Literature DB >> 26239137

Association of three SNPs in TOX3 and breast cancer risk: Evidence from 97275 cases and 128686 controls.

Li Zhang1, Xinghua Long1.   

Abstract

The associations of SNPs in TOX3 gene with breast cancer risk were investigated by some Genome-wide association studies and epidemiological studies, but the study results were contradictory. To derive a more precise estimate of the associations, we conducted a meta-analysis. ORs with 95% CI were used to assess the strength of association between TOX3 polymorphisms and breast cancer risk in fixed or random effect model. A total of 37 publications with 97275 cases and 128686 controls were identified. We observed that the rs3803662 C > T, rs12443621 A > G and rs8051542 C > T were all correlated with increased risk of breast cancer. In the stratified analyses by ethnicity, significantly elevated risk was detected for all genetic models of the three SNPs in Caucasians. In Asian populations, there were significant associations of rs3803662 and rs8051542 with breast cancer risk. Whereas there was no evidence for statistical significant association between the three SNPs and breast cancer risk in Africans. Additionally, we observed different associations of rs3803662 with breast cancer risk based on different ER subtype and BRCA1/BRCA2 mutation carriers. In conclusion, the meta-analysis suggested that three SNPs in TOX3 were significantly associated with breast cancer risk in different populations.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26239137      PMCID: PMC4523945          DOI: 10.1038/srep12773

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Breast cancer is the most generally diagnosed cancer and the most common cause of cancer death for females all over the world, particularly in the economically developing countries1. It is well known that breast cancer is a heterogeneous disease, not only in the aspect of various pathogenesis, but also in diversified clinical manifestation and outcome. Meanwhile, breast carcinoma is multifactorial disease, from a certain perspective, along with the combination of polygenic inheritance factor and environmental factor. Accompany with technological advances, more studies related with the genomic variation were conducted, in order to improve diagnosis and treatment for breast cancer patients. Mutations in some high and moderate penetrate genes, such as BRCA1, BRCA2 and ATM, were verified to be connected with the increased risk of breast cancer23. Nonetheless, these mutations constitute a part of the disease risk and it remains unclarified for the majority of genetic variations related with breast cancer susceptibility, particularly for low penetrate genes. It is noteworthy that genome-wide association studies (GWASs) about hundreds of single nucleotide polymorphisms (SNPs) provide strong evidences in elaborating the associations between low penetrate genes and breast cancer risk. The TOX3 gene, formerly known as trinucleotide repeat containing 9 (TNRC9), is located in the chromosome 16q 12 and has a tri-nucleotide repeat motive. The gene encoded a protein containing a putative high mobility group (HMG) box4, indicating that it might play a potential role in calcium dependent transcription as a transcription factor5. In the recent years, the associations between genetic variants in TOX3 region and breast cancer susceptibility have been validated by GWASs and epidemiological studies in European, Asian and African American populations678910111213. The SNP rs3803662 is located in 8 kb upstream of TOX3, and the rs12443621 and rs8051542 are both lied in an linkage disequilibrium (LD) block containing the 5′ end of TOX36. The TOX3 rs3803662 was identified to exhibit association with breast cancer by GWASs6710, with ascertainment of the association in Hispanic and non-Hispanic white women by Slattery et al.11. However, no significant association was found between rs3803662 and breast cancer risk in Asian and African ancestry813. Analogously, there was no evidence for the association between rs12443621 or rs8051542 and increased risk of breast cancer in Chinese women141516. Whereas, Shan et al. reported that rs8051542 was significantly correlated with breast cancer risk in Tunisians17. Additionally, some studies found different relationships of three SNPs and breast cancer risk among different populations, which might result from different sample size or diverse allele frequencies and LD pattern among populations. Meanwhile, the most recent meta-analysis related to the associations between the above-mentioned 3SNPs with breast cancer risk omitted some important studies18, and thus had limited statistical power to demonstrate the associations. Therefore, we performed an updated meta-analysis to aim to come up with the highest level of evidence for the associations between three SNPs in TOX3 gene and breast cancer risk among diverse ancestry populations and distinct tumor subtypes stratified by estrogen receptor (ER) or BRCA1/BRCA2.

Materials and Methods

Literature search strategy

We carried out a comprehensive literature search from PubMed and EMBASE databases up to March 2015, using the following search terms “TOX3” or “TNRC9” and “polymorphism” or “genetic variant” or “rs3803662” or “rs12443621” or “rs8051542” and “breast cancer” or “breast carcinoma” or “breast tumor” . First, we retrieved all potentially relevant articles, whose abstracts contained information related to our research purpose. Second, the references from eligible studies were carefully checked for additional relevant literature. Finally, only the comprehensive or the most recent study was brought into this meta-analysis, in the case that the same study population was included in several different articles.

Selection criteria

Eligible studies had to fulfill the following criteria: (1) case-control studies or cohort studies evaluating the association between TOX3 polymorphism (rs3803662, rs12443621 or rs8051542) and breast cancer risk; (2) odds ratio (OR) and 95% confidence interval (CI) or genotype data of rs3803662, rs12443621 or rs8051542 in breast cancer patients and cancer-free female to calculate OR and 95% CI; (3) studies were confined to human female groups; (4) articles in English.

Data extraction

A standard protocol was applied to extract data. For every eligible study, the following data were extracted: First author’s surname, year of publication, country of origin, population ethnicity, genotyping method, the genotype counts in cases and control (TT, CT and CC genotypes for TOX3 rs3803662; GG, AG and AA genotypes for rs12443621; TT, CT and CC genotypes for rs8051542) and P-value for the HWE in control groups. Two investigators independently extracted the above relative data with any disagreement resolved by discussion. If no consensus wasn’t reached, another investigator joined in the discussion. And the final decision was made by the majority of the votes.

