Literature DB >> 26244005

De Novo Transcriptome Assembly and Development of Novel Microsatellite Markers for the Traditional Chinese Medicinal Herb, Veratrilla baillonii Franch (Gentianaceae).

Lei Wang1, Zhengkun Wang1, Jianbing Chen2, Chunyan Liu1, Wanlong Zhu1, Liuyang Wang3, Lihua Meng1.   

Abstract

Veratrilla baillonii Franch is an important Chinese medicinal herb for treating liver-related diseases, which has been over-collected in the recent decades. However, the effective conservation and related population genetic study has been hindered because of the lack of genome sequences and genetic markers in the natural population. We have conducted RNA-seq on V. baillonii. We performed de novo assembly of these data to characterize the V. baillonii transcriptome, resulting in 133,019 contigs with size >200 bp. These contigs were annotated using the NCBI nonredundant database and Gene Ontology (GO) terms. From these contigs, we developed novel microsatellite simple sequence repeat (SSR) markers, identifying a total of 40,885 SSRs. SSRs with repeat motifs of 1-4 bp (mono-, di-, tri-, and tetranucleotides) accounted for 99.8% of all SSRs, with mononucleotide repeats most common, followed by dinucleotide (16.2%) and trinucleotide repeats (14.7%). We selected 151 SSRs for experimental validation, of which 74 were confirmed by polymerase chain reaction. Fourteen SSRs were determined to be polymorphic by screening 40 individuals from six distant populations. The number of alleles per locus ranged from two to four, and the expected heterozygosity varied from 0.2637 to 0.8571, suggesting that these SSR markers are highly polymorphic and effective for further genetic analysis in the nature population. In addition, we explored the genetic structure of V. baillonii using five SSRs in four geographic populations and found that the identified genotypes were clustered into two phylogenetic clades: the Mekong River clade and Jinsha River clade. This result indicates that these two regions may harbor highly divergent genetic lineages and enriched genetic diversity. The de novo transcriptome sequences and new SSR markers discovered by this study provide an initial step for understanding the population genetics of V. baillonii, and a valuable resource for effective conservation management.

Entities:  

Keywords:  Illumina RNA-Seq; Veratrilla baillonii; microsatellite (SSR) markers; transcriptome

Year:  2015        PMID: 26244005      PMCID: PMC4498661          DOI: 10.4137/EBO.S20942

Source DB:  PubMed          Journal:  Evol Bioinform Online        ISSN: 1176-9343            Impact factor:   1.625


Introduction

Microsatellites, or simple sequence repeats (SSRs), are short tandem repeats of 1–6 bp nucleotides, which have increasingly been used in population genetics analysis, crop breeding, and conservation genetics. SSRs are widespread in both protein-coding and noncoding regions in plants.1 Because of their abundance, high levels of allelic variation, and codominant inheritance characteristics, SSRs are considered to be an effective genetic marker in genetic diversity analysis, gene tagging, and conservation biology in plants.2,3 SSRs are generally categorized into two common groups based on their origins, genomic SSRs from genomic sequences, and expressed sequence tag (EST)-SSRs from transcribed RNA sequences.4 The de novo development of genomic SSRs is time consuming and labor intensive, involving the screening of a genomic DNA library screening with specific SSR probes to isolate the microsatellite sequences.4 In contrast, development of EST-SSR markers has many advantages, including low cost, technical simplicity, and the ability to capture the functional diversity in natural populations or germplasm collections, as well as high transferability to related species.4 The NCBI dbEST database collects cDNA sequences from a number of organisms. However, dbEST does not include the vast majority of known species, having particular poor coverage of nonmodel organisms, especially those with low economic value. Lack of EST data makes it difficult to develop effective EST-SSR markers. Next-generation sequencing (NGS) is an important tool for generating large quantities of genomic data from nonmodel organisms in a cost-effective manner. In particular, genome-scale transcriptome analysis by RNA-seq enables identification of genes that have high differential expression in response to environment changes, determination of the genetic basis of critical phenotypes, and mapping genomic diversity in nonmodel organisms. RNA-seq can accelerate the development of SSR markers, which is particularly useful for genetic analysis in the nonmodel species. Nonmodel plant species that have benefited from RNA-seq based SSR marker development include Lilium,5 buckwheat (Fagopyrum esculentum and F. tataricum),6 and big sagebrush (Artemisia tridentata).7 EST-SSRs have provided a direct and reliable approach for exploring the genetic diversity and evolutionary history in these species. Veratrilla baillonii Franch (Gentianaceae) is an important Chinese medicinal herb that is distributed only in the eastern Himalayas and Hengduan Mountains of southwest China. V. baillonii has been widely used to cure liver-related diseases with a common name of “Jin Bu Huan”.8 Because of the overexploitation, the distribution and natural populations for V. baillonii have shrunk substantially in recent years. However, the effective conservation management has been hampered by the lack of genome information and effective genetic markers. In this study, we aimed to obtain a de novo transcriptome for V. baillonii via RNA-seq and develop efficient SSR markers. We assembled the resulting genome-scale expression data, generating what is, to the best of our knowledge, the first reported transcriptome sequence for V. baillonii. We screened this transcriptome for identifying 40,885 putative EST-SSR markers. We selected 151 of these SSRs for experimental testing, which validated 74 markers. Further examination demonstrated 14 SSR markers to be highly polymorphic across six distant populations. This de novo transcriptome assembly and collection of SSR markers represent a first step toward the large-scale genomic analysis of V. baillonii. These resources can be used for further studies on genetic diversity and population demographic history, and as a tool in developing conservation strategies.

