppresses the activation of the astrogliogenic Jak-Stat pathway, the underlying molecular mechanism was unknown. Here, by employing in vivo and in vitro approaches, we report that Ngn1 binds to the promoter of a brain-enriched microRNA, miR-9, and activates its expression during neurogenesis. Subsequently, our in vitro study showed that miR-9 directly targets mRNAs of Lifr-beta, Il6st (gp130), and Jak1 to down-regulate these critical upstream components of the Jak-Stat pathway, achieving inhibition of Stat phosphorylation and consequently, suppression of astrogliogenesis. This study revealed Ngn1 modulated non-coding RNA epigenetic regulation during cell fate specifications.
It has been postulated that a proneural factor, neurogenin 1 (Ngn1), simultaneously activates the neurogenic program and inhibits the alternative astrogliogenic program when specifying the neuronal fate. While Ngn1 substantially suppresses the activation of the astrogliogenic Jak-Stat pathway, the underlying molecular mechanism was unknown. Here, by employing in vivo and in vitro approaches, we report that Ngn1 binds to the promoter of a brain-enriched microRNA, miR-9, and activates its expression during neurogenesis. Subsequently, our in vitro study showed that miR-9 directly targets mRNAs of Lifr-beta, Il6st (gp130), and Jak1 to down-regulate these critical upstream components of the Jak-Stat pathway, achieving inhibition of Stat phosphorylation and consequently, suppression of astrogliogenesis. This study revealed Ngn1 modulated non-coding RNA epigenetic regulation during cell fate specifications.
It is known that leukemia inhibitory factor (Lif)-activated Jak-Stat signaling controls the onset of neurogenic-to-astrogliogenic transition (Bonni et al., 1997). Lif-activated Jak-Stat signaling pathway in neural stem/progenitor cells (NPCs) starts with three critical components at the cell membrane: the heterodimeric Lif receptor Lifr-beta and Il6st, as well as the receptor-associated Janus kinase (Jak), which are involved in activation of the signaling transducer and activator of transcription (Stat) (Sun et al., 2001). We previously demonstrated that the expression of the proneural basic-Helix-Loop-Helix (bHLH) factor neurogenin 1 (Ngn1) inhibits glial differentiation by two distinct mechanisms: (1) Ngn1 sequesters the transcription co-activators Crebbp (CBP)/E1A binding protein p300 (Ep300) away from glial specific promoters; (2) Ngn1 inhibits Stat1/3 phosphorylation (Sun et al., 2001). Moreover, we have previously revealed that during astrogliogenic period, phosphor-Stat1/3 directly induces the expression of Il6st and Jak1 to strengthen Stat signaling and trigger astrogliogenesis (He et al., 2005). However, the underlying mechanism of how Ngn1 inhibits Stat1/3 activity to block precocious astrocyte differentiation during the neurogenic period is still elusive.Our previous and current studies showed that protein and mRNA levels of Ngn1 were high during neurogenesis (E12 to E15) but significantly reduced during astrogliogenesis (P0–P4) (Figure 1A, lower panel) (He et al., 2005). Recently, a group of small non-coding RNA, microRNA (miRNA), has emerged as a novel neuroepigenetic mechanism that can rapidly fine-tune gene expression to regulate developmental timing and cell fate specification (Lee et al., 1993; Wightman et al., 1993; Shibata et al., 2008). While screening the expression pattern of brain specific miRNAs in developing brains and in adult brains by quantitative PCR (qPCR), we found that expression of miR-9 showed a bell-shaped pattern with their expression reaching maximum level at E16, right before the onset of astrogliogenesis (Figure 1A, upper panel). To analyze temporal expression of miR-9 in developing mouse brain, we carried out in situ hybridization (ISH) analysis. Our ISH data showed that miR-9 was extensively expressed in the ventricular zone (VZ) and subventricular zone (SVZ) progenitors in prenatal brains. In neonatal brains (P1–P7), the expression of miR-9 persisted in the SVZ, but at a lower level (Figure 1B). Previous studies by Britz et al. (2006) and Ge et al. (2006) showed that the Ngn1 was highly expressed in VZ/SVZ progenitors during neurogenic period. Taken together, these evidences implied that the expression pattern of miR-9 somewhat correlated with the expression of Ngn1, compatible with a potential regulatory relationship between Ngn1 and miR-9.
(A) Temporal expression of miR-9 and Ngn1 in the developing and adult mouse cortex. Upper panel: Taqman quantitative PCR (qPCR) analysis of endogenous miR-9 expression levels. Data were normalized to the loading control U6 non-coding RNA. Lower panel: qRT-PCR of endogenous Ngn1 mRNA levels. Data were normalized to loading control Gapdh. Gapdh, glyceraldehyde-3-phosphate dehydrogenase. (B) Expression analysis of miR-9 in the prenatal and neonatal mouse cortex by in situ hybridization (ISH). The mature miR-9 was extensively expressed in the VZ/SVZ progenitors in developing cortex. VZ, ventricular zone. SVZ, subventricular zone. Scale bar: 100 μm. (C) Ngn1 up-regulated the activity of the miR-9-2 promoter-driven luciferase reporter but not Ngn1 binding site mutant Ngn1 (AQ-Ngn1). (D) ChIP-qPCR analysis showed Ngn1 bound to miR-9-2 but not miR-99b promoter region in mouse E11 cortical NPCs overexpressing T7-tagged Ngn1. Data was presented as percentage pull down (IP using T7 antibody) comparing to the input. Negative control IgG pull down was also shown (*p < 0.05, Mann–Whitney test). (E) ChIP-qPCR of endogenous Ngn1 associated with miR-9-2 promoter in E15 and in P3 mouse cortexes. Data was presented as percentage pull down (IP using Ngn1 antibody) comparing to the input. Negative control IgG pull down was also shown (*p < 0.05, Mann–Whitney test). (F) Taqman qPCR analysis of the expression level of miR-9 in mouse NPCs in the presence of T7-tagged Ngn1 (*p < 0.02, Mann–Whitney test).
(A) Temporal expression of miR-9 and Ngn1 in the developing and adult mouse cortex. Upper panel: Taqman quantitative PCR (qPCR) analysis of endogenous miR-9 expression levels. Data were normalized to the loading control U6 non-coding RNA. Lower panel: qRT-PCR of endogenous Ngn1 mRNA levels. Data were normalized to loading control Gapdh. Gapdh, glyceraldehyde-3-phosphate dehydrogenase. (B) Expression analysis of miR-9 in the prenatal and neonatal mouse cortex by in situ hybridization (ISH). The mature miR-9 was extensively expressed in the VZ/SVZ progenitors in developing cortex. VZ, ventricular zone. SVZ, subventricular zone. Scale bar: 100 μm. (C) Ngn1 up-regulated the activity of the miR-9-2 promoter-driven luciferase reporter but not Ngn1 binding site mutant Ngn1 (AQ-Ngn1). (D) ChIP-qPCR analysis showed Ngn1 bound to miR-9-2 but not miR-99b promoter region in mouse E11 cortical NPCs overexpressing T7-tagged Ngn1. Data was presented as percentage pull down (IP using T7 antibody) comparing to the input. Negative control IgG pull down was also shown (*p < 0.05, Mann–Whitney test). (E) ChIP-qPCR of endogenous Ngn1 associated with miR-9-2 promoter in E15 and in P3 mouse cortexes. Data was presented as percentage pull down (IP using Ngn1 antibody) comparing to the input. Negative control IgG pull down was also shown (*p < 0.05, Mann–Whitney test). (F) Taqman qPCR analysis of the expression level of miR-9 in mouse NPCs in the presence of T7-tagged Ngn1 (*p < 0.02, Mann–Whitney test).DOI:
http://dx.doi.org/10.7554/eLife.06885.003By searching upstream sequences of the transcription start sites (TSS) of all three mouse miR-9 genes, we identified a putative Ngn1 binding site containing the E-box element CATATG located 2.5 kb upstream of the miR-9-2 TSS (Figure 1C). Subsequently, we confirmed that Ngn1, but not its DNA-binding mutant form, AQ-Ngn1, specifically activated the miR-9-2 promoter-driven luciferase reporter (Figure 1C). As expected, when the E-box element was mutated, Ngn1 activation of the miR-9-2 promoter was abolished (Figure 1C). To further confirm direct binding of Ngn1 to the putative binding site within the miR-9-2 promoter, we performed chromatin-immunoprecipitation combined with qPCR (ChIP-qPCR) using cultured mouse E11 cortical NPCs expressing T7-tagged Ngn1. The ChIP-qPCR analysis showed that Ngn1 directly associated with the miR-9-2 putative promoter region encompassing the E-box element, but not to the promoter of an irrelevant/control brain enriched miRNA, miR-99b (Figure 1D). To determine whether Ngn1 can directly bind to miR-9-2 promoter in vivo, we performed gene-specific ChIP-qPCR experiments using mouse cortex at both the neurogenic stage (E15) when Ngn1 was robustly expressed and the astrogliogenic stage (P3) when Ngn1 expression was diminished. We found that the miR-9-2 promoter was occupied by endogenous Ngn1 in E15 but not in P3 cortex (Figure 1E). Finally, we found that overexpression of Ngn1 significantly up-regulated miR-9 expression (Figure 1F). Collectively, these results demonstrated that Ngn1 could directly control the expression of miR-9 during the neurogenic period.Previous and current studies have showed that (1) Ngn1 inhibited astrogliogenesis partially by inhibiting the astrogliogenic Jak-Stat pathway (Sun et al., 2001); (2) miR-9 potentially inhibited Stat activation in mouse embryonic stem cell in vitro (Krichevsky et al., 2006); and (3) the expression of miR-9 was controlled by Ngn1 during neurogenesis. Based on these evidences, therefore, we predicted that miR-9 should play essential roles in inhibiting astrocyte differentiation. To test this, we built miR-9 overexpression (miR-9) and miR-9 knockdown sponge (miR-9AS) constructs (Figure 2—figure supplement 1A). miR-9, miR-9AS, or control plasmid was delivered into progenitor cells that resided in the ventricular surface by in utero electroporation at E16 (Figure 2A). The electroporated cells (GFP+) migrated to layers 2/3 without obvious migration defect in all experimental conditions. We analyzed the ratios of both astrocyte marker+ cells and neuronal marker+ cells vs total transfected cells (GFP+) at P30. Our in vivo study showed that overexpression of miR-9 significantly decreased the number of astrocytes by using three astrocyte markers, Aldh1l1, Slc1a3 (EAAT1), and Gfap, while knockdown of miR-9 increased it (Figure 2B–D). We found that neither overexpressing nor knocking down miR-9 had significant effect on the number of Rbfox3+ (NeuN+) neurons (Figure 2B–D). By miR-9 ISH combined with Gfap and Rbfox3 immunostaining analysis in adult mouse brains, it became clear that miR-9 was expressed in neurons (Rbfox3+), but not in astrocytes (Gfap+) (Figure 2—figure supplement 1B), consistent with the notion that miR-9 inhibited the astroglial program.