Statistical methods

The strength of associations between TOX3 polymorphisms and breast carcinoma risk were estimated by OR with corresponding 95% CI. For all studies, we assessed the association under five different genetic models for calculating OR. Those were homozygote codominant model, heterozygote codominant model, dominant model, recessive model and allele model. Hardy-Weinberg equilibrium (HWE) was assessed by using χ2 test to compare expected and actual genotype frequencies among controls of each study. Q-statistic was applied to investigate heterogeneity among studies. P-value greater than 0.1 for Q test suggested a lack of statistically significant heterogeneity, and the fixed-effect model (Mantel-Haenszel method)19 was used to calculate pooled ORs. Otherwise, heterogeneity was present and the random-effect model (DerSimonian-Laird method)20 was more appropriate. In addition, the I-test was employed to accurately measure the degree of heterogeneity. Furthermore, the I-value less than 25% was equivalent to mild heterogeneity, and values between 25% and 50% was equivalent to moderate heterogeneity, whereas values greater than 50% was equivalent to large heterogeneity among studies. Potential publication bias was estimated by symmetry of funnel plot of OR versus the standard error of log (OR) and the visual symmetrical plot indicated that there was no publication bias among studies. Sensitivity analyses were conducted to assess the robustness of the results by eliminating each study in turn to show whether the individual data set influenced the pooled OR. Stratified analyses were conducted in terms of ethnicity, estrogen receptor (ER) status, BRCA1 and BRCA2 mutation. All statistical tests in this meta-analysis were two-tailed and P-value ≤ 0.05 was considered statistically significant unless otherwise noted. All statistical analyses were performed with Review Manager 5.2 software recommended by Cochrane Collaboration and Comprehensive Meta Analysis V2 software.

Result

Study Characteristics

Based on the above selection criteria, a total of 37 eligible studies were included in the pooled analyses, involving 97275 cases and 128686 controls for rs3803662 polymorphism78910111213141516172122232425262728293031323334353637383940414243444546. For rs12443621, 14 studies812141516172428293141424546 involved a total of 17750 cases and 19488 controls. Moreover, there were 13 studies8121516172829313941424546 with 20965 cases and 21580 controls for rs8051542. Of particular note was that it’s smaller than 0.05 for the P-value of Hardy-Weinberg equilibrium in the controls of two studies, Campa et al. and Garcia-Closas et al.3738, but we still included the two studies after sensitivity analyses were done. Additionally, in three included studies, genotype frequencies were shown separately according to different ethnic groups73139. Therefore, the corresponding genotype counts in the study were separately considered for analyses. For rs3803662, five studies1115162638 concerned with ER subtype of breast cancers and three studies263035 related with BRCA1/2 mutation carriers were analysed as subgroups. The Fig. 1 expounded the study selection process. The Table 1 and 2 described the main features of these studies, especially for the genotype counts.
Figure 1

The flowchart of the study selection process.

Table 1

Characteristics of studies for the association of TOX3 rs3803662 with breast cancer risk included in the meta-analysis.

AuthorYearCountryEthnicityGenotyping methodCase
Control
 
TTCTCCTTCTCCPHWE
Stacey72007IcelandCaucasianIllumina469198521001272691393920.999
Stacey72007IcelandAAIllumina95211116130222950.990
Stacey72007IcelandAsianIllumina1552751221472781320.980
Stacey72007IcelandMixedIllumina1042751831143402590.891
He82014ChinaAsianSequenom MassARRAY27128072270278720.973
Elematore92014ChileMixedTaqMan621851001003713300.786
Low102013JapanAsianIllumina OmniExpress BeadChip1801270510161496273912540.996
Slattery112011USACaucasianTaqMan2047557782028629780.550
Udler122010UKCaucasianNA194942104115782912730.167
Ruiz -Narváez132010USAAASequenom MassArray iPLEX1883761892144121990.980
Jiang142011ChinaAsianSNaPshot23321248232224540.995
Li152009ChinaAsianPCR-LDR11814132123128400.470
Liang162010ChinaAsianSNP stream highthroughput 12-plex4864131264554641270.603
Shan172012QatarCaucasianTaqMan147293200781651260.083
Long212013USAAATaqMan/Sequenom32861328756310274690.988
Kim222012KoreaAsianAffymetrix/TaqMan49919391887577196716770.996
Huo232012USAAfricanIllumina GoldenGate3937543623686913240.991
Chan242012SingaporeAsianTaqMan5414991346296561810.622
Stevens252011USACaucasianiPLEX/Illumina26812521460363196026500.982
Mulligan262011CanadaMixedTaqMan58526523109426219728990.730
Han272011KoreaAsianRT-PCR14811435369136116175160.317
Long282010USAAsianAffymetrix/Sequenom MassARRAY29342761650160317274650.996
Long292010USACaucasianTaqMan25811721330190102813910.997
Latif302010UKCaucasianTaqMan84395422191372170.660
Barnholtz-Sloan312010USAAAIllumina GoldenGate1963781661823331420.654
Barnholtz-Sloan312010USACaucasianIllumina GoldenGate133512585894405890.591
Gorodnova322010RussiaCaucasianRT-PCR1650741582770.294
Hemminki332010GermanyCaucasianMALDITOF mass spectrometry15462663512470410020.982
Mcinerney342009IrelandCaucasianKASPar SNP genotyping82382486583965320.161
Antoniou352008UKCaucasianTaqMan/MALOI-TOF/iPLEX49721732422382183122440.756
Tapper362008UKCaucasianiPLEX Service76371452196113716470.990
Campa372011GermanyMixedTaqMan1071352837061150472457210.001
Garcia-Closas382008USAMixedTaqMan/MALDITOF1848713277592026970513295<0.0001
Barzan392013GermanyAsianSequenom MassARRAY482413899619902550.999
Barzan392013GermanyCaucasianSequenom MassARRAY36140135653695260.979
Rinella402013USACaucasianAffymetrix/KASPar1313352141063663150.985
Zheng412009USAAASequenom MassARRAY2224041844828914110.984
Butt422012SwedenCaucasianSequenom MassARRAY64278353955127800.380
Mizoo432013JapanAsianTaqMan16023074142227910.987
Harlid442012SwedenCaucasianMALDITOF mass spectrometry33014201794352189827680.280
Zheng452010USAAsianAffymetrix14011325313128614103860.987
Tamimi462010USACaucasianSequenom iPLEX/TaqMan54300333502734150.576

AA: African Americans; NA: not available; HWE: Hardy-Weinberg equilibrium; PCR-LDR : Polymerase chain reaction–ligation detection reaction.