Methods

Plant material

V. baillonii is an important Chinese medicinal herb and grows only in the high altitudes (3700–4600 m) of the Himalaya–Hengduan Mountains in southwest China. During July 2013, we sampled the fresh leaves of V. baillonii from Shangri-la in northwest Yunnan (28°31′0″N, 99°57′0″E, alt. 4514 m) and quickly stored in liquid nitrogen. In addition, 40 individuals from six populations were collected and kept in silica gel for DNA extraction, polymerase chain reaction (PCR) amplification, SSR marker validation, and analysis of genetic diversity. Detailed information for the plant materials was listed in Supplementary Table 1.
Table 1

Summary of assembly and annotation results for V. baillonii.

V. BAILLONII
Total number of high quality reads28483317
Total number of contigs133019
Total size of contigs (bp)168009542
Mean length of contigs1263
N50 value of contigs2104
Length range of contigs201–13830
GC content40.6%
Total number of identified SSRs40885
SSRs containing sequences with BLASTx hit28912 (70.7%)
SSRs containing sequences with annotation11148 (27.3%)

RNA extraction and sequencing

Total RNA was extracted from the samples, using a CTAB procedure.9 A260/A280 ratios of the RNA samples dissolved in 10 mm Tris (pH 7.6) ranged from 1.9 to 2.1. The integrity of the RNA samples was examined with an Agilent 2100 Bioanalyzer and their RIN (RNA integrity number) values ranged from 8.6 to 10.0, with no sign of degradation. RNA from each replicate was pooled with equal volumes to obtain enough RNA for RNA-Seq. A total of 20 µg RNA was used for RNA sequencing, and the mRNA was fragmented into small pieces using divalent cations at an elevated temperature. The cDNA library was constructed via poly-A enriched RNA method, and 200–300 bp fragments were chosen for paired-end sequencing based on Illumina protocols (San Diego, CA, USA). The double strands were synthesized with random hexamer primers. The short fragments were purified with the QIAquick PCR Purification kit (Qiagen Inc.). The purified DNA libraries were first amplified via PCR and then sequenced on Illumina HiSeq™ 2000 platform.

De novo assembly

Raw reads were first filtered by removing the adaptors and reads with >eight ambiguous bases and >50% of the bases with a quality score ≤5 using in-house Perl scripts (available upon request). The transcriptome sequence was assembled into distinct contigs by Trinity tools10 with default parameters. For convenience, we used those unigenes to represent the nonredundant (NR) contigs in the further analysis.