Figure 2—figure supplement 1.
(A) Upper left panels showed construction of miR-9 overexpression plasmid (miR-9) by inserting pre-miR-9-2 and its flanking sequences to a modified lentiviral plasmid FG12.
Lower left panels showed the construction of miR-9 knockdown lentiviral vector (miR-9AS) and knockdown control (miR-9ASm). Four miR-9 bulged antisense sequences were inserted immediately downstream of the H1 promoter of the modified-FG12 vector. H1, H1 promoter. UbiC, ubiquitin promoter. miR-9AS mutant control, miR-9Sm was constructed by modifying 3-nt in miR-9 seed binding region. Right panels showed the luciferase assay of miR-9 knockdown efficiency. Upper right panel showed the construction of miR-9 luciferase assay plasmid. Three miR-9 bulged antisense repeats were inserted immediately downstream of a firefly luciferase gene. Lower right panel showed relative fold changes of luciferase activity. miR-9 luciferase construct was co-transfected into HEK239T cells with miR-9 and/or miR-9AS. A Renilla luciferase plasmid pRL-TK was used as an internal control. The empty vector FG12 (con) and the miR-9 binding site mutant miR-9AS (miR-9ASm) were used as negative controls. *p < 0.05, Wilcoxon-Mann-Whitney test. (B) Endogenous miR-9 was expressed in neocortical neurons, but not in astrocytes in adult cortex. miR-9 ISH combined with Rbfox3 (NeuN) and Gfap double immunostaining in the upper left panels were shown at greater magnification in the right panels. The lower left panels showed miR-9 positive neuron that overlaps with a neuronal maker, Rbfox3 (green, arrowhead), but not Gfap positive astrocyte (red, arrow).
DOI:
http://dx.doi.org/10.7554/eLife.06885.005
Figure 2.
miR-9 inhibited astrogliogenesis in vivo.
(A) Schematic representation of in utero injection of miR-9 constructs followed by electroporation into cortical progenitors resided at the ventricular surface at E16. The right panels showed that cells electroporated at E16 (green) with each condition all migrated to proper cortical layers without overt migration defects. Scale bar: 100 μm. (B–D) Left panels showed examples of astrocyte marker+ or neuronal marker+ cells. The arrow pointed Rbfox3+(NeuN) cortical neuron (green and blue). The arrowhead pointed astrocyte marker+ astrocyte (green and red). Scale bar: 10 μm. The arrowhead pointed astrocyte was shown at greater magnification in the last left panel (confocal montage with orthogonal views taken at the center of the cell, scale bar: 5 μm). Right panels showed that overexpression of miR-9 in vivo dramatically attenuated astrogliogenesis, whereas knockdown of miR-9 had the opposite effect (**p < 0.01, *p < 0.5, Mann–Whitney test). Aldh1l1, aldehyde dehydrogenase 1 family, member L1; Slc1a3 (EAAT1), solute carrier family 1 (sodium-dependent glutamate/aspartate transporter 1), member 3; Gfap, glial fibrillary acidic protein.
DOI:
http://dx.doi.org/10.7554/eLife.06885.004
Lower left panels showed the construction of miR-9 knockdown lentiviral vector (miR-9AS) and knockdown control (miR-9ASm). Four miR-9 bulged antisense sequences were inserted immediately downstream of the H1 promoter of the modified-FG12 vector. H1, H1 promoter. UbiC, ubiquitin promoter. miR-9AS mutant control, miR-9Sm was constructed by modifying 3-nt in miR-9 seed binding region. Right panels showed the luciferase assay of miR-9 knockdown efficiency. Upper right panel showed the construction of miR-9 luciferase assay plasmid. Three miR-9 bulged antisense repeats were inserted immediately downstream of a firefly luciferase gene. Lower right panel showed relative fold changes of luciferase activity. miR-9 luciferase construct was co-transfected into HEK239T cells with miR-9 and/or miR-9AS. A Renilla luciferase plasmid pRL-TK was used as an internal control. The empty vector FG12 (con) and the miR-9 binding site mutant miR-9AS (miR-9ASm) were used as negative controls. *p < 0.05, Wilcoxon-Mann-Whitney test. (B) Endogenous miR-9 was expressed in neocortical neurons, but not in astrocytes in adult cortex. miR-9 ISH combined with Rbfox3 (NeuN) and Gfap double immunostaining in the upper left panels were shown at greater magnification in the right panels. The lower left panels showed miR-9 positive neuron that overlaps with a neuronal maker, Rbfox3 (green, arrowhead), but not Gfap positive astrocyte (red, arrow).
DOI:
http://dx.doi.org/10.7554/eLife.06885.005
miR-9 inhibited astrogliogenesis in vivo.
(A) Schematic representation of in utero injection of miR-9 constructs followed by electroporation into cortical progenitors resided at the ventricular surface at E16. The right panels showed that cells electroporated at E16 (green) with each condition all migrated to proper cortical layers without overt migration defects. Scale bar: 100 μm. (B–D) Left panels showed examples of astrocyte marker+ or neuronal marker+ cells. The arrow pointed Rbfox3+(NeuN) cortical neuron (green and blue). The arrowhead pointed astrocyte marker+ astrocyte (green and red). Scale bar: 10 μm. The arrowhead pointed astrocyte was shown at greater magnification in the last left panel (confocal montage with orthogonal views taken at the center of the cell, scale bar: 5 μm). Right panels showed that overexpression of miR-9 in vivo dramatically attenuated astrogliogenesis, whereas knockdown of miR-9 had the opposite effect (**p < 0.01, *p < 0.5, Mann–Whitney test). Aldh1l1, aldehyde dehydrogenase 1 family, member L1; Slc1a3 (EAAT1), solute carrier family 1 (sodium-dependent glutamate/aspartate transporter 1), member 3; Gfap, glial fibrillary acidic protein.DOI:
http://dx.doi.org/10.7554/eLife.06885.004
(A) Upper left panels showed construction of miR-9 overexpression plasmid (miR-9) by inserting pre-miR-9-2 and its flanking sequences to a modified lentiviral plasmid FG12.
Lower left panels showed the construction of miR-9 knockdown lentiviral vector (miR-9AS) and knockdown control (miR-9ASm). Four miR-9 bulged antisense sequences were inserted immediately downstream of the H1 promoter of the modified-FG12 vector. H1, H1 promoter. UbiC, ubiquitin promoter. miR-9AS mutant control, miR-9Sm was constructed by modifying 3-nt in miR-9 seed binding region. Right panels showed the luciferase assay of miR-9 knockdown efficiency. Upper right panel showed the construction of miR-9 luciferase assay plasmid. Three miR-9 bulged antisense repeats were inserted immediately downstream of a firefly luciferase gene. Lower right panel showed relative fold changes of luciferase activity. miR-9 luciferase construct was co-transfected into HEK239T cells with miR-9 and/or miR-9AS. A Renilla luciferase plasmid pRL-TK was used as an internal control. The empty vector FG12 (con) and the miR-9 binding site mutant miR-9AS (miR-9ASm) were used as negative controls. *p < 0.05, Wilcoxon-Mann-Whitney test. (B) Endogenous miR-9 was expressed in neocortical neurons, but not in astrocytes in adult cortex. miR-9 ISH combined with Rbfox3 (NeuN) and Gfap double immunostaining in the upper left panels were shown at greater magnification in the right panels. The lower left panels showed miR-9 positive neuron that overlaps with a neuronal maker, Rbfox3 (green, arrowhead), but not Gfap positive astrocyte (red, arrow).DOI:
http://dx.doi.org/10.7554/eLife.06885.005To investigate the mechanisms of how miR-9 mediated Ngn1 regulation to prevent precocious astrocyte differentiation, we employed in vitro approaches. miR-9, miR-9AS, or the control plasmid was delivered into E13 cortical progenitor cells by electroporation (Figure 3A). The ratios of Gfap+ astrocytes and Map2+ neurons in transfected cells (GFP+) were analyzed at 10 DIV (Days In Vitro). Overexpression of miR-9 significantly decreased the number of astrocytes, whereas knockdown of miR-9 had the opposite effect (Figure 3A). Transfection of mouse E11 NPCs with exogenous miR-9 duplexes significantly reduced the number of astrocytes, while having no significant effect on the number of neurons (Figure 3—figure supplement 1A). In agreement with our in vivo and in vitro findings, the luciferase reporter assays showed that miR-9 suppressed the activation of glial-specific Gfap promoter, with little effect on the neurogenic promoter Neurod1 (Figure 3—figure supplement 1B). While Ngn1 could both activate the neurogenic program and simultaneously inhibit the astrogliogenic program (Figure 3—figure supplement 1C), miR-9 appeared to be only involved in the inhibition of glial fate.