Table 2

Genotypes and PWHE for TOX3 rs12443621 and rs8051542 polymorphisms included in the study.

Authorrs12443621 Genotypes
PHWErs8051542 Genotypes
PHWE
Cases
Controls
Cases
Controls
GGAGAAGGAGAATTCTCCTTCTCC
He8 20141103042091153042010.80925199399181754270.989
Udler12 2010527111154649710996810.176455108961142510677360.274
Jiang14 201117023984162251970.990
Li15 20091061385497141550.76615821989902090.854
Liang16 20103475071863385192040.85048314670473097080.078
Shan17 201219030114798180850.894138289208461761460.529
Chan2420124045731985326692620.419
Long28 2010546144896055414699740.99824619713941118108024600.968
Long29 20102865732862745712970.9893367884632797094510.991
Barnholtz-Sloan31 20101643702081653291640.99987342313593042950.121
Barnholtz-Sloan31 20103375803132425743020.3192575873862015593580.501
Barzan39 2013433276147265114830.957
Barzan39 201381155751864733010.994
Zheng41 20091894052164238914700.986803493811707628520.984
Butt42 20121653381952756574510.2031493381922726374430.119
Zheng45 201010011486552100815095650.99511896119609689820880.963
Tamimi46 20101513371931303662410.6591323591941353802200.193

PHWE: P value of Hardy-Weinberg equilibrium for control groups.

Meta-analysis results

The mixtures of adjusted and crude estimates were used to calculate pooled ORs. The available adjusted variables of included studies were listed in supplementary table 1. Owing to large heterogeneity among studies, we used random-effect model to calculate pooled ORs for the associations of rs3803662 and rs12443621 with breast cancer risk. In contrast, fix-effect model was applied to calculate pooled ORs for rs8051542. In aggregate, T-rs3803662 and T-rs8051542 were all statistically associated with increased risk of breast cancer in all genetic models. However, the association between G-rs12443621 and breast cancer risk was only observed in Caucasians under all genetic models. The pooled ORs and 95%CI for these associations in all genetic models were shown in detail in Table 3, 4, 5, respectively. Forest plots related to the association of rs3803662, rs12443621 and rs8051542 with breast cancer susceptibility in homozygote model were shown in Fig. 2, Fig. 3 and Fig. 4, respectively.
Table 3

Stratified analysis of TOX3 rs3803662 polymorphism on breast cancer.

VariablesNTT versus CC
CT versus CC
TT + CT versus CC
TT versus CT + CC
T versus C
OR (95% CI)PHOR (95% CI)PHOR (95% CI)PHOR (95% CI)PHOR (95% CI)PH
Total431.311 (1.221–1.407)<0.0011.151 (1.103–1.201)<0.0011.160 (1.088–1.237)<0.0011.200 (1.140–1.263)<0.0011.145 (1.106–1.186)<0.001
Ethnicity
Asian131.245 (1.076–1.440)<0.0011.121 (1.013–1.241)<0.0011.162 (1.030–1.311)<0.0011.133 (1.049–1.223)<0.0011.112 (1.034–1.195)<0.001
Caucasian191.483 (1.371–1.604)0.0291.212 (1.153–1.275)0.0051.259 (1.194–1.327)<0.0011.347 (1.280–1.418)0.3321.220 (1.171–1.271)<0.001
African60.929 (0.837–1.032)0.2400.961 (0.841–1.099)0.0440.989 (0.877–1.116)0.0480.952 (0.878–1.032)0.520.962 (0.914–1.012)0.296
Mixed51.440 (1.288–1.611)0.0171.200 (1.109–1.298)0.0041.084 (0.927–1.268)<0.0011.358 (1.294–1.425)0.2651.202 (1.126–1.282)<0.001
ER (+)41.493 (1.391–1.603)0.6961.241 (1.188–1.297)0.4681.312 (1.262–1.364)0.2841.410 (1.321–1.505)0.5941.225 (1.189–1.262)0.524
ER (−)41.104 (0.885–1.376)0.0731.134 (1.066–1.206)0.4911.135 (1.008–1.278)0.0791.282 (1.163–1.414)0.3271.118 (1.064–1.175)0.519
ER (+) vs. ER (−)51.382 (0.998–1.915)0.0161.073 (1.002–1.149)0.5821.086 (1.019–1.157)0.6681.093 (0.986–1.212)0.8831.067 (1.016–1.121)0.468
BRCA131.249 (1.087–1.436)0.8111.107 (1.022–1.198)0.9331.130 (1.048–1.219)0.8881.194 (1.044–1.365)0.8331.113 (1.050–1.181)0.822
BRCA231.102 (0.921–1.319)0.9111.276 (1.018–1.599)0.0301.310 (1.039–1.650)0.0171.207 (1.018–1.432)0.4581.230 (1.037–1.459)0.023

N: Numbers of data sets; PH: P-value of Q-test for heterogeneity test; PH < 0.1 indicates that there is heterogeneity and random-effect model is used to calculate pooled ORs and 95% CI. Otherwise, fixed-effect model is used.

Table 4

Stratified analysis of TOX3 rs12443621 polymorphism on breast cancer.

VariablesNGG versus AA
AG versus AA
GG + AG versus AA
GG versus AG + AA
G versus A
OR (95% CI)PHOR (95% CI)PHOR (95% CI)PHOR (95% CI)PHOR (95% CI)PH
Total151.072 (0.975–1.180)0.0051.033 (0.958–1.113)0.0201.049 (0.983–1.121)0.0471.061 (0.996–1.131)0.0691.033 (0.985–1.083)0.003
Ethnicity
 Asian71.006 (0.927–1.092)0.8851.002 (0.936–1.073)0.6631.006 (0.941–1.075)0.6961.007 (0.945–1.072)0.8021.000 (0.956–1.046)0.843
 Caucasian61.264 (1.143–1.398)0.2011.156 (1.062–1.258)0.2811.163 (1.078–1.256)0.1471.181 (1.089–1.280)0.2731.125 (1.070–1.183)0.190
 African20.854 (0.720–1.012)0.1170.863 (0.658–1.132)0.0620.931 (0.803–1.079)0.3550.926 (0.794–1.080)0.3710.928 (0.853–1.009)0.145

N: Numbers of data sets; PH: P-value of Q-test for heterogeneity test; PH <0.1 indicates that there is heterogeneity and random-effect model is used to calculate pooled ORs and 95% CI. Otherwise, fixed-effect model is used.