SSR locus search, primer acquisition, and validation

The unigenes were used for detecting SSR loci by Micro-SAtellite (MISA, http://pgrc.ipk-gatersleben.de/misa).11 Criteria includes a minimum of five repeats for simple motifs, and three repeats for complex or imperfect repeats, a motif length of 2–10 bp, and for compound SSRs, a maximum interruption distance of 100 bp between different SSRs. To facilitate SSR detection, only 1–6-nucleotide motifs were considered, and the minimum repeat unit was defined as 10 for mono-, 6 for di-, and 5 for tri-, tetra-, penta-, and hexanucleotides. Primer pairs of each unique SSR were designed using Primer 3.0,12 with target microsatellites containing at least five repeats and yielding PCR products of 80–500 bp. One hundred fifty-one primer pairs were synthesized and used for validation (Supplementary Table 2). Screened primer pairs giving good amplification were subsequently used to characterize polymorphism among 40 individuals from six populations (Supplementary Table 1). PCR was performed in a 25-µL volume, containing 10–40 ng plant DNA. The PCR reactions were carried out under the following conditions: DNA initial denaturation at 94 °C for 4 minutes, 35 cycles of 94 °C for 1 minute 30 seconds, annealing temperature ranging from 45 °C to 60 °C for 50 seconds, 72 °C for 50 seconds, and a final extension at 72 °C for 7 minutes. The PCR products were purified before sequencing to remove excess primers and deoxynucleotide triphosphates using a TIAN quick Midi Purification Kit (Tiangen Biotechnology Co. Ltd.), and then, sequencing reactions were performed using ABI Prism Sequencing Ready Reaction Kit with the same primers as PCRs and analyzed on the ABI 3730 genetic analyzer (Applied Biosystems).
Table 2

Counts of various SSR types with different repeat motifs in V. baillonii.

REPEATSCOUNTS
Mono-nucleotide27136
A/T26360
C/G776
Bi-nucleotide6620
AC/GT1631
AG/CT1739
AT/AT3245
CG/CG5
Tri-nucleotide6010
AAC/GTT215
AAG/CTT1828
AAT/ATT572
ACC/GGT612
ACG/CGT63
ACT/AGT197
AGC/CTG1036
AGG/CCT768
ATC/ATG594
CCG/CGG125
Tetra-nucleotide1014
Penta-nucleotide105
Hexa-nucleotide0

Functional annotation for unigenes containing SSRs

Functional annotation of SSR-containing coding sequences was conducted using the program Blast2GO.13 All the SSR-containing unigenes were blasted against the NCBI’s NR protein database using BLASTx. The E-value threshold was set as 1e-6. The contig was assigned with gene names according to best BLASTx hits. The distributions of functional categories were plotted with the program WEGO.14

Population genetic analyses

We used POPGEN v1.3215 to calculate the number of alleles and expected and observed heterozygosity. Five primer pairs were selected for phylogenetic analysis using 23 individuals from four populations. We used MEGA616 to construct the dendrogram tree using the unweighted pair-group as implemented in the UPGMA method.

Results and Discussion

A total of 28,483,317 high-quality RNA-Seq reads passed our stringent quality assessment and filtering. We used the Trinity assembler,10 to assemble these reads, resulting in 133,019 contigs. The length of the contigs in our assembly ranged from 201 to 13830 bp, with an average 1263 bp and median of 850 bp. The N50 value of our assembly is 2104 bp. N50 is an important measurement for quantifying assembly quality and is measured by the length of the contigs for which all contigs of that length or longer contain 50% of the bases in the assembly. The N50 for V. baillonii transcriptome assembly is much higher than those from lily17 and Gossypium arboreum.18 The GC-content of our assembly is 40.6% (Table 1). The distribution of contig sizes follows a power-law-like distribution, with the number of contigs decreasing with increasing contig length (Fig. 1), as observed in Primula poissonii and P. wilsonii.19
Figure 1

Length distributions for all 133,019 transcriptome contigs for V. baillonii, of size >200 bp.