Figure 3.
miR-9 inhibited astrogliogenesis via targeting three components of Jak-Stat pathway.
(A) Upper right panels: schematic representation of in vitro delivery of miR-9 constructs into cortical progenitors by electroporation. Lower left panels showed examples of astrocyte marker Gfap+ or neuronal marker Map2+ cells. Right panel showed overexpression of miR-9 significantly reduced the number of astrocytes 10 days after electroporation, whereas knockdown of miR-9 dramatically promoted astrogliogenesis (**p < 0.01, *p < 0.5, Mann–Whitney test). Overexpression of miR-9 in NPCs did not increase the number of neurons. Knockdown of miR-9 reduced the number of Map2+ neurons. Map2, Microtubule-Associated Protein 2. (B) Transfection of mouse NPCs with exogenous miR-9 duplex blocked phosphorylation of Stat1/3 without altering their protein levels. (C) Luciferase activity of Lifr-beta, Il6st (gp130), and Jak1 3′ UTR luciferase reporter in the presence of different combinations of control (con), miR-9, miR-9 inhibitor con, and miR-9 inhibitor in mouse NPCs. (D) miR-9 inhibited protein levels of Jak-Stat signaling components in NPCs transfected with control or miR-9 duplex. Right panels: western blotting densitometry analysis of protein level changes. Actb (β-actin) serves as the loading control. (E) A constitutively active form of Stat3, Stat3C bypassed the effect of miR-9 inhibition on astrocyte differentiation. (F) Schematic representation of Ngn1-regulated miR-9 signaling that modulates Stat1/3 phosphorylation to control cell fate specification. Ngn1 up-regulates miR-9 expression during neurogenesis. miR-9 reduces protein levels of Lifr-beta, Il6st, and Jak1 of Jak-Stat signaling pathway by targeting their 3′ UTRs, which in turn abolish Stat1/3 phosphorylation to suppress astrogliogenesis. Crebbp: CREB binding protein, Smad1: Mothers Against DPP Homolog 1 (Drosophila), Ep300: E1A Binding Protein p300, E-protein: ubiquitous basic-Helix-Loop-Helix proteins, such as E12 or E47. The dotted arrows show the inhibition regulations.
DOI:
http://dx.doi.org/10.7554/eLife.06885.006
(A) Transfection of mouse E11 cortical NPCs with exogenous miR-9 duplex significantly reduced the number of Gfap+ astrocytes in vitro. (B) miR-9 suppressed activation of glial-specific Gfap promoter, with little effect on the neurogenic promoter Neurod1. (C) Ngn1 promoted neurogenesis and suppresses astrogliogenesis. Western blotting analysis showed that overexpression of Ngn1 in mouse E11 cortical NPC promoted Tuj1 expression, while reduced Gfap+ expression (left panels). Tuj1, beta III tubulin, a neuronal marker. Right panel showed overexpression of Ngn1 in mouse E11 cortical NPC promoted neurogenesis (Tuj1+ cells).
DOI:
http://dx.doi.org/10.7554/eLife.06885.007
(A) Predicted duplex formation between mouse Lifr-beta, Il6st, and Jak1 3′ UTR (top) and miR-9 (bottom). (B) Luciferase activity of wild type Lifr-beta 3′ UTR and miR-9 binding region mutant Lifr-beta 3′ UTR reporter genes with or without miR-9 duplex in mouse E11 cortical NPCs (*p < 0.0001, Wilcoxon-Mann-Whitney test). (C, D) Ngn1 suppressed the expression of three major components of Jak-Stat signaling pathway. (C) Western blot analysis of Ngn1 suppressed the protein levels of Lifr-beta, Il6st, and Jak1. Actb served as the loading control. (D) Overexpression of Ngn1 decreased the activity of luciferase reporter fused to 3′ UTRs of Il6st, Lifr-beta, and Jak1 mRNAs. (*p < 0.05, **p < 0.005, Wilcoxon-Mann-Whitney test).
DOI:
http://dx.doi.org/10.7554/eLife.06885.008
Figure 3—figure supplement 1.
miR-9 and Ngn1 inhibited astrogliogenesis.
(A) Transfection of mouse E11 cortical NPCs with exogenous miR-9 duplex significantly reduced the number of Gfap+ astrocytes in vitro. (B) miR-9 suppressed activation of glial-specific Gfap promoter, with little effect on the neurogenic promoter Neurod1. (C) Ngn1 promoted neurogenesis and suppresses astrogliogenesis. Western blotting analysis showed that overexpression of Ngn1 in mouse E11 cortical NPC promoted Tuj1 expression, while reduced Gfap+ expression (left panels). Tuj1, beta III tubulin, a neuronal marker. Right panel showed overexpression of Ngn1 in mouse E11 cortical NPC promoted neurogenesis (Tuj1+ cells).
DOI:
http://dx.doi.org/10.7554/eLife.06885.007
miR-9 inhibited astrogliogenesis via targeting three components of Jak-Stat pathway.
(A) Upper right panels: schematic representation of in vitro delivery of miR-9 constructs into cortical progenitors by electroporation. Lower left panels showed examples of astrocyte marker Gfap+ or neuronal marker Map2+ cells. Right panel showed overexpression of miR-9 significantly reduced the number of astrocytes 10 days after electroporation, whereas knockdown of miR-9 dramatically promoted astrogliogenesis (**p < 0.01, *p < 0.5, Mann–Whitney test). Overexpression of miR-9 in NPCs did not increase the number of neurons. Knockdown of miR-9 reduced the number of Map2+ neurons. Map2, Microtubule-Associated Protein 2. (B) Transfection of mouse NPCs with exogenous miR-9 duplex blocked phosphorylation of Stat1/3 without altering their protein levels. (C) Luciferase activity of Lifr-beta, Il6st (gp130), and Jak1 3′ UTR luciferase reporter in the presence of different combinations of control (con), miR-9, miR-9 inhibitor con, and miR-9 inhibitor in mouse NPCs. (D) miR-9 inhibited protein levels of Jak-Stat signaling components in NPCs transfected with control or miR-9 duplex. Right panels: western blotting densitometry analysis of protein level changes. Actb (β-actin) serves as the loading control. (E) A constitutively active form of Stat3, Stat3C bypassed the effect of miR-9 inhibition on astrocyte differentiation. (F) Schematic representation of Ngn1-regulated miR-9 signaling that modulates Stat1/3 phosphorylation to control cell fate specification. Ngn1 up-regulates miR-9 expression during neurogenesis. miR-9 reduces protein levels of Lifr-beta, Il6st, and Jak1 of Jak-Stat signaling pathway by targeting their 3′ UTRs, which in turn abolish Stat1/3 phosphorylation to suppress astrogliogenesis. Crebbp: CREB binding protein, Smad1: Mothers Against DPP Homolog 1 (Drosophila), Ep300: E1A Binding Protein p300, E-protein: ubiquitous basic-Helix-Loop-Helix proteins, such as E12 or E47. The dotted arrows show the inhibition regulations.DOI:
http://dx.doi.org/10.7554/eLife.06885.006
miR-9 and Ngn1 inhibited astrogliogenesis.
(A) Transfection of mouse E11 cortical NPCs with exogenous miR-9 duplex significantly reduced the number of Gfap+ astrocytes in vitro. (B) miR-9 suppressed activation of glial-specific Gfap promoter, with little effect on the neurogenic promoter Neurod1. (C) Ngn1 promoted neurogenesis and suppresses astrogliogenesis. Western blotting analysis showed that overexpression of Ngn1 in mouse E11 cortical NPC promoted Tuj1 expression, while reduced Gfap+ expression (left panels). Tuj1, beta III tubulin, a neuronal marker. Right panel showed overexpression of Ngn1 in mouse E11 cortical NPC promoted neurogenesis (Tuj1+ cells).DOI:
http://dx.doi.org/10.7554/eLife.06885.007
miR-9 targeted Jak-Stat signaling pathway.