Table 5

Stratified analysis of TOX3 rs8051542 polymorphism on breast cancer.

VariablesNTT versus CC
CT versus CC
TT + CT versus CC
TT versus CT + CC
T versus C
OR (95% CI)PHOR (95% CI)PHOR (95% CI)PHOR (95% CI)PHOR (95% CI)PH
Total151.304 (1.210–1.405)0.3781.125 (1.076–1.175)0.6471.159 (1.112–1.208)0.6891.198 (1.121–1.280)0.4201.135 (1.099–1.171)0.388
Ethnicity
 Asian61.370 (1.185–1.584)0.8861.141 (1.075–1.211)0.8121.164 (1.101–1.231)0.9171.200 (1.041–1.383)0.7081.148 (1.093–1.206)0.786
 Caucasian71.29 (1.181–1.425)0.1071.128 (1.046–1.215)0.2811.199 (1.116–1.288)0.5571.226 (1.082–1.389)0.0791.138 (1.086–1.191)0.137
 African21.186 (0.941–1.494)0.1891.030 (0.896–1.183)0.9171.030 (0.913–1.161)0.9961.145 (0.970–1.351)0.4071.066 (0.964–1.179)0.318

N: Numbers of data sets; PH: P-value of Q-test for heterogeneity test; PH <0.1 indicates that there is heterogeneity and random-effect model is used to calculate pooled ORs and 95% CI. Otherwise, fixed-effect model is used.

Figure 2

Forest plot of TOX3 rs3803662 polymorphism and breast cancer risk.

Random-effect model was used for the analysis (homozygote codominant model TT vs. CC). The squares and horizontal lines correspond to the specific OR and 95% CI for every study. The area of the squares reflects the study specific weight. The diamond stands for the pooled OR and 95% CI.

Figure 3

Forest plot of TOX3 rs12443621 polymorphism and breast cancer risk.

Random-effect model was used for the analysis (homozygote codominant model GG vs. AA).

Figure 4

Forest plot of TOX3 rs8051542 polymorphism and breast cancer risk.

Fixed-effect model was used for the analysis (homozygote codominant model TT vs. CC).

In the subgroup analysis by ethnicity, our results indicated statistically significant associations between the three SNPs and breast cancer susceptibility in Caucasians under all genetic models. Nevertheless, as for Asian populations, T-rs3803662 and T-rs8051542 were shown to be statistically significant correlated with increased risk of breast cancer in all genetic models. In addition, there was no evidence for the statistical significant associations between the three SNPs and increased risk of breast cancer in African population which were almost African-American in our study. The pool ORs and 95%CI for these stratified analyses were detailedly shown in Table 3, 4, 5 for all genetic modes. When stratified by ER status for rs3803662, statistically significant increased risk was found in ER+ and ERtumor (Fig. 5 and Fig. 6). Moreover, a stronger association was identified in ER+ than ER− subtype for breast cancer risk (Fig. 7). Additionally, our analysis demonstrated that there were significant relationships between elevated risk of breast cancer and BRCA1/2 mutation carriers for rs3803662 (Fig. 8 and Fig. 9). And the details about ORs and 95% CI under all genetic models were shown in Table 3.
Figure 5

Forest plot of TOX3 rs3803662 polymorphism and breast cancer risk stratified by ER (+).

Fixed-effect model was used for the analysis (allele model T vs. C).

Figure 6

Forest plot of TOX3 rs3803662 polymorphism and breast cancer risk stratified by ER (−).

Fixed-effect model was used for the analysis (allele model T vs. C).

Figure 7

Forest plot of TOX3 rs3803662 polymorphism and breast cancer risk in ER+ subtype compared with ER− tumors.

Fixed-effect model was used for the analysis (allele model T vs. C).

Figure 8

Forest plot of TOX3 rs3803662 polymorphism and breast cancer risk stratified by BRCA1 mutation.

Fixed-effect model was used for the analysis (allele contrast model T vs. C).

Figure 9

Forest plot of TOX3 rs3803662 polymorphism and breast cancer risk stratified by BRCA2 mutation.

Fix -effect model was used for the analysis (allele contrast model T vs. C).

Sensitivity analyses and publication bias

Sensitivity analyses were conducted to assess the robustness of the results by eliminating each study in turn and all the results were not essentially altered, suggesting that the results of our meta-analysis were statistically stable. Publication bias of the eligible literature was evaluated by funnel plots and the shapes of funnel plots for literature about association between three SNPs and breast cancer risk were mostly symmetrical, indicating that no publication bias was detected.