Frequency and distribution of different types of SSR markers

MISA was used to analyze the 133,019 contigs, identifying 40,885 putative SSRs (Table 1). The number of SSRs obtained in this study was lower than known model plants, including Arabidopsis thaliana (50,092), Medicago truncatula (152,461), Oryza sativa (135,265), and Sorghum bicolor (129,564).20 The density of SSRs was 243.3 per Mb for V. baillonii, which was higher than Brachypodium distachyon (191.3 per Mb) and S. bicolor (175.4 per Mb).20 The reduced number and high density of SSRs may indicate unique evolutionary history for V. baillonii. A detailed summary of SSRs, including repeat motif and total number of different repeat motifs, is shown in Table 2. SSRs with repeat motifs of 1–4 bp (mono-, di-, tri-, and tetranucleotides) accounted for 99.8% of the total (Table 2). The frequency of SSRs decreased with the increase of motif length (mono- to hexanucleotide repeats), with mononucleotide being the dominant repeat unit. Proportions of dinucleotide and trinucleotide repeats were 16.2% and 14.7%, respectively. The combined number of tetra-, penta-, and hexanucleotide repeats accounted for 2.7% of SSRs, which was higher than in Populus trichocarpa (1.66%), M. truncatula (0.94%), O. sativa (2.54%), B. distachyon (2.45%), and A. thaliana (0.53%).20 Of the two possible types of mononucleotide repeats, the most abundant was (A/T)n (97.1%), as in most plants,20,21 and the (G/C)n contributed 1.90% to total SSRs, which was higher than 0.05% in tree peony.21 For the dinucleotide repeat category, different species have unique motif frequency distributions. For example, AG/CT repeats were more frequent in B. distachyon and O. sativa with 50.7% and 41.9% frequencies, respectively, whereas AT/AT repeats were more frequent in P. trichocarpa (60.5%) and M. truncatula (59.9%). Similar to the latter two species, AT/AT repeats in V. baillonii were most abundant, accounting for 49.0% of dinucleotide repeats. The AC/GT and AG/CT repeats were abundant in V. baillonii, accounting for 24.6% and 26.3% of dinucleotide repeats, respectively. The CG/CG repeats contributed <0.08%, similar to P. trichocarpa, M. truncatula, and A. thaliana, suggesting that CG-rich motifs were the least preferred in dicot genomes. Trinucleotide repeats AGC/CGT, AGG/CCT, and CCG/CGG were observed more frequently in all the monocot species, whereas A/T-rich repeats, such as AAC/GTT, AAG/CTT, and AAT/ATT, were preferred in dicots. Similar to the results of Sonah et al.20, A/T-rich repeats were the dominant trinucleotide SSRs in V. baillonii. In addition, AGC/CTG repeats were abundant, accounting for 15.6%. The dominant occurrence of repeat motifs from particular sequences with certain size in plant genomes is generally caused by natural selection. However, like in tree peony, ACG/CGT and CCG/CGG repeats were scarce, which may be because of highly mutable CpG dinucleotide repeats. The CCG repeats may also be under selection, which could be because of specific splicing pattern for the maintenance of other related tandem repeat forms.22 The overall absence of a particular repeat motif may also indicate the presence of strong selective pressure.22 Replication slippage is the most common mechanism for creating and/or mutating microsatellites, involving changes of motif repeats. However, the molecular mechanisms for the origin of microsatellites are still not clear. SSR loci were divided into two groups based on the size of SSR tracts and possible informative genetic markers: Class I, or hypervariable markers, consisted of SSRs ≥20 bp, and Class II, or potentially variable markers, consisted of SSRs ≥12 bp and <20 bp. Class I microsatellites are generally highly polymorphic and more informative because of the large size and long repeats, which was first observed in human beings,23 and subsequently confirmed by studies in a number of other organisms, including rice.22,24 Class II microsatellites are less variable, representing mutations that have accumulated recently because of sporadic SSR expansion. In V. baillonii, 6.8% of SSRs were categorized as Class I microsatellites and 93.2% as Class II microsatellites. The small fraction of Class I microsatellites may make it difficult to further develop efficient and polymorphic microsatellite markers in V. baillonii. The preponderance of short SSRs could reflect from the characteristics of physiology or development, or may simply be a result of genetic drift.