(A) Predicted duplex formation between mouse Lifr-beta, Il6st, and Jak1 3′ UTR (top) and miR-9 (bottom). (B) Luciferase activity of wild type Lifr-beta 3′ UTR and miR-9 binding region mutant Lifr-beta 3′ UTR reporter genes with or without miR-9 duplex in mouse E11 cortical NPCs (*p < 0.0001, Wilcoxon-Mann-Whitney test). (C, D) Ngn1 suppressed the expression of three major components of Jak-Stat signaling pathway. (C) Western blot analysis of Ngn1 suppressed the protein levels of Lifr-beta, Il6st, and Jak1. Actb served as the loading control. (D) Overexpression of Ngn1 decreased the activity of luciferase reporter fused to 3′ UTRs of Il6st, Lifr-beta, and Jak1 mRNAs. (*p < 0.05, **p < 0.005, Wilcoxon-Mann-Whitney test).DOI:
http://dx.doi.org/10.7554/eLife.06885.008We confirmed that transfection of mouse NPCs with exogenous miR-9 duplex blocked phosphorylation of Stat1/3 without altering their protein levels (Figure 3B), which is in agreement with the work by Krichevsky et al. (2006). To explore how miR-9 inhibits Stat phosphorylation, we scanned the 3′ UTRs of three upstream components of the Jak-Stat pathway (www.targetscan.com) and found that Lifr-beta, Il6st, and Jak1 contain putative miR-9 binding-sites (Figure 3—figure supplement 2A). Luciferase reporter assays were used to confirm miR-9 targeting of these components. Transfection of exogenous miR-9 duplex led to an average of 40% decrease in luciferase activities of reporter constructs carrying 3′ UTRs of Lifr-beta, Il6st, and Jak1 mRNAs. Such effect was reversed by a miR-9 inhibitor (duplex) (Figure 3C). Furthermore, we showed that the effects of miR-9 on the targets were dependent on the miR-9 binding-sites within the 3′ UTRs as the luciferase reporter containing mutant Lifr-beta 3′ UTR (with mutated miR-9 binding-site) was resistant to miR-9 inhibition (Figure 3—figure supplement 2B). In line with the luciferase assay, we showed that the transfection of mouse NPCs with exogenous miR-9 duplex reduced protein levels of Lifr-beta, Il6st, and Jak1 (Figure 3D). We confirmed that Ngn1 also down-regulated the expression levels of Lifr-beta, Il6st, and Jak1 (Figure 3—figure supplement 2C) (Sun et al., 2001; He et al., 2005). We further verified this result by luciferase assays. Overexpression of Ngn1 suppressed the luciferase activities of all three critical component of Jak-Stat pathway (Figure 3—figure supplement 2D). In supporting the above-mentioned findings, we showed that co-expression of a constitutively active form of Stat3 (Stat3C) with miR-9 in NPCs could bypass the effect of miR-9 inhibition on astrocyte differentiation (Figure 3E). In addition, we previously showed that Jak-Stat signaling has a positive auto-regulation loop, where phosphor-Stat1/3 activates Il6st and Jak1 expression (He et al., 2005). Therefore, the DNA binding mutant Ngn1 (AQ-Ngn1), by sequestration of the transcriptional co-activator Crebbp, should also inhibit Stat1/3 mediated activation of Il6st and Jak1, which in turn inhibits Stat1/3 phosphorylation (Sun et al., 2001). It appeared that the Ngn1 sequestration regulation and the Ngn1 induced miR-9 regulation acted jointly to suppress Jak-Stat signaling to warrant the neuronal cell fate specification during the time period of neurogenesis (Figure 3F).
Figure 3—figure supplement 2.
miR-9 targeted Jak-Stat signaling pathway.
(A) Predicted duplex formation between mouse Lifr-beta, Il6st, and Jak1 3′ UTR (top) and miR-9 (bottom). (B) Luciferase activity of wild type Lifr-beta 3′ UTR and miR-9 binding region mutant Lifr-beta 3′ UTR reporter genes with or without miR-9 duplex in mouse E11 cortical NPCs (*p < 0.0001, Wilcoxon-Mann-Whitney test). (C, D) Ngn1 suppressed the expression of three major components of Jak-Stat signaling pathway. (C) Western blot analysis of Ngn1 suppressed the protein levels of Lifr-beta, Il6st, and Jak1. Actb served as the loading control. (D) Overexpression of Ngn1 decreased the activity of luciferase reporter fused to 3′ UTRs of Il6st, Lifr-beta, and Jak1 mRNAs. (*p < 0.05, **p < 0.005, Wilcoxon-Mann-Whitney test).
DOI:
http://dx.doi.org/10.7554/eLife.06885.008
Since the first miRNA was discovered 20 years ago, miRNA has emerged as a new mechanism of epigenetic regulation that can rapidly respond to extrinsic cues to pattern the activities of particular target protein-coding genes and generate different types of cells over a short period of time (Lee et al., 1993; Wightman et al., 1993; Sauvageot and Stiles, 2002; Miller and Gauthier, 2007). This study demonstrated a novel molecular mechanism through which miR-9 mediated the action of Ngn1 by suppressing the expression of three major components of Jak-Stat singling, Lifr-beta, Il6st, and Jak1, which attenuated Stat1/3 phosphorylation to inhibit the astrogliogenic differentiation genes or programs. Our previous and present work revealed that Ngn1 modulated multiple layers of genetic and epigenetic regulations to secure the process of neuronal fate specification.
Materials and methods
miRNA isolation and real-time PCR
Small RNA from samples was purified by using the Trizol reagent (Invitrogen, Thermo Fisher Scientific, Waltham, MA). miRNA real-time PCR was performed by using Taqman miRNA assay kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA).
miRNA ISH
LNA 5′-DIG-labeled mercury miR-9 probe (Exiqon, Woburn, MA) were used in ISH on mouse brains. Briefly, brains of CD-1 embryos were dissected and fixed in freshly prepared 4% paraformaldehyde (PFA) (Sigma-Aldrich, St. Louis, MO) for 2 hr at room temperature. The fixed brains were perfused in PBS with 30% sucrose overnight at 4°C. The next day, the brain tissues were embedded in Sakura Finetek Tissue-Tek O.C.T. Compound and frozen on dry-ice. The frozen brain was sectioned at 10 μm thickness and mounted on Superfrost PLUS slides. After acetylation, the tissue was permeablized by proteinase K at a final concentration of 5 μg/ml and then pre-hybridized by hybridization buffer (50% formamide (Sigma-Aldrich, St. Louis, MO), 5× SSC, 5× Denhardt's solution (Thermo Fisher Scientific, Waltham, MA), 200 μg/ml of yeast RNA (Thermo Fisher Scientific, Waltham, MA), 500 μg/ml of salmon sperm DNA (Thermo Fisher Scientific, Waltham, MA), and 2% Roche blocking reagent (Roche Applied Sciences, Penzberg, Upper Bavaria, Germany)) for 8 hr. For hybridization, 1 pM of the LNA 5′-DIG-labeled mercury probe in 150 μl denaturizing buffer (50% formamide, 5× SSC, 5× Denhardt's solution, 200 μg/ml of yeast RNA, 500 μg/ml of salmon sperm DNA, 2% Roche blocking reagent, 0.25% CHAPS (Sigma-Aldrich, St. Louis, MO), and 0.1% Tween-20 (Sigma-Aldrich, St. Louis, MO)) was added per slide. The hybridization was carried out overnight at 50°C. After stringency washes, hybridization probe was visualized using anti-DIG-alkaline phosphatase conjugated substrate (Roche Applied Sciences, Penzberg, Upper Bavaria, Germany).The immunostaining was carried following the ISH. The primary antibodies used were anti-Gfap polyclonal antibody (Abcam, Cambridge, MA) and anti-Rbfox3 (NeuN) monoclonal antibody (Chemicon, EMD Millipore, Billerica, MA). Fluorophore conjugated secondary antibody were purchased from Invitrogen (Molecular Probe, Thermo Fisher Scientific, Waltham, MA). Images were taken with a Zeiss LSM510 confocal microscope, processed with software Imaris (Bitplane, Switzerland) and composed with adobe Photoshop.
Plasmid constructions
To construct miR-9 overexpression lentiviral plasmid, the miR-9-2 pre-miRNA fragment with 80 bp flanking sequences was PCR amplified from CD-1mouse genomic DNA. The PCR product was first cloned into BamH1 and XhoI sites of pBS-hH1 shuttle vector, and then the pre-miR-9 sequence together with human H1 Pol III promoter of the vector pBS-hH1 was digested by Xbal1 and Xho1 and subcloned into FG12 lentiviral vector. miR-9 overexpression forward oligo: CCGGATCCCTGGAGTTCAGCCAGAGGAA. miR-9 overexpression reverse oligo: CCCTCGAGGGTTTTTACTGTCTCTTGGTTGC. To efficiently suppress miR-9 activity, we inserted four bulged miR-9 antisense sequences immediately downstream of the H1 promoter of FG12 (Ebert et al., 2007). The control sequence has 3-nucleotide mutations in the miR-9 ‘seed’-binding region. The bulged miR-9 antisense sequences bind to endogenous mature miR-9, serving as a miR-9 sponge to inhibit miR-9 cellular activity without altering endogenous miR-9 expression. To construct miR-9 knockdown lentiviral plasmid (miR-9AS), the annealed oligonucleotides for miRNA binding sites with 4-nt spacers for bulged sites were cloned into lentiviral vector FG12 (CTL). miR-9AS forward oligo: GATCTCATACAGCTCTTAACCAAAGAATCTCATACAGCTCTTAACCAAAGAATCTCATACAGCTCTTAACCAAAGAATCTCATACAGCTCTTAACCAAAGATTTTT. miR-9AS reverse oligo: TCGAAAAAATCTTTGGTTAAGAGCTGTATGAGATTCTTTGGTTAAGAGCTGTATGAGATTCTTTGGTTAAGAGCTGTATGAGATTCTTTGGTTAAGAGCTGTATGA.To test the efficiency of miR-9 knockdown plasmid, we cloned miR-9 bulged (AS) or miR-9 perfect-matched antisense oligonucleotides duplex into immediate downstream of a firefly luciferase reporter gene of plasmid pIS0 (a gift kindly provided by David Baltimore). miR-9 luciferase assay forward oligo: TCATACAGCTCTTAACCAAAGAATCGTCATACAGCTCTTAACCAAAGAATCGTCATACAGCTAGATAACCAAAGA; miR-9 luciferase assay reverse oligo: CTAGTCTTTGGTTAAGAGCTGTATGACGATTCTTTGGTTAAGAGCTGTATGACGATTCTTTGGTTAAGAGCTGTATGAAGCT; miR-9 Luciferase assay mutant forward oligo: TCATACAGCTCTTAGCTGAAGAATCGTCATACAGCTCTTAGCTGAAGAATCGTCATACAGCTCTTAGCTGAAGA; miR-9 luciferase assay mutant reverse oligo: TAGTCTTCAGCTAAGAGCTGTATGACGATTCTTCAGCTAAGAGCTGTATGACGATTCTTCAGCTAAGAGCTGTATGAAGCT.All the lentiviral shuttle vectors and helper vectors were kind gifts from David Baltimore.