Discussion

The TOX3 gene encoded a protein with an HMG box that is considered to be implicated in modification of DNA and chromatin structure47. Moreover, increased expression of TOX3 was relevant to bone metastasis in breast cancer patients48. Whereas, precise biological function of TOX3 is undetermined. Some GWASs and epidemiological studies have identified the associations of TOX3 polymorphisms with breast cancer susceptibility. However, study results were not consistent. Hence, in order to resolve the conflict, we performed this meta-analysis of the associations between the TOX3 rs3803662, rs12443621 and rs8051542 polymorphism and breast cancer risk. The three SNPs locate in the 5’ end of TOX3 gene and a hypothetical gene LOC643714 on 16q12, and the region is contained in a 133kb linkage disequilibrium (LD) block12. Based on the International HapMap database, different LD patterns were observed between Asian and European ancestry. SNP rs3803662 was in moderate LD with rs12443621, with a Pearson’s correlation coefficient (r2) of 0.29 in the HapMap CEU population for European ancestry, but very weak LD was found between these two SNPs (r2 = 0.06) in Chinese8. Similarly, there was very weak association (r2 = 0.08) between rs3803662 and rs8051542 located 52 kb apart from each other in Chinese women45. However, the two SNPs showed moderate association (r2 = 0.15) with each other in European populations8. The substantial differences in genetic architecture among races, such as allele frequencies and LD structures, may partly account for our results which confirmed different association of the three SNPs with breast cancer risk in Caucasians, Asians and African-Americans. Rs3803662-T allele, rs12443621-G allele and rs8051542-T allele were statistically significantly associated with increased risk of breast cancer in Caucasians. Meanwhile, T-rs3803662 and T-rs8051542 were identified as risk factors of breast cancer in Asian populations. However, there was no evidence to prove that the three SNPs in African-Americans and G-rs12443621 in Asians were implicated in the breast tumor susceptibility, which was in line with the previous studies4145. It’s worth mentioning that our study showed that T-rs3803662 and G-rs12443621 were protective factors in African-Americans in spite of no statistical significance. In general, our study proved that the T-rs3803662 and T-rs8051542 in TOX3 were correlated with elevated breast cancer risk in all genetic models. It is notable that a previous meta-analysis directed by Chen et al.18 has showed that rs3803662 polymorphism was significantly associated with breast cancer risk, but no significant associations were observed for the rs12443621 and rs8051542. In addition, it only included eight case-control studies without stratified analyses. Compared with the previous meta-analysis, our study had more powerful and detailed analyses to prove our results. First and most obviously, more eligible literature and larger sample size were included. Second, the associations between breast cancer risk and rs3803662 polymorphism were considered with respect to ER status and BRCA1/2 mutation carriers. Third, stratified analyses were performed based on Caucasians, Asians and Africans, which was in favor of a more comprehensive understanding the associations in diverse populations. Finally and most importantly, we used mixture of adjusted and crude ORs rather than unadjusted estimates to calculate the pooled ORs. Meanwhile, the original genotype counts of eligible studies were also used to calculate the crude ORs. Supplementary table 2 showed the pooled ORs of the associations between the 3SNPs and breast cancer risk by using crude estimates. And there was no significant difference among the two results of pooled ORs based on different estimates, except for rs12443621. The crude ORs were incorporated to result in marginally association of rs12443621 with breast cancer risk under homozygote, dominant and allele genetic mode, but no association was found by using mixture ORs. That was probably because that adjusted estimates could yield more accurate results. Nevertheless, the two ways both demonstrated the relationship between rs12443621 and elevated risk of breast cancer in Caucasians. To date, more attention has been paid to the heterogeneity of associations between common genetic variants and breast cancer subtypes. The two large-scale studies3738 and our result identified that rs3803662 polymorphism was associated with both ER+ and ER− subtype of breast cancer, in spite of the slightly weaker association for ERbreast cancer. Additionally, our study demonstrated that T-rs3803662 was statistically significant associated with increased risk in ER+ breast cancer compared with ER− subtype, which was accordance with the researches done by Stacey et al. and Broeks et al.749. Intriguingly, T-rs8051542 allele and rs12443621 AG/GG genotypes, rather than rs3803662, were significantly associated with elevated risk of ER+ breast cancer in Chinese women816. By contrast, the significant associations of rs8051542 and rs12443621 were observed with luminal A (ER/PR+, Her2−) and Her2+/ERbreast cancer only among whites, respectively50. Furthermore, the association was strongly confirmed between rs3803662 and triple-negative tumors2549. Taken together, these studies indicated that there were somehow connections between the three SNPs in TOX3 gene and pathological subtype of breast tumor among different populations. And in another aspect, these studies provided further support for the hypothesis that different subtypes stem from diverse etiological pathways. Additionally, rs3803662 SNP in BRCA1 and BRCA2 mutation carriers was significantly associated with the increased risk of breast cancer in our analysis, which was in consistent with previous studies2635. While Latif et al. confirmed that the genetic variant was only associated with breast tumor in BRCA2 mutation carriers30. Therefore, it’s necessary to further elucidate the relevance of rs3803662 to breast cancer risk with BRAC1 and BRCA2 mutation. Despite the advantage of large sample size and stratified analyses, the meta-analysis had several limitations that should be taken into account. First, there was extreme heterogeneity for the outcomes of the association between rs3803662 polymorphism and breast cancer risk. Although we reduced the degree of heterogeneity by stratified analyses based on ethnicity, other sources of heterogeneity were not verified, such as different genotyping methods or tumor types. Second, the sample size of African populations (5462 cases and 7155 controls) was relatively small. Therefore there was insufficient statistical power to demonstrate the associations between the 3SNPs and breast cancer risk in Africans. Third, the criterion of control groups was not uniformly defined. The design of eligible studies was based on population or/and hospital patients, thus there were potential risks of breast cancer in control groups. Fourth, the mixtures of crude and adjusted publish estimates, rather than incorporation of adjusted ORs, were used in the meta-analysis. Because of the lack of some individual data, we were unable to adjust effect size with possible confounders related with lifestyle risk factors, such as age, obesity, smoking, alcohol consumption and menopausal status. Furthermore, we were unable to examine the interaction between genetic variables and environment. In recent years, some studies for gene-environment interactions showed that relative risks of breast cancer correlated with low-penetrance susceptibility variants (including rs3803662) didn’t vary significantly with established environmental risk factors, such as reproductive history, menopausal status and body mass index515253. Nevertheless, more and more researches have elaborated combined effect of low-penetrance susceptibility loci with breast cancer risk. And the obviously elevated risk stemming from combining many low-penetrant risk alleles supports the polygenic inheritance model of breast cancer44. Finally, owing to merely include English articles, there might be language bias on some level. Additionally, positive reports are tended to be published, which might make certain bias. In conclusion, this meta-analysis indicated that there were different associations between the 3SNPs in TOX3 gene and breast cancer risk in different ethnic groups or subtype tumor. The 3SNPs were associated with the increased risk of breast cancer in Caucasians, while weren’t correlated in Africans. Additionally, rs3803662 and rs8051542 were risk factors for breast cancer in Asians. Furthermore, there were stronger associations between rs3803662 polymorphism and breast cancer risk in ER+ subtype than ERtumors. Increased risk of breast cancer associated with rs3803662 was confirmed in BRCA1/BRCA2 mutation carriers. However, studies with larger sample size, which use uniform genotyping methods and criterion of control groups, have sufficiently corresponding individual data and consider the interactions of gene-gene and gene-environment will be needed to verify our results for TOX3 rs3803662, rs12443621 and rs8051542 as predisposition markers to breast cancer in clinical application.