SSR-containing coding sequences annotation

A large number of the contigs in our assembly (28,912, 70.7%) had more than one hit in the NCBI NR database with an E-value of 1e-6. This percentage was higher than P. poissonii (65.6%) or P. wilsonii (65.1%).19 We performed Gene Ontology (GO) annotation on unigenes containing the SSRs. The number of SSR-containing genes in each GO classification is shown in Figure 2. A total of 11,148 contigs containing SSRs were annotated, representing 27.3% of total identified SSRs. The unigenes were annotated with the three categories: cellular component, molecular function, and biological processes. For the cellular component category, the two most common were cell and cell part. For the molecular function category, catalytic activity was abundant, followed by binding. The biological processes category, cellular process, and metabolic process were the most abundant terms (Fig. 2). These results may give hints of function constraints in V. baillonii, and similar results were reported in other plants, such as tree peony and P. poissonii and P. wilsonii.19
Figure 2

GO classification of SSRs in coding regions. The x-axis refers to the three functional classes. The y-axis indicates the percentage (left) and number (right) of genes that contain an SSR, which belong to each functional class.

Validation of SSR assays and UPGMA analysis

RNA-seq is a labor- and cost-effective method to identify a large number of candidate SSRs for organisms such as V. bailloni, which are not represented in dbEST. RNA-seq for SSRs development is particularly attractive in comparison to the cost and labor-intensive process of identifying genomic SSRs. In order to validate the identified SSRs, we designed 151 pairs of SSRs primers for PCR screening in six natural populations. PCR amplification was successful for 74 of these SSRs (Supplementary Table 2). Microsatellites containing the (AT)n repeats represented the most abundant and polymorphic type among all markers, but we only obtained PCR products from a few of these markers, similar to rice.25 The validated primers were subsequently used to characterize genetic polymorphism among 40 individuals from six populations (Supplementary Table 1). Of these, 14 were found to be polymorphic. The number of alleles per locus ranged from two to four, and the expected heterozygosity varied between 0.2637 and 0.8571, which was higher than tree peony of which observed heterozygosity ranged from 0.0000 to 0.8751 (Table 3). Then, we identified eight distinct genotypes among 23 individuals from four populations using five primer pairs (Supplementary Table 3). The eight genotypes were grouped into two major clusters in the UPGMA dendrogram (Fig. 3). Cluster I was only composed of the YN Deqin population from Mekong River. Cluster II contained five genotypes collected from YN Dali, Lijiang, and SC Jiulong populations, which generally fall into the Jinsha River region. The phylogenetic relationship is generally in agreement with the geographic locations, indicating that the river formation might play a critical role in shaping present genetic structure in V. baillonii. However, we cannot rule out the effect of past climate changes, for example, the Pleistocene glacial–interglacial climate cycles. Elucidating this will require further assessment with additional population.
Table 3

Fourteen SSR primers, size, and summary statistic across four populations in V. baillonii.

LOCUSREPEATForward primer (5′–3′)reverse primer (5′–3′)Ta (°C)SIZE(BP)NaHeHo
HQJ19(TA)6TTTGCTTACCGTTTGTCCAATGCTTCCAGCCTATCC52187–19220.33100.0000
HQJ34(TGG)6CGTTACGGTCTTTCCTTGAATACCTCACTCCTCCACAT58191–19740.60950.1111
HQJ35(TAAAA)4CCGAACAAACAACTCATTTCCTGTATTCACCCTCCT54163–17820.36920.0000
HQJ37(AAGA)5GCTCGTTTCGTTTGTTTCGTCGGTTATGAGATTCCATC58105–12940.68410.1667
HQJ40(GAT)7AGCGTCTATTGGGCAGTGAAAAGCAGAGTGAAGAAACATC5852–14940.52700.3333
HQJ45(AT)6CAGCCTCACGCTCAACAACGACGGCCTACCATCTTT55195–19930.77500.3750
HQJ56(TA)9CTAAAAATGATGAACTCCCGAAAAAACTGAGCAGCACAGCACAAC5898–10640.70330.8751
HQJ63(TA)5ACGGAGGACATCACGAGCTGGCAGGGCAAACCATAT52116–11820.26370.0000
HQJ79(AGA)6CAGCTTGCGAGGATACGGCTTCCCAAACTGCGAGGC58157–16220.66670.0000
HQJ99(GCC)6GAGCAATCAGGAGGAGGGGGGAAATGAACAGCGACTT60156–16820.35560.0000
HQJ103(ACTC)5TGACTCCTTGACTGACCCTCTGCAGCAGCTTGCTTTAT58122–13330.53330.0000
HQJ115(AT)10GTTCTGTTGCTACCTGTGTTGTCTCATTTTGCTTTC56200–20920.85711.0000
HQJ134(TA)9TCCTCCTCCTTTATCACAGTGCAGTATTAAGCGTTG57365–37730.54551.0000
HQJ137(AC)9TTTCACGCTCATCTTTTACCTTTTGGCAGTCATTAT52231–23320.54551.0000