Adenovirus
The T7-tagged mouseNgn1 was cloned into an adenoviral shuttle vector pMZL6 containing a GFP expression cassette. Control and myc-tagged mouseNgn1 adenovirus were previously made (Sun et al., 2001). Recombinant adenoviruses were made by co-transfection of the shuttle plasmids with the plasmid pBHG10 into HEK293 cells. Viruses were amplified by infecting HEK293 cells and supernatants were harvested, tittered and frozen at −80°C until infection.
In utero electroporation
For the in utero electroporation, pregnant mice at embryonic day 16 (E16) were deeply anesthetized with isoflurane, uterine horns were carefully exposed through a midline abdominal incision to perform in utero injection and electroporation. Plasmid (2 μl, 2 μg/μl) in saline containing 0.01% fast green was injected into the lateral ventricle of the embryos through the uterine wall using a NanoFil Syringe with a 36 gouge needle (World Procession Instruments, Sarasota, FL). After injection, electroporation (50 ms square pulses of 40 V with 100 ms, 5 intervals; BTX Electroporator ECM 830 (Harvard Apparatus, Inc., Holliston, MA) was carried out. Then, uterine horns were placed back into the abdominal cavity, and the abdominal wall of the pregnant mouse was sutured. The pups at postnatal day 8 (P8) and day 30 were transcardially fixed with 4% PFA and the brain was continuously fixed in 4% PFA 2 hr at room temperature. Vibratome-sections with GFP positive were subjected to immunohistochemistry.
Subjects
For in utero electroporation experiments, ICR CD-1mice were used (Charlies River Laboratories (San Diego, CA). Following the in utero electroporation, the male mice were housed four per cage, maintained on a 12 hr light/dark schedule, and allowed free access to food and water. The protocols are approved by the Institutional Animal Care and Use Committee of the University of California, Los Angeles.
Cell culture, miRNA mimetics, and electroporation
Mouse (CD1 or Balb/c) cortical neural progenitor cells (NPCs) from E11 cortex were dissected, dissociated, and cultured in DMEM/F12 (Invitrogen) chemically defined medium supplemented with B27. HEK293 and HEK293T cells (ATCC, Manassas, VA) were cultured in DMEM medium with 10% FBS, penicillin/streptomycin and glutamine. LIF (100 ng/ml, R&D Systems, Minneapolis, MN) was used for astrocyte differentiation (1∼3-day long-term treatment). Short-term Lif (100 ng/ml) treatment (20 min) was used to detect Stat1/3 phosphorylation. To study the role of miR-9 in regulating astrogliogenesis, CD-1mouseE13 NPC were isolated and the plasmid (miR-9, miR-9AS, con) was electroporated into the cells using a Nucleofector device (Lonza, Switzerland). To confirm above study, miRNA duplexes and 2′-O-methyl antisense oligonucleotides targeted miR-9 (miR-9 inhibitor) and control (Dharmacon, GE Dharmacon, Lafayette, CO) were electroporated into mouse NPCs by using the nucleofector and mouse neural stem cell nucleofection kit according to the manufacturer's instructions (Lonza). The cells were fixed with 4% PFA for 10 min at room temperature.
Immunohistochemistry and image processing
The primary antibodies that were used in this study are: anti-Gfap monoclonal antibody (Sigma), anti-Gfap polyclonal antibody (Abcam), anti-Slc1a3 (EAAT1) polyclonal antibody (Abcam), anti-Aldh1l1 polyclonal antibody (Abcam), chicken anti-Map2 antibody (Abcam), anti-Rbfox3 (NeuN) monoclonal antibody (EMD Millipore), and anti-beta III Tubulin (Tuj1) monoclonal antibody (Abcam). For mouse antibody (monoclonal antibody) on mouse tissues, the endogenous mouseIgG blocking method was used to reduce background straining. Briefly, after normal serum blocking and before primary antibody incubation, the mouse brain sections were incubated with unconjugated affiniPure Fab fragment goat Anti-MouseIgG (H + L) (Jackson ImmunoResearch Labs, West Grove, PA) for 1 hr at room temperature. Fluorophore conjugated secondary antibodies were purchased from Invitrogen (Molecular Probe). Images were taken with a Zeiss LSM510 confocal microscope, processed with software NIH ImageJ and Imaris (Bitplane), and composed with adobe Photoshop.
Luciferase reporter assays
The 1.9 kb Gfap promoter-luciferase reporter construct (pGL3-Gfap) and mouseNeurod1 promoter-luciferase reporter construct (pGL3-Neurod1) were inserted into pGL3 firefly luciferase vector. The mousemiR-9-2 gene promoter sequence and its E-box motif mutant were amplified by PCR and cloned into the pGL3 fly-luciferase construct (Promega, Madison, WI), respectively. The mouseIl6st(gp130) 3′ UTR, Jak1 3′ UTR, Lifr-beta 3′ UTR and miR-9 seed region mutant of Lifr-beta 3′ UTR were amplified by PCR and cloned into a firefly luciferase vector, pIS0 vector after luciferase gene (a gift from Dr David Bartel). The miRNA duplex and 2′-O-methyl oligos and fly-luciferase plasmids were co-transfected into E11 mouse NPCs at P2–P4 using Lipofectamine LTX (Invitrogen). TK-pRL Renilla luciferase construct was used as transfection control (Promega). Approximately 24 hr post-transfection, cells were lysed for dual luciferase assays (Promega).
Western blot analysis
The antibodies used for western were as follows: mouse anti-Gfap (Sigma), rabbit anti-Jak1 (Santa Cruz Biotechnology, Dallas, TX), rabbit anti-Il6st (Santa Cruz, C-20), rabbit anti-Lifr-beta (Santa Cruz, C-19), rabbit anti-Stat1 (BD Biosciences, San Jose, CA), mouse anti-Stat3 (BD Biosciences), mouse anti-phosphotyrosine Stat1 (BD Biosciences), rabbit anti-phosphotyrosine Stat3 (Cell Signaling, Danvers, MA), mouse anti-TuJ1 (Covance, Princeton, NJ) and mouse anti-β-actin (Actb) (Sigma). Secondary goat anti-mouse or anti-rabbitIgG-horseradish antibodies (Calbiochem, EMD Millipore, Billerica, MA) were used, and detection was performed using the ECL plus chemiluminescence (PerkinElmer, Waltham, MA) on X-Omat Blue films (Kodak).
ChIP
Briefly, ∼108 E11 mouse cortical NPC culture (usually around passage 2) infected with T7-tagged Ngn1 adenoviruses to over 95% infection fate was chemically cross-linked by the additional of 11% formaldehyde solution for 20 min at room temperature. Cells were treated with 1/20 vol of 2.5 M glycine to quench the formaldehyde and washed three times with 1× PBS and pellets were harvested and stored at −80°C prior to use. Cells were re-suspended, lysed, and sonicated to solubilize and shear cross-linked DNA. We used a Branson Sonifier 450 and sonicated at power 5 with a microtip for 7–10 cycles of 30 s pulses (60-s pause between pulses) at 4°C while samples were immersed in an ice bath. After saving 50 μl of whole cell extract (WCE) from each sample to store at −20°C, the rest of sonicated cell lysate was incubated overnight at 4°C with 100 μl Dynal Protein G magnetic beads (Invitrogen) preincubated with 10 μg of the appropriated antibody for at least 8 hr. Beads were then washed five times with RIPA buffer and 1 time with TE containing 50 mM NaCl. Bound complexes were eluted from the beads in elution buffer by heating at 65°C with occasional vortex, and crosslinking was reversed by 6 hr incubation at 65°C. The WCE was also treated for crosslink reversal with additional elution buffer at the same time. Immunoprecipitated DNA and WCE DNA were then purified by treatment with RNaseA, proteinase K and phenol: chloroform: isoamyl alcohol extractions.
ChIP validations by site-specific qPCR analysis
We used site-specific ChIP-PCR to confirm binding of Ngn1 to miR-9 promoter. Primers were designed to amplify around the E-box location on miR-9-2 promoter. PCR was performed on unamplified DNA samples of several sets of ChIP experiments. The final immunoprecipitated DNA product was dissolved in 70 μl of TE. 2 μl of IP DNA was used in PCR reactions. ∼50 ng of the input WCE DNA samples was used. qPCR was performed on iCycler (Bio-Rad) using iQ SYBR Green PCR supermix (Bio-Rad). PCR efficiencies of primers were examined by standard curve of serial-diluted WCEs input and melting curve functionality. The enrichment was calculated as immunoprecipitation signal vs whole cell lysate input (IP/WCE). Antibody used for IP: rabbit anti-Ngn1 (from Greenberg lab, Harvard), rabbit anti-Crebbp (CBP A-22) (Santa Cruz). Normal rabbit anti-IgG antibody (Santa Cruz) was used as the negative. The ChIP-PCR primers for miR-9 were GCCACGGTGCTCTTTAATCT (forward) and TGGTCACAGCATAAACAACTCA (reverse). The ChIP-PCR primers for miR-99b were GGGTCACCCATTTCCTTCTT (forward) and TTCTGAAGGAGGAGGGGATT (reverse).