Additional Information

How to cite this article: Zhang, L. and Long, X. Association of three SNPs in TOX3 and breast cancer risk: Evidence from 97275 cases and 128686 controls. Sci. Rep. 5, 12773; doi: 10.1038/srep12773 (2015).
  52 in total

1.  Risk of genome-wide association study newly identified genetic variants for breast cancer in Chinese women of Heilongjiang Province.

Authors:  Yongdong Jiang; Jiguang Han; Jing Liu; Guoqiang Zhang; Lihong Wang; Feng Liu; Xianyu Zhang; Yashuang Zhao; Da Pang
Journal:  Breast Cancer Res Treat       Date:  2011-01-01       Impact factor: 4.872

2.  Interactions between genetic variants and breast cancer risk factors in the breast and prostate cancer cohort consortium.

Authors:  Daniele Campa; Rudolf Kaaks; Loïc Le Marchand; Christopher A Haiman; Ruth C Travis; Christine D Berg; Julie E Buring; Stephen J Chanock; W Ryan Diver; Lucie Dostal; Agnes Fournier; Susan E Hankinson; Brian E Henderson; Robert N Hoover; Claudine Isaacs; Mattias Johansson; Laurence N Kolonel; Peter Kraft; I-Min Lee; Catherine A McCarty; Kim Overvad; Salvatore Panico; Petra H M Peeters; Elio Riboli; Maria José Sanchez; Fredrick R Schumacher; Guri Skeie; Daniel O Stram; Michael J Thun; Dimitrios Trichopoulos; Shumin Zhang; Regina G Ziegler; David J Hunter; Sara Lindström; Federico Canzian
Journal:  J Natl Cancer Inst       Date:  2011-07-26       Impact factor: 13.506

3.  Low penetrance breast cancer susceptibility loci are associated with specific breast tumor subtypes: findings from the Breast Cancer Association Consortium.

Authors:  Annegien Broeks; Marjanka K Schmidt; Mark E Sherman; Fergus J Couch; John L Hopper; Gillian S Dite; Carmel Apicella; Letitia D Smith; Fleur Hammet; Melissa C Southey; Laura J Van 't Veer; Renate de Groot; Vincent T H B M Smit; Peter A Fasching; Matthias W Beckmann; Sebastian Jud; Arif B Ekici; Arndt Hartmann; Alexander Hein; Ruediger Schulz-Wendtland; Barbara Burwinkel; Frederik Marme; Andreas Schneeweiss; Hans-Peter Sinn; Christof Sohn; Sandrine Tchatchou; Stig E Bojesen; Børge G Nordestgaard; Henrik Flyger; David D Ørsted; Diljit Kaur-Knudsen; Roger L Milne; Jose I Arias Pérez; Pilar Zamora; Primitiva Menéndez Rodríguez; Javier Benítez; Hiltrud Brauch; Christina Justenhoven; Yon-Dschun Ko; Ute Hamann; Hans-Peter Fischer; Thomas Brüning; Beate Pesch; Jenny Chang-Claude; Shan Wang-Gohrke; Michael Bremer; Johann H Karstens; Peter Hillemanns; Thilo Dörk; Heli A Nevanlinna; Tuomas Heikkinen; Päivi Heikkilä; Carl Blomqvist; Kristiina Aittomäki; Kirsimari Aaltonen; Annika Lindblom; Sara Margolin; Arto Mannermaa; Veli-Matti Kosma; Jaana M Kauppinen; Vesa Kataja; Päivi Auvinen; Matti Eskelinen; Ylermi Soini; Georgia Chenevix-Trench; Amanda B Spurdle; Jonathan Beesley; Xiaoqing Chen; Helene Holland; Diether Lambrechts; Bart Claes; Thijs Vandorpe; Patrick Neven; Hans Wildiers; Dieter Flesch-Janys; Rebecca Hein; Thomas Löning; Matthew Kosel; Zachary S Fredericksen; Xianshu Wang; Graham G Giles; Laura Baglietto; Gianluca Severi; Catriona McLean; Christopher A Haiman; Brian E Henderson; Loic Le Marchand; Laurence N Kolonel; Grethe Grenaker Alnæs; Vessela Kristensen; Anne-Lise Børresen-Dale; David J Hunter; Susan E Hankinson; Irene L Andrulis; Anna Marie Mulligan; Frances P O'Malley; Peter Devilee; Petra E A Huijts; Rob A E M Tollenaar; Christi J Van Asperen; Caroline S Seynaeve; Stephen J Chanock; Jolanta Lissowska; Louise Brinton; Beata Peplonska; Jonine Figueroa; Xiaohong R Yang; Maartje J Hooning; Antoinette Hollestelle; Rogier A Oldenburg; Agnes Jager; Mieke Kriege; Bahar Ozturk; Geert J L H van Leenders; Per Hall; Kamila Czene; Keith Humphreys; Jianjun Liu; Angela Cox; Daniel Connley; Helen E Cramp; Simon S Cross; Sabapathy P Balasubramanian; Malcolm W R Reed; Alison M Dunning; Douglas F Easton; Manjeet K Humphreys; Carlos Caldas; Fiona Blows; Kristy Driver; Elena Provenzano; Jan Lubinski; Anna Jakubowska; Tomasz Huzarski; Tomasz Byrski; Cezary Cybulski; Bohdan Gorski; Jacek Gronwald; Paul Brennan; Suleeporn Sangrajrang; Valerie Gaborieau; Chen-Yang Shen; Chia-Ni Hsiung; Jyh-Cherng Yu; Shou-Tung Chen; Giu-Cheng Hsu; Ming-Feng Hou; Chiun-Sheng Huang; Hoda Anton-Culver; Argyrios Ziogas; Paul D P Pharoah; Montserrat Garcia-Closas
Journal:  Hum Mol Genet       Date:  2011-05-19       Impact factor: 6.150

4.  Replication of five GWAS-identified loci and breast cancer risk among Hispanic and non-Hispanic white women living in the Southwestern United States.

