Literature DB >> 26238421

Evaluation of reference gene suitability for quantitative expression analysis by quantitative polymerase chain reaction in the mandibular condyle of sheep.

Xin Jiang1, Yang Xue2, Hongzhi Zhou1, Shouhong Li3, Zongmin Zhang1, Rui Hou1, Yuxiang Ding1, Kaijin Hu1.   

Abstract

Reference genes are commonly used as a reliable approach to normalize the results of quantitative polymerase chain reaction (qPCR), and to reduce errors in the relative quantification of gene expression. Suitable reference genes belonging to numerous functional classes have been identified for various types of species and tissue. However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. Sheep are important for the study of human bone diseases, particularly for temporomandibular diseases. The present study aimed to identify a set of reference genes suitable for the normalization of qPCR data from the mandibular condyle of sheep. A total of 12 reference genes belonging to various functional classes were selected, and the expression stability of the reference genes was determined in both the normal and fractured area of the sheep mandibular condyle. RefFinder, which integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, was used to compare and rank the candidate reference genes. The results obtained from the four methods demonstrated a similar trend: RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle. As determined by RefFinder comprehensive analysis, the results of the present study suggested that RPL19 is the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 may be considered suitable alternatives.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26238421      PMCID: PMC4581798          DOI: 10.3892/mmr.2015.4128

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is commonly used to measure the expression levels of a selected gene of interest by quantifying the mRNA transcripts. RT-qPCR technology provides highly sensitive and accurate expression profiles (1,2). However, numerous parameters need to be controlled in order to obtain reliable quantitative expression measurements. These parameters include variations in the initial sample amount, RNA recovery, RNA integrity, efficiency of cDNA synthesis, and differences in the overall transcriptional activity of the tissue or cells analyzed (3). Therefore, reference genes are commonly used as internal controls. The reference gene is submitted to the same experimental protocol as the target gene in order to normalize qPCR data, and in order to reduce possible errors generated during the quantification of gene expression. The expression levels of the target gene are then normalized according to the values of the internal controls. Therefore, selecting a suitable reference gene is important for the correct interpretation of RT-qPCR analyses. Typically, reference genes satisfy the following criteria: They are highly expressed in the cells of interest, variability in the expression levels of the reference gene between samples is minimal, and the reference gene expression is not influenced by experimental conditions (2,4). However, it has recently become apparent that no single gene is constitutively expressed in all cell types and under all experimental conditions, implying that the expression stability of the intended control gene must be verified prior to each experiment. Therefore, the selection of a suitable reference gene is largely dependent on the experimental tissue samples. At present, GAPDH, ACTB, and 18S rRNA are the most commonly used reference genes. However, previous studies have demonstrated that these reference genes are not always suitable, as they exhibit different behaviors in various types of cells and tissue (5,6), particularly in sheep. Due to their unique advantages (such as their similarity to humans in anatomy, physiology and wound repair mechanisms), sheep are widely used in medical experimental studies. Previous studies have successfully identified the most suitable reference genes for ovine nervous tissue, spleen, ileum, lung, mesenteric lymph node, pulmonary tissue, and blood (7–10). However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. The present study aimed to identify a set of reference genes suitable for the normalization of sheep mandibular condyle RT-qPCR data. A total of 12 commonly-used reference genes belonging to various functional classes were selected, and their expression stability was determined in both normal and fractured sheep mandibular condyles. RefFinder was used to validate the reference genes.

Materials and methods

Animals

Nine healthy sheep (six male and three female; age, 1 year; weight, 30–40 kg) were included in the present study. The sheep were obtained from the Animal Experimental Center and housed at the School of Stomatology, both at The Fourth Military Medical University (Xi'an, China). Condylar fractures on the right side of the sheep mandibular were created as previously reported (11). Briefly, the zygomatic arch and the panniculus carnosus muscles at the surface of the capsule of the temporomandibular joint were exposed via a curved pre-auricular skin incision. A horizontal incision was subsequently made through the capsule at the condylar neck to open the inferior joint space. An oblique vertical osteotomy was made from the lateral pole of the condyle to the medial side of the condylar neck, using an ultrasound osteotome (Guilin Woodpecker Medical Instrument Co., Ltd., Guilin, China). The left side of the sheep mandibular served as a control. Three sheep were postoperatively sacrificed at the end of the second, fourth and twelfth week by dissecting the carotid artery (under a general anaesthetic) resulting in acute hemorrhagic death. The bones surrounding the fracture line on the right side, and the bones from the corresponding area on the left side were subsequently collected for further experimentation. The present study was approved by the Ethics Committee of the School of Stomatology, The Fourth Military Medical University. All surgical procedures were conducted under satisfactory anesthesia (0.1 ml/kg xylazine hydrochloride; Military Veterinary Research Institute of Military Medical Science, Changchun, China). The sheep were cared for according to the guidelines set by the Laboratory Animal Research Centre of the Fourth Military Medical University.