Statistical analysis
Wilcoxon-Mann-Whitney test was used to evaluate the statistical significance of differences between groups. Data are presented as mean of fold change compared to control group ±SEM.eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.[Editors’ note: this article was originally rejected after discussions between the reviewers, but the authors were invited to resubmit after an appeal against the decision.]Thank you for choosing to send your work entitled “Ngn1 inhibits astrogliogenesis through induction of miR-9 during neuronal fate specification” for consideration at eLife. Your full submission has been evaluated by a Senior Editor, a Reviewing Editor, and three peer reviewers. Based on the reviews below, we regret to inform you that your work will not be considered further for publication in eLife at this time. Please note, however, that we would be willing to consider a new submission in the future (with no guarantees of acceptance) should you be able to complete the additional work the reviewers are asking for.The reviewers indicate potential interest in your study, but they express serious major concerns and do not feel that the work, as it stands, represents a convincing advance over previous work. The reviewers suggest additional experiments to help with this: for example, some are to add more in vivo physiological relevance, some are for more control experiments, and some are to add more stainings with other markers besides GFAP to show that the cells really are astrocytes. We aim to publish articles with a single round of revision that would typically be accomplished within two months, so this means that work that has potential, but in our judgment would need extensive additional work, will not be invited as a resubmission.Reviewer #1:This manuscript by Zhao provides data on mechanism by which Ngn1 prevents Stat1/3 phosphorylation, thus inhibiting astrogenesis during a primarily neurogenic stage of development using primarily in vitro approaches. The manuscript extends previous findings that Ngn1 simultaneously promotes neurogenesis and inhibits astrogliogenesis through Stat1/3 phosphorylation (Sun et al., 2001). It also follows up on another study investigating miR-9 as a brain enriched micro-RNA that prevents Stat3 phosphorylation and could inhibit GFAP expression when cotransfected with miR-124a, but not on its own (Krichevsky, 2009).This study extends the mechanism of neuron-glial fate choice. The major strength comprises excellent in vitro culture and biochemical data showing that miR-9 inhibits astrogliogenesis and targets some components of the Jak-Stat pathway to prevent expression of GFAP, an astrocyte marker. However, because the majority of the experiments are performed in vitro, the biological relevance of this pathway in the regulation of neuron-glial fate choice in vivo is not clear. The absence of complete in vivo expression analysis and well-defined gain- and loss-of-function experiments are major deficiencies. As this journal does not generally solicit major revisions, the following comments are provided for the benefit of authors:1) In Figure 2E, in utero electroporation of an miR-9 expression construct at E16.5 decreased number of GFAP positive cells from ∼5% to ∼1% at P40. However, no images comparing control and electroporated are shown. The nature of the experiment prevents much quantitation, or a clear understanding of whether miR-9 is necessary for neurogenesis, neuronal maintenance, or has any physiological relevance to neural development.Regarding the in vivo studies:2) What is the identity, location, and morphology of the GFAP positive cells that have been electroporated by miR-9? Are they periventricular or cortical? Why was the analysis done so late (P40) since other lineage stages might have been missed?3) Related to the above point, the expression pattern of MiR-9 in vivo is not clearly demonstrated. Is it expressed in all astrocytes (note that a marker such as Aldh1l1-GFP should be used to capture early stages of radial glia, protoplasmic as well as fibrous astrocytes), or in regionally specific ways or compartments such as white matter, SVZ, cortex, etc.?4) Electroporation at E16.5 presumably targets the role of Ngn1 during a primarily neurogenic period, when few astrocytes are being produced in vivo. What would the authors propose in terms of the physiological significance of this pathway at this particular time? Would knockdown of mir-9 be expected to increase the number of neurons at the expense of glia? This should be shown.5) Loss-of-function studies in vivo are needed to demonstrate the biological significance of the findings.Regarding both in vivo and in vitro studies:6) Why is only one marker (GFAP) used? Many new markers of astrocyte fate have been identified, including Glast, Glt1, Aldh1l1, Acsbg1, among others. Earlier in development, markers of the glial lineage include Nf1a/b, Sox9, Fgfr3, Id3, etc. These are useful in characterization of the entire lineage, whereas GFAP is a late marker and not expressed by many cortical astrocytes. Thus, the lineage analysis is insufficient.Reviewer #2:Previous work has indicated that in addition to its well-established function of promoting neural specification during development, Ngn1 inhibits astrocytic differentiation by reducing Jak-STAT signaling. In this manuscript, Zhao et al. identify induction of miR-9 as a mechanism linking Ngn1 to reduced Jak-Stat signaling. They identify a region upstream of the miR-9-2 gene that is bound by Ngn1, with overexpression of Ngn1 increasing miR-9 expression. Electoporation of cortical progenitor cells with miR-9 inhibits astrocyte production (as measured by GFAP expression), and transfection of cells with miR-9 reduces expression of LIFRβ, gp130 and JAK1, an effect likely mediated through direct binding to the 3' UTRs of their mRNAs.Overall, the results of the manuscript are interesting, and the experiments seem to have been well performed. Nevertheless, in our view, the results fail to fully support the authors' claim that Ngn1 mediated induction of miR-9 controls the neuronal/astrocyte cell fate specification decision, and it is questionable whether in its current form the manuscript is a sufficient step forward to warrant publication in eLife.1) If the neuronal/astrocytic cell fate decision is being modulated by miR-9, wouldn't miR-9 overexpression be expected to lead to an increase in neuronal numbers as well as the decrease in astrocytes (as is the case for overexpression of Ngn1)? As it stands this conclusion seems to be overstated.2) GFAP (which is under direct regulation by STAT signaling) is used as the sole measure of astrocyte specification. Independent markers (e.g., Slc1a3) should be used to determine whether astrocytes are still specified but fail to express GFAP.3) Relevant to the above point, the fate of the miR-9 transfected cells is unclear. It would seem they do not become neurons, so do they remain uncommitted and continue to proliferate? Do they undergo apoptosis?4) As the authors note, Ngn1 may also inhibit astrocyte specification, GFAP expression and Jak-Stat signaling via additional miR-9 independent mechanisms. Why not perform an experiment co-electroporating Ngn1 with the antisense miR-9 sponge in order to determine the contribution of miR-9 to Ngn1's role in inhibition of astrocyte generation?5) Although the ChIP enrichment for Ngn1 at the region upstream of the miR-9-2 gene appears robust, the actual induction of miR-9 by Ngn1 is a little underwhelming (∼1.5 fold, Figure 1B and E).Reviewer #3:In this manuscript, the authors describe a role for the microRNA miR-9 in the regulation of Jak-Stat signaling and glial differentiation in the cerebral cortex. They report that the proneural basic helix-loop-helix protein Ngn1 binds to the promoter of miR-9 and induces its expression in mouse neural precursor cells. They also show that overexpression of miR-9 inhibits the expression of the cytokine receptors LIFRβ and gp130 and the protein kinase Jak1. They conclude that Ngn1-induced miR-9 inhibits Jak-Stat signaling and hence suppresses astrogliogenesis.The authors report an interesting set of results that should advance our understanding of the temporal regulation of neurogenesis and gliogenesis in the mammalian brain. My major concern is the means of inhibiting endogenous miR-9 is through the use of antisense or sponge technology. These methods could produce non-specific effects, which should be discussed. The authors should test whether endogenous levels of LIFRβ, gp130, and Jak1 are specifically upregulated upon inhibition of endogenous miR-9.Other comments:1) Is the E-box in the promoter of the miR-9 gene evolutionarily conserved?2) In ChIP analyses, the authors should show immunoprecipitation efficiency, as percent of input on the y-axis.3) What is the effect of miR-9 overexpression, antisense, and sponge on neurogenesis and NPC proliferation?4) What are the consequences of combined miR-9 and Ngn1-AQ on Jak-Stat signaling?[Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.]Thank you for resubmitting your work entitled “Ngn1 inhibits astrogliogenesis through induction of miR-9 during neuronal fate specification” for further consideration at eLife. Your revised article has been favorably evaluated by a Senior Editor, a Reviewing Editor, and one reviewer. The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:The authors have added in vivo data and used IHC markers of astrocytes including Aldh1l1 (Abcam), EAA1, and GFAP. The new loss-of-function data supports conclusions. However, it is unclear which progenitors actually express Ngn1 and MiR-9 to affect a neuron-glial cell fate choice in vivo.The paper shows in situ hybridization (ISH) of MiR-9 in neurons in adult brain; however, this is not relevant for the proposed developmental functions. MiR-9 expression peaks at E16 by qPCR and so showing expression by ISH remains a major gap and is needed. While the authors cite technical difficulties, these problems seem overstated given that ISH probes are clearly working in adult tissue and E16 ISH is standard procedure in many labs. The requested data would greatly strengthen the paper.