Authors:  Martha L Slattery; Kathy B Baumgartner; Anna R Giuliano; Tim Byers; Jennifer S Herrick; Roger K Wolff
Journal:  Breast Cancer Res Treat       Date:  2011-04-08       Impact factor: 4.872

5.  Evaluation of 19 susceptibility loci of breast cancer in women of African ancestry.

Authors:  Dezheng Huo; Yonglan Zheng; Temidayo O Ogundiran; Clement Adebamowo; Katherine L Nathanson; Susan M Domchek; Timothy R Rebbeck; Michael S Simon; Esther M John; Anselm Hennis; Barbara Nemesure; Suh-Yuh Wu; M Cristina Leske; Stefan Ambs; Qun Niu; Jing Zhang; Nancy J Cox; Olufunmilayo I Olopade
Journal:  Carcinogenesis       Date:  2012-02-22       Impact factor: 4.944

6.  Common breast cancer susceptibility loci are associated with triple-negative breast cancer.

Authors:  Kristen N Stevens; Celine M Vachon; Adam M Lee; Susan Slager; Timothy Lesnick; Curtis Olswold; Peter A Fasching; Penelope Miron; Diana Eccles; Jane E Carpenter; Andrew K Godwin; Christine Ambrosone; Robert Winqvist; Hiltrud Brauch; Marjanka K Schmidt; Angela Cox; Simon S Cross; Elinor Sawyer; Arndt Hartmann; Matthias W Beckmann; Rüdiger Schulz-Wendtland; Arif B Ekici; William J Tapper; Susan M Gerty; Lorraine Durcan; Nikki Graham; Rebecca Hein; Stephan Nickels; Dieter Flesch-Janys; Judith Heinz; Hans-Peter Sinn; Irene Konstantopoulou; Florentia Fostira; Dimitrios Pectasides; Athanasios M Dimopoulos; George Fountzilas; Christine L Clarke; Rosemary Balleine; Janet E Olson; Zachary Fredericksen; Robert B Diasio; Harsh Pathak; Eric Ross; JoEllen Weaver; Thomas Rüdiger; Asta Försti; Thomas Dünnebier; Foluso Ademuyiwa; Swati Kulkarni; Katri Pylkäs; Arja Jukkola-Vuorinen; Yon-Dschun Ko; Erik Van Limbergen; Hilde Janssen; Julian Peto; Olivia Fletcher; Graham G Giles; Laura Baglietto; Senno Verhoef; Ian Tomlinson; Veli-Matti Kosma; Jonathan Beesley; Dario Greco; Carl Blomqvist; Astrid Irwanto; Jianjun Liu; Fiona M Blows; Sarah-Jane Dawson; Sara Margolin; Arto Mannermaa; Nicholas G Martin; Grant W Montgomery; Diether Lambrechts; Isabel dos Santos Silva; Gianluca Severi; Ute Hamann; Paul Pharoah; Douglas F Easton; Jenny Chang-Claude; Drakoulis Yannoukakos; Heli Nevanlinna; Xianshu Wang; Fergus J Couch
Journal:  Cancer Res       Date:  2011-08-15       Impact factor: 12.701

7.  Combined effect of low-penetrant SNPs on breast cancer risk.

Authors:  S Harlid; M I L Ivarsson; S Butt; E Grzybowska; J E Eyfjörd; P Lenner; A Försti; K Hemminki; J Manjer; J Dillner; J Carlson
Journal:  Br J Cancer       Date:  2011-11-01       Impact factor: 7.640

8.  Common breast cancer susceptibility alleles are associated with tumour subtypes in BRCA1 and BRCA2 mutation carriers: results from the Consortium of Investigators of Modifiers of BRCA1/2.

Authors:  Anna Marie Mulligan; Fergus J Couch; Daniel Barrowdale; Susan M Domchek; Diana Eccles; Heli Nevanlinna; Susan J Ramus; Mark Robson; Mark Sherman; Amanda B Spurdle; Barbara Wappenschmidt; Andrew Lee; Lesley McGuffog; Sue Healey; Olga M Sinilnikova; Ramunas Janavicius; Thomas vO Hansen; Finn C Nielsen; Bent Ejlertsen; Ana Osorio; Iván Muñoz-Repeto; Mercedes Durán; Javier Godino; Maroulio Pertesi; Javier Benítez; Paolo Peterlongo; Siranoush Manoukian; Bernard Peissel; Daniela Zaffaroni; Elisa Cattaneo; Bernardo Bonanni; Alessandra Viel; Barbara Pasini; Laura Papi; Laura Ottini; Antonella Savarese; Loris Bernard; Paolo Radice; Ute Hamann; Martijn Verheus; Hanne E J Meijers-Heijboer; Juul Wijnen; Encarna B Gómez García; Marcel R Nelen; C Marleen Kets; Caroline Seynaeve; Madeleine M A Tilanus-Linthorst; Rob B van der Luijt; Theo van Os; Matti Rookus; Debra Frost; J Louise Jones; D Gareth Evans; Fiona Lalloo; Ros Eeles; Louise Izatt; Julian Adlard; Rosemarie Davidson; Jackie Cook; Alan Donaldson; Huw Dorkins; Helen Gregory; Jacqueline Eason; Catherine Houghton; Julian Barwell; Lucy E Side; Emma McCann; Alex Murray; Susan Peock; Andrew K Godwin; Rita K Schmutzler; Kerstin Rhiem; Christoph Engel; Alfons Meindl; Ina Ruehl; Norbert Arnold; Dieter Niederacher; Christian Sutter; Helmut Deissler; Dorothea Gadzicki; Karin Kast; Sabine Preisler-Adams; Raymonda Varon-Mateeva; Ines Schoenbuchner; Britta Fiebig; Wolfram Heinritz; Dieter Schäfer; Heidrun Gevensleben; Virginie Caux-Moncoutier; Marion Fassy-Colcombet; François Cornelis; Sylvie Mazoyer; Mélanie Léoné; Nadia Boutry-Kryza; Agnès Hardouin; Pascaline Berthet; Danièle Muller; Jean-Pierre Fricker; Isabelle Mortemousque; Pascal Pujol; Isabelle Coupier; Marine Lebrun; Caroline Kientz; Michel Longy; Nicolas Sevenet; Dominique Stoppa-Lyonnet; Claudine Isaacs; Trinidad Caldes; Miguel de la Hoya; Tuomas Heikkinen; Kristiina Aittomäki; Ignacio Blanco; Conxi Lazaro; Rosa B Barkardottir; Penny Soucy; Martine Dumont; Jacques Simard; Marco Montagna; Silvia Tognazzo; Emma D'Andrea; Stephen Fox; Max Yan; Tim Rebbeck; Olufunmilayo Olopade; Jeffrey N Weitzel; Henry T Lynch; Patricia A Ganz; Gail E Tomlinson; Xianshu Wang; Zachary Fredericksen; Vernon S Pankratz; Noralane M Lindor; Csilla Szabo; Kenneth Offit; Rita Sakr; Mia Gaudet; Jasmine Bhatia; Noah Kauff; Christian F Singer; Muy-Kheng Tea; Daphne Gschwantler-Kaulich; Anneliese Fink-Retter; Phuong L Mai; Mark H Greene; Evgeny Imyanitov; Frances P O'Malley; Hilmi Ozcelik; Gordon Glendon; Amanda E Toland; Anne-Marie Gerdes; Mads Thomassen; Torben A Kruse; Uffe Birk Jensen; Anne-Bine Skytte; Maria A Caligo; Maria Soller; Karin Henriksson; von Anna Wachenfeldt; Brita Arver; Marie Stenmark-Askmalm; Per Karlsson; Yuan Chun Ding; Susan L Neuhausen; Mary Beattie; Paul D P Pharoah; Kirsten B Moysich; Katherine L Nathanson; Beth Y Karlan; Jenny Gross; Esther M John; Mary B Daly; Saundra M Buys; Melissa C Southey; John L Hopper; Mary Beth Terry; Wendy Chung; Alexander F Miron; David Goldgar; Georgia Chenevix-Trench; Douglas F Easton; Irene L Andrulis; Antonis C Antoniou
Journal:  Breast Cancer Res       Date:  2011-11-02       Impact factor: 6.466