Abbreviations: Size, size of cloned allele; Ta, annealing temperature; Na, number of alleles; He, expected heterozygosity; Ho, observed heterozygosity.

Figure 3

UPGMA dendrogram constructed based on eight genotypes from four representative populations and five SSR markers developed in this study. Two clusters were identified, generally corresponding to two geologic locations: the Mekong River and the Jinsha River (YN, Yun Nan Province; SC, Si Chuan Province).

Plant genomes are very complex and contain large amounts of repetitive DNA, including microsatellites, which has immediate practical implications for the success of SSR marker development. The 14 SSRs identified in this study represent high-quality and polymorphic genomic loci, which will allow us to further explore the genetic diversity and genetic structure in wild populations of V. baillonii. These markers will be an important tool in characterizing the phylogeographic patterns and evolutionary history of V. baillonii and related species of Veratrilla and will help guide development of a conservation strategy for this traditional medicinal plant.

Conclusions

In this study, we used RNA-seq to determine a de novo transcriptome for V. baillonii. We identified a number of microsatellite markers from the de novo transcriptome sequences and carried out experimental validations for 151 SSRs. Finally, 14 SSR markers were found to be polymorphic, making them useful tools for future studies in this species. The de novo transcriptome and SSR markers identified in this study provide an initial step and valuable resources for understanding the genetic diversity and population history of V. baillonii and for the development of a conservation strategy for this species. Supplementary Table S1. Locations of populations of sampled V. baillonii. Supplementary Table S2. Primer pairs synthesized and used for validation based on SSR sequences from V. baillonii. Supplementary Table S3. The frequency of repeat motif for eight genotypes observed in V. baillonii.
  20 in total

1.  Estimation of average heterozygosity and genetic distance from a small number of individuals.

Authors:  M Nei
Journal:  Genetics       Date:  1978-07       Impact factor: 4.562

2.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

3.  Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential.

Authors:  S Temnykh; G DeClerck; A Lukashova; L Lipovich; S Cartinhour; S McCouch
Journal:  Genome Res       Date:  2001-08       Impact factor: 9.043

4.  Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.

Authors:  Arwa Shahin; Martijn van Kaauwen; Danny Esselink; Joachim W Bargsten; Jaap M van Tuyl; Richard G F Visser; Paul Arens
Journal:  BMC Genomics       Date:  2012-11-20       Impact factor: 3.969

5.  De novo sequencing and characterization of floral transcriptome in two species of buckwheat (Fagopyrum).

Authors:  Maria D Logacheva; Artem S Kasianov; Dmitriy V Vinogradov; Tagir H Samigullin; Mikhail S Gelfand; Vsevolod J Makeev; Aleksey A Penin
Journal:  BMC Genomics       Date:  2011-01-13       Impact factor: 3.969

6.  Genome-wide distribution and organization of microsatellites in plants: an insight into marker development in Brachypodium.