[Editors’ note: the author responses to the first round of peer review follow.]In response to the extensive and insightful comments by the reviewers, we made the following revisions:1) We completed miR-9 in vivo and in vitro loss-of-function studies to fully address the reviewers’ comments (Figure 2 and Figure 3A);2) We completed the quantification analysis of miR-9-regulated astrogliogenesis and neurogenesis in vivo using a neuronal marker, NeuN and two additional astrocyte markers, ALDH1L1 and EAAT1 (Figure 2);3) We added a new figure to show the specificity of miR-9 knockdown sponge configuration (Figure 2–figure supplement 1A);4) We added a new ISH/immunostaining figure to show the neuronal specificity of miR-9 expression (Figure 2–figure supplement 1B);5) We modified the Ngn1 ChIP-PCR figures to clarify the pull down efficiency (Figure 1C and D).Reviewer #1:[…] This study extends the mechanism of neuron-glial fate choice. The major strength comprises excellent in vitro culture and biochemical data showing that miR-9 inhibits astrogliogenesis and targets some components of the Jak-Stat pathway to prevent expression of GFAP, an astrocyte marker. However, because the majority of the experiments are performed in vitro, the biological relevance of this pathway in the regulation of neuron-glial fate choice in vivo is not clear. The absence of complete in vivo expression analysis and well-defined gain- and loss-of-function experiments are major deficiencies. As this journal does not generally solicit major revisions, the following comments are provided for the benefit of authors:In the revised study, we have successfully completed the in vivo gain- and loss-of-function analysis of miR-9-regulated astrogliogenesis by using three astrocyte markers, ALDH1L1, EAAT1 (GLAST, Slc1a3), as well as GFAP (Figure 2). We believe that the in vivo biological relevance of Ngn1-miR-9-Jak/STAT in regulation of neurogenic-to-astrogliogenic transition is well defined now.1) In
, in utero electroporation of an miR-9 expression construct at E16.5 decreased number of GFAP positive cells from ∼5% to ∼1% at P40. However, no images comparing control and electroporated are shown. The nature of the experiment prevents much quantitation, or a clear understanding of whether miR-9 is necessary for neurogenesis, neuronal maintenance, or has any physiological relevance to neural development.We found that overexpression of miR-9 in cortical progenitors started from E16 reduced the number of GFAP+ astrocytes to ∼5% of total GFP+ cells, whereas knockdown of miR-9 significantly increased GFAP+ astrocytes to ∼17% of total GFP+ cells (Figure 2d). We added three representative panels to show the efficiency of in utero electroporation (Figure 2A).In utero electroporation is a powerful tool that allows genetic manipulation in vivo in order to study a broad range of questions from genes to circuits and behaviors (Fukuchi-Shimogori and Grove, Science, 2001, 294:1071; Bai et al., Nat. Neuroscience, 2003, 18:169; Luo et al., Cell, 2015, 161:1175; Niwa et al., Neuron, 2015, 65:480; Lin et al., unpublished data). Since the genetic liabilities for brain regional- or cell type-dependent behavioral traits are difficult to test in traditional knockout and transgenic animals, in utero electroporation can be used as an alternative tool to study biological questions and, in particular, brain regions. Currently, lacking of astroglio-lineage specific or cell lineage specific miR-9 knockout transgenic mice make lineage tracing difficult. Moreover, miR-9-2 traditional knockout mice die in the early weeks of life, which also hampers astroglio-lineage tracing in vivo (Shibata et al., J. Neuroscience, 2011, 31:3407 and personal communication). Therefore, in the current study, we decided to use in utero electroporation approach to study the role of miR-9 in regulation of astrogliogenesis in vivo.The major limitation of in utero electroporation is that this pulse gene delivery approach labels a relatively small number of cells in the cortex. Based on our experience, electroporation of the cortical neural progenitors at E16 labeled layers 2/3 cells. We understand that it is impossible to answer all the questions by using in utero gene delivery approach, however, in our opinion, in utero electroporation is a practical and effective tool to analyze the role of miR-9 in regulating cell fate in vivo.Regarding the in vivo studies:2) What is the identity, location, and morphology of the GFAP positive cells that have been electroporated by miR-9? Are they periventricular or cortical? Why was the analysis done so late (P40) since other lineage stages might have been missed?Cortical progenitors electroporated at E16 migrated to layers2/3 (GFP+) (Figure 2A). We found very few GFP+ cells remained in the periventricular zone including corpus callosum. Our GFAP immunostaining showed that in the cortex, GFAP+ cells mainly resided in the periventricular region and the superficial layers (layers 2/3 and the marginal zone) of the cortex. We observed that GFAP/GFP double+ cells in general have small and uniform nuclei with fluffy lamellipodium-like peripheral structure. We could not clearly identify the fine processes solely based on the GFP signal.We analyzed the cell lineage in adult animals because we sought to study the long-lasting effects of Ngn1-driven miR-9 regulation of astrocyte fate.3) Related to the above point, the expression pattern of MiR-9 in vivo is not clearly demonstrated. Is it expressed in all astrocytes (note that a marker such as ALDH1L1-GFP should be used to capture early stages of radial glia, protoplasmic as well as fibrous astrocytes), or in regionally specific ways or compartments such as white matter, SVZ, cortex, etc.?We added a miR-9 in situ hybridization (ISH) combined with an immunostaining figure to show the expression of miR-9 in the cortical region (Figure 2–figure supplement 1B). We showed that in the cortex, miR-9 was expressed in ependymal cells and NeuN+ cortical neurons in layers 2-6, but not in the marginal zone and corpus callosum where abundant GFAP+ cells reside. We could not successfully perform miR-9 ISH and immunostaining with other astrocyte markers, such as ALDH1L1 and EAAT1, mainly due to the hash ISH procedures and the nature of the antibodies.4) Electroporation at E16.5 presumably targets the role of Ngn1 during a primarily neurogenic period, when few astrocytes are being produced in vivo. What would the authors propose in terms of the physiological significance of this pathway at this particular time? Would knockdown of mir-9 be expected to increase the number of neurons at the expense of glia? This should be shown.We chose the time point E16 because we sought to target astrocyte progenitors in the germinal zone of the cortex, which were believed to raise after the peak of neurogenesis (E14-15) (Sauvageot and Stiles, Current Opinion in Neurobiology, 2002, 12:244-249).We found that overexpression of miR-9 did not significantly increase the number of cortical neurons both in vivo and in vitro, whereas knockdown of miR-9 did reduce it (Figures 2 and 3A). We reason that this could be due to some sort of “ceiling” effect of miR-9 expression during the period of neurogenesis in neuronal progenitors. Our ISH data showed that during this period of time, miR-9 was highly expressed in the germinal zone in mouse brains (Lin at al., unpublished data).5) Loss-of-function studies in vivo are needed to demonstrate the biological significance of the findings.It has been completed both in vivo and in vitro (Figures 2 and 3A).Regarding both in vivo and in vitro studies:6) Why is only one marker (GFAP) used? Many new markers of astrocyte fate have been identified, including Glast, Glt1, Aldh1l1, Acsbg1, among others. Earlier in development, markers of the glial lineage include Nf1a/b, Sox9, Fgfr3, Id3, etc. These are useful in characterization of the entire lineage, whereas GFAP is a late marker and not expressed by many cortical astrocytes. Thus, the lineage analysis is insufficient.In the revised study, we used two more astrocyte markers, ALDH1L1 and EAAT1 to show the role of miR-9 in regulating astrogliogenesis (Figure 2).Reviewer #2:[…] Overall, the results of the manuscript are interesting, and the experiments seem to have been well performed. Nevertheless, in our view, the results fail to fully support the authors' claim that Ngn1 mediated induction of miR-9 controls the neuronal/astrocyte cell fate specification decision, and it is questionable whether in its current form the manuscript is a sufficient step forward to warrant publication in eLife.By using in utero electroporation combined with immunostaining, we have completed the in vivo gain- and loss-of-function analysis to demonstrate the role of miR-9 in regulating astrogliogenesis.Specifically:1) If the neuronal/astrocytic cell fate decision is being modulated by miR-9, wouldn't miR-9 overexpression be expected to lead to an increase in neuronal numbers as well as the decrease in astrocytes (as is the case for overexpression of Ngn1)? As it stands this conclusion seems to be overstated.Please see response to point 4 from Reviewer #1.2) GFAP (which is under direct regulation by STAT signaling) is used as the sole measure of astrocyte specification. Independent markers (e.g., Slc1a3) should be used to determine whether astrocytes are still specified but fail to express GFAP.We analyzed the role of miR-9 in regulating astrogliogenesis using two more astrocytes markers, ALDH1L1 and EAAT1 (Figure 2B, C).3) Relevant to the above point, the fate of the miR-9 transfected cells is unclear. It would seem they do not become neurons, so do they remain uncommitted and continue to proliferate? Do they undergo apoptosis?Cortical