9.  Genetic predisposition, parity, age at first childbirth and risk for breast cancer.

Authors:  Salma Butt; Sophia Harlid; Signe Borgquist; Malin Ivarsson; Göran Landberg; Joakim Dillner; Joyce Carlson; Jonas Manjer
Journal:  BMC Res Notes       Date:  2012-08-07

10.  Genome-Wide Association Studies (GWAS) breast cancer susceptibility loci in Arabs: susceptibility and prognostic implications in Tunisians.

Authors:  Jingxuan Shan; Wijden Mahfoudh; Shoba P Dsouza; Elham Hassen; Noureddine Bouaouina; Sonia Abdelhak; Ahlem Benhadjayed; Hager Memmi; Rebecca Ann Mathew; Idil I Aigha; Sallouha Gabbouj; Yassmine Remadi; Lotfi Chouchane
Journal:  Breast Cancer Res Treat       Date:  2012-08-22       Impact factor: 4.872

View more
  6 in total

1.  Significant association of TOX3/LOC643714 locus-rs3803662 and breast cancer risk in a cohort of Iranian population.

Authors:  Amir Tajbakhsh; Fahimeh Afzal Javan; Mahdi Rivandi; Atefeh Moezzi; Soheila Abedini; Mahla Asghari; Zahra Farjami; Hosein Soltanian; Fatemeh Homaei Shandiz; Mohammad Mahdi Kooshyar; Alireza Pasdar
Journal:  Mol Biol Rep       Date:  2018-12-04       Impact factor: 2.316

2.  An in silico approach to characterize nonsynonymous SNPs and regulatory SNPs in human TOX3 gene.

Authors:  Mehran Akhtar; Tazkira Jamal; Jalal Ud Din; Chandni Hayat; Mamoona Rauf; Syed Manzoor Ul Haq; Raham Sher Khan; Aftab Ali Shah; Muhsin Jamal; Fazal Jalil
Journal:  J Genet       Date:  2019-12       Impact factor: 1.166

3.  Polymorphisms in TIM-3 and breast cancer susceptibility in Chinese women: A case-control study.

Authors:  Zheng Wang; Xinghan Liu; Xijing Wang; Tie Chong; Shuai Lin; Meng Wang; Xiaobin Ma; Kang Liu; Peng Xu; Yanjing Feng; Zhijun Dai
Journal:  Oncotarget       Date:  2016-07-12

4.  The breast cancer susceptibility-related polymorphisms at the TOX3/LOC643714 locus associated with lung cancer risk in a Han Chinese population.

Authors:  Chaowen Jiang; Shilong Yu; Pin Qian; Ruiling Guo; Ruijie Zhang; Zhi Ao; Qi Li; Guoming Wu; Yan Chen; Jin Li; Changzheng Wang; Wei Yao; Jiancheng Xu; Guisheng Qian; Fuyun Ji
Journal:  Oncotarget       Date:  2016-09-13

5.  Risk Association of TOX3 and MMP7 Gene Polymorphisms with Sporadic Breast Cancer in Mexican Women.

Authors:  Orlando Solis-Coronado; Mónica Patricia Villarreal-Vela; Hazyadee Frecia Rodríguez-Gutiérrez; Juan Francisco González-Guerrero; Ricardo M Cerda-Flores; Fernando Alcorta-Núñez; Karen Paola Camarillo-Cárdenas; Diana Cristina Pérez-Ibave; Oscar Vidal-Gutiérrez; Genaro A Ramírez-Correa; María Lourdes Garza-Rodríguez
Journal:  Curr Oncol       Date:  2022-02-11       Impact factor: 3.677

Review 6.  Breast cancer: The translation of big genomic data to cancer precision medicine.

Authors:  Siew-Kee Low; Hitoshi Zembutsu; Yusuke Nakamura
Journal:  Cancer Sci       Date:  2017-12-30       Impact factor: 6.716

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.