Authors:  Humira Sonah; Rupesh K Deshmukh; Anshul Sharma; Vinay P Singh; Deepak K Gupta; Raju N Gacche; Jai C Rana; Nagendra K Singh; Tilak R Sharma
Journal:  PLoS One       Date:  2011-06-21       Impact factor: 3.240

7.  WEGO: a web tool for plotting GO annotations.

Authors:  Jia Ye; Lin Fang; Hongkun Zheng; Yong Zhang; Jie Chen; Zengjin Zhang; Jing Wang; Shengting Li; Ruiqiang Li; Lars Bolund; Jun Wang
Journal:  Nucleic Acids Res       Date:  2006-07-01       Impact factor: 16.971

8.  Full-length transcriptome assembly from RNA-Seq data without a reference genome.

Authors:  Manfred G Grabherr; Brian J Haas; Moran Yassour; Joshua Z Levin; Dawn A Thompson; Ido Amit; Xian Adiconis; Lin Fan; Raktima Raychowdhury; Qiandong Zeng; Zehua Chen; Evan Mauceli; Nir Hacohen; Andreas Gnirke; Nicholas Rhind; Federica di Palma; Bruce W Birren; Chad Nusbaum; Kerstin Lindblad-Toh; Nir Friedman; Aviv Regev
Journal:  Nat Biotechnol       Date:  2011-05-15       Impact factor: 54.908

9.  Comparative transcriptome analysis and marker development of two closely related Primrose species (Primula poissonii and Primula wilsonii).

Authors:  Lu Zhang; Hai-Fei Yan; Wei Wu; Hui Yu; Xue-Jun Ge
Journal:  BMC Genomics       Date:  2013-05-14       Impact factor: 3.969

10.  Development and validation of microsatellite markers for Brachiaria ruziziensis obtained by partial genome assembly of Illumina single-end reads.

Authors:  Pedro I T Silva; Alexandre M Martins; Ediene G Gouvea; Marco Pessoa-Filho; Márcio E Ferreira
Journal:  BMC Genomics       Date:  2013-01-16       Impact factor: 3.969

View more
  7 in total

1.  Genetic diversity and population structure among accessions of Perilla frutescens (L.) Britton in East Asia using new developed microsatellite markers.

Authors:  Kyu Jin Sa; Ik-Young Choi; Kyong-Cheul Park; Ju Kyong Lee
Journal:  Genes Genomics       Date:  2018-08-13       Impact factor: 1.839

2.  Deep sequencing and transcriptome analyses to identify genes involved in secoiridoid biosynthesis in the Tibetan medicinal plant Swertia mussotii.

Authors:  Yue Liu; Yi Wang; Fengxian Guo; Lin Zhan; Toni Mohr; Prisca Cheng; Naxin Huo; Ronghui Gu; Danning Pei; Jiaqing Sun; Li Tang; Chunlin Long; Luqi Huang; Yong Q Gu
Journal:  Sci Rep       Date:  2017-02-22       Impact factor: 4.379

3.  Development of Microsatellite Markers for a Dioecious Herpetospermum pedunculosum (Cucurbitaceae).

Authors:  Zhu-Qing Chen; Zhi-Li Zhou; Lin-Lin Wang; Li-Hua Meng; Yuan-Wen Duan
Journal:  Evol Bioinform Online       Date:  2020-02-21       Impact factor: 1.625

4.  SSR Loci Analysis in Transcriptome and Molecular Marker Development in Polygonatum sibiricum.

Authors:  Qingwen Yang; Yujie Jiang; Yuping Wang; Ruilian Han; Zongsuo Liang; Qiuling He; Qiaojun Jia
Journal:  Biomed Res Int       Date:  2022-03-08       Impact factor: 3.411

5.  RNA: An Expanding View of Function and Evolution.

Authors:  Xinwei Han; Yuan Chen; Liuyang Wang; Wenwen Fang; Ning Zhang; Qiyun Zhu
Journal:  Evol Bioinform Online       Date:  2016-01-14       Impact factor: 1.625

Review 6.  Microsatellites in Pursuit of Microbial Genome Evolution.

Authors:  Abdullah F Saeed; Rongzhi Wang; Shihua Wang
Journal:  Front Microbiol       Date:  2016-01-05       Impact factor: 5.640

7.  Transcriptome Analysis and Microsatellite Markers Development of a Traditional Chinese Medicinal Herb Halenia elliptica D. Don (Gentianaceae).

Authors:  Mingliu Yang; Nanyu Han; Heng Li; Lihua Meng
Journal:  Evol Bioinform Online       Date:  2018-07-25       Impact factor: 1.625

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.