progenitors in utero electroporated at E16 migrated to layers2/3 (GFP+). We did not observe overt migration and cell number differences among miR-9, miR-9AS, and the control. We found there were very few if any GFP+ cells remained in the SVZ at postnatal day 8 (Figure 2A), suggesting that neither knockdown nor overexpression of miR-9 affected cell proliferation when in utero electroporation was carried out at E16. Interestingly, we observed that the total number of astrocyte marker and the neuronal marker NeuN double+ cells is about 80% of total GFP+ cells in all experimental conditions (Figure 2). Although the fate of the remaining ∼20% GFP+ cells in the layers 2/3 have yet to be understood, our study clearly demonstrated that perturbation of miR-9 starting at the later stage of embryonic development impaired astrogliogenesis but not neurogenesis.4) As the authors note, Ngn1 may also inhibit astrocyte specification, GFAP expression and Jak-Stat signaling via additional miR-9 independent mechanisms. Why not perform an experiment co-electroporating Ngn1 with the antisense miR-9 sponge in order to determine the contribution of miR-9 to Ngn1's role in inhibition of astrocyte generation?We did not perform the suggested assay for two major reasons:a) Ngn1 inhibits glial differentiation by at least two mechanisms: the sequestration regulation (Sun at al., Cell, 2001) and transcriptional regulation (Sun et al., Cell, 2001; He et al., Nat. Neuroscience, 2005 and the current study). Ngn1-miR-9-Jak/STAT pathway only contributes partially to the Ngn1 signaling that prevents astrogliogenesis.b) The in utero electroporation experiment only transfects a relative small number of astrocyte lineage cells (∼10% of total transfected cells) in the cortex. Therefore, the rescue effect of miR-9 antisense sponge in Ngn1 overexpressing cells would be difficult to analysis.In the current study, by miR-9 and Ngn1 qPCR, Ngn1 ChIP-qPCR, and luciferase assays, we demonstrated that Ngn1 directly induced miR-9 expression during the neurogenic period. By miR-9 gain- and loss-of-function studies in vivo and in vitro, we showed that during the time period of neurogenesis, miR-9 mediated Ngn1 in inhibiting astrogliogenesis. By luciferase assay and western blotting analysis, we showed that miR-9 directly targeted LIFRβ, gp130, and Jak1 of Jak-Stat pathway. We also performed the rescue assay using constitutive active form of STAT3, STAT3C in miR-9 overexpressing cells to close the signaling loop between miR-9 and Jak-Stat. In sum, we provided clear and convincing evidences to demonstrate the role of Ngn1-miR-9-Jak/STAT pathway in regulating neurogenic-to-astrogliogenic transition.5) Although the ChIP enrichment for Ngn1 at the region upstream of the miR-9-2 gene appears robust, the actual induction of miR-9 by Ngn1 is a little underwhelming (∼1.5 fold,
).Our miR-9 qPCR analysis and miRNA next generation sequencing data showed that miR-9 was one of the most abundant expressed miRNAs in the cortex during prenatal and neonatal periods. For example, the reads of miR-9 RNAseq was >10-fold greater than that of a neuronal specific miRNA, miR-124 in the cortex in neonatal cortex. Therefore, although there was >=1.5-fold increase (Figure 1E), the absolute increase in miR-9 number was massive.Reviewer #3:[…] The authors report an interesting set of results that should advance our understanding of the temporal regulation of neurogenesis and gliogenesis in the mammalian brain. My major concern is the means of inhibiting endogenous miR-9 is through the use of antisense or sponge technology. These methods could produce non-specific effects, which should be discussed. The authors should test whether endogenous levels of LIFRβ, gp130, and Jak1 are specifically upregulated upon inhibition of endogenous miR-9.In Figure 2–figure supplement 1A, we demonstrated the efficiency and the specificity of the miR-9 knockdown sponge configuration. Our luciferase assay showed that 3-nt mutations in the miR-9 seed region abolished the binding of overexpressed mature miR-9.Other comments:1) Is the E-box in the promoter of the miR-9 gene evolutionarily conserved?There are 2 E-box sequences (CATATG) within 5kb upstream of humanmiR-9-2 pre-miRNA (around -1350bp and -4200bp). There are 3 E-box sequences within 5kb upstream of Rhesus monkeymiR-9-2 pre-miRNA (around -1350bp, -1940bp, and -2970bp). The upstream sequence distance of miR-9-2 (homology) between mouse and human is 79.6%. The upstream sequence distance of miR-9-2 (homology) between mouse and Rhesus monkey is 79.6%.2) In ChIP analyses, the authors should show immunoprecipitation efficiency, as percent of input on the y-axis.We revised the Ngn1 ChIP-qPCR figures to demonstrate the ChIP assay pull down efficiency (Figure 1C and D). Since Ngn1 is a transcription factor, the pull down efficiency compared to input is lower than abundant proteins such as histones, etc. However, the percentage is within reasonable range as others have reported in the literature. As a negative control, we also included the relative IgG pull down efficiency side by side for a better understanding of the ChIP experiment.3) What is the effect of miR-9 overexpression, antisense, and sponge on neurogenesis and NPC proliferation?Please see response to point 4 from Reviewer #1.4) What are the consequences of combined miR-9 and Ngn1-AQ on Jak-STAT signaling?We previously reported that AQ-Ngn1, when overexpressed, could partially reduce STAT1/3 phosphorylation (Sun, Nadal-Vicens et al., Cell, 2001). We have previously also published that Jak-Stat signaling has a positive auto-regulation loop, where phosphor-STAT1/3 activates gp130 and jak1 expression (He et al., Nat. Neuroscience, 2005). Therefore, AQ-Ngn1, by sequestration of the transcriptional coactivator CBP, should inhibit STAT1/3 mediated activation of gp130 and Jak1, which in turn inhibit STAT1/3 phosphorylation. In the current study, we revealed a Ngn1-regualted miR-9 signaling pathway that governs the initiation of astrogliogenic cell fate specification during cortical development (Figure 3F). It seemed that the Ngn1 sequestration regulation and the Ngn1-miR-9 regulation acted jointly to warrant the neuronal cell fate specification. Thus, we rationalize that the combination of miR-9 and Ngn1-AQ will strongly suppress Jak-Stat signaling and block astrogliogenesis.[Editors’ note: the author responses to the re-review follow.]The authors have added in vivo data and used IHC markers of astrocytes including Aldh1l1 (Abcam), EAA1, and GFAP. The new loss-of-function data supports conclusions. However, it is unclear which progenitors actually express Ngn1 and MiR-9 to affect a neuron-glial cell fate choice in vivo.Temporal analysis of miR-9 expression in mouse cortex by in situ hybridization (ISH) showed that the mature miR-9 was extensively expressed in the VZ/SVZ progenitors. The expression levels of miR-9 decreased dramatically in the cortical germinal zone in neonatal brains (P1 and P7) (Figure 1B). Studies by Britz et al. and Ge et al. (our lab) showed that in mid-stage cortical development (E14-E15.5), Ngn1 was highly expressed in the ventricular zone (VZ) and the subventricular zone (SVZ) progenitors. It was less abundant near the ventricular surface (Britz et al., Cerebral Cortex, 2006, 16:i138 and Ge et al., PNAS, 2006, 103:1319).Our ISH data showed that at the mid-stage of cortical development (E16), the expression level of miR-9 was also low or undetectable in a small subset of the ventricular progenitors (Figure 1B). It appeared that this small set of cells expanded in P1 and P7 SVZ, suggesting that these cells may contribute to a portion of astrocytes in the cortex. In the current study, by employing an in utero electroporation approach, we pulse-labeled progenitors in the ventricular surface at E16 that produced astrocytes in the superficial neocortical layers. It seemed that this subset of progenitors expressed low or undetectable Ngn1 and miR-9 during the time period of astrogliogenesis. It would be interesting to examine the fates of this progenitor pool in a following study.The paper shows in situ hybridization (ISH) of MiR-9 in neurons in adult brain; however, this is not relevant for the proposed developmental functions. MiR-9 expression peaks at E16 by qPCR and so showing expression by ISH remains a major gap and is needed. While the authors cite technical difficulties, these problems seem overstated given that ISH probes are clearly working in adult tissue and E16 ISH is standard procedure in many labs. The requested data would greatly strengthen the paper.We added the temporal ISH analysis of miR-9 expression in developing mouse cortex in Figure 1B.
Authors: A Bonni; Y Sun; M Nadal-Vicens; A Bhatt; D A Frank; I Rozovsky; N Stahl; G D Yancopoulos; M E Greenberg Journal: Science Date: 1997-10-17 Impact factor: 47.728
Authors: Weihong Ge; Fei He; Kevin J Kim; Bruno Blanchi; Volkan Coskun; Laurent Nguyen; Xiangbing Wu; Jing Zhao; Julian Ik-Tsen Heng; Keri Martinowich; Jifang Tao; Hao Wu; Diogo Castro; Magdi M Sobeih; Gabriel Corfas; Joseph G Gleeson; Michael E Greenberg; Francois Guillemot; Yi E Sun Journal: Proc Natl Acad Sci U S A Date: 2006-01-23 Impact factor: 11.205
Authors: Quan Lin; Ravikumar Ponnusamy; Jocelyn Widagdo; Jung A Choi; Weihong Ge; Christine Probst; Tyler Buckley; Mimi Lou; Timothy W Bredy; Michael S Fanselow; Keqiang Ye; Yi E Sun Journal: Proc Natl Acad Sci U S A Date: 2017-08-08 Impact factor: 11.205
Authors: Beate Roese-Koerner; Laura Stappert; Thomas Berger; Nils Christian Braun; Monika Veltel; Johannes Jungverdorben; Bernd O Evert; Michael Peitz; Lodovica Borghese; Oliver Brüstle Journal: Stem Cell Reports Date: 2016-07-14 Impact factor: 7.765
Authors: Sisu Han; Daniel J Dennis; Anjali Balakrishnan; Rajiv Dixit; Olivier Britz; Dawn Zinyk; Yacine Touahri; Thomas Olender; Marjorie Brand; François Guillemot; Deborah Kurrasch; Carol Schuurmans Journal: Development Date: 2018-10-01 Impact factor: 6.868