Total RNA extraction and cDNA synthesis

Total RNA was extracted using the Total RNA kit I (Omega Bio-Tek, Inc., Norcross, GA, USA), according to the manufacturer's instructions. Contaminating genomic DNA was removed by on-column treatment of each sample with DNase I (Omega Bio-Tek, Inc., Norcross, GA, USA). The purity and quality of the extracted RNA was evaluated using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA) at a wavelength of 260 nm. Total RNA (500 ng) was reverse transcribed in a final volume of 50 µl using PrimeScript® RT Reagent kit (Takara Bio, Inc., Otsu, Japan), according to the manufacturer's instructions. The cDNA was subsequently stored at −20°C.

Gene selection and primer design

A total of 12 genes belonging to various functional classes, which are frequently used as references genes in RT-qPCR studies, were selected for experimentation. The following genes were included in the present study: ACTB, YWHAZ, HPRT, TFRC, SDHA, B2M, PGK1, GAPDH, G6PD, RPL19, RPS24 and 18S. The primer sequences are specified in Table I (Augct, Beijing, China). The primer sequences for PGK1, SDHA, and G6PD were based on previous publications (7,9).
Table I

Primer sequences of the 12 candidate reference genes.

Gene namePrimer sequences
RPL19F: 5′ AGCCTGTGACTGTCCATTCC 3′R: 5′ ACGTTACCTTCTCGGGCATT 3′
YWHAZF: 5′ AGACGGAAGGTGCTGAGAAA 3′R: 5′ CGTTGGGGATCAAGAACTTT 3′
PGK1F: 5′ ACTCCTTGCAGCCAGTTGCT 3′R: 5′ AGCACAAGCCTTCTCCACTTCT 3′
HPRTF: 5′ TTTATTCCTCATGGACTAATTATGGA 3′R: 5′ CCACCCATCTCCTTCATCAC 3′
TFRCF: 5′ TTCTGGGCAGACCTCAAATC 3′R: 5′ CAGCTTCACGTGGGACATAA 3′
G6PDF: 5′ TGACCTATGGCAACCGATACAA 3′R: 5′ CCGCAAAAGACATCCAGGAT 3′
B2MF: 5′ CTGTCGCTGTCTGGACTGG 3′R: 5′ TTTGGCTTTCCATCTTCTGG 3′
ACTBF: 5′ CCAACCGTGAGAAGATGACC 3′R: 5′ CCAGAGGCGTACAGGGACAG 3′
SDHAF: 5′ CATCCACTACATGACGGAGCA 3′R: 5′ ATCTTGCCATCTTCAGTTCTGCTA 3′
RPS24F: 5′ TTTGCCAGCACCAACGTTG 3′R: 5′ AAGGAACGCAAGAACAGAATGAA 3′
18SF: 5′ TGGTCGCTCGCTCCTCTCC 3′R: 5′ CGCCTGCTGCCTTCCTTGG 3′
GAPDHF: 5′ CCAGAGGCGGACTACTACG 3′R: 5′ CCG AGA GAGCAACACAGG 3′

F, forward; R, reverse.

RT-qPCR

All RT-qPCR reactions were performed in a 20 µl volume using SYBR® Premix Ex Taq™ II (Takara Bio, Inc.). The RT-qPCR was performed according to the instructions of the ABI 7500 real-time PCR system (Applied Biosystems Life Technologies, Foster City, CA, USA), which were as follows: Holding stage, 95°C for 3 min; 40 cycles of 95°C for 15 sec and 55°C for 34 sec; melt curve stage, 95°C for 15 secs, 60°C for 1 min, 95°C 30 sec and 60°C for 15 sec. A melt curve was included at the end of each RT-qPCR reaction.

Data analysis

RefFinder (http://www.leonxie.com/referencegene.php?type=reference) was used in order to validate the reference genes. RefFinder is a user-friendly web-based comprehensive tool developed for evaluating and screening reference genes from extensive experimental datasets. RefFinder integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, in order to compare and rank experimental candidate reference genes. Based on the rankings from each program, RefFinder assigns an appropriate weight to an individual gene, and calculates the geometric mean of these weights in order to generate a final overall ranking. In addition to analyses of the test and control groups, the expression data of the two groups were also combined to form a combined group.

Results

Expression levels of reference genes

All 12 reference genes expressed in the mandibular condyle of the sheep exhibited a single marked increase in the melt-curve. RPL19 and 18S exhibited the highest expression levels, with a comparative threshold (Ct) mean of 17.46 and 26.09, respectively, whereas B2M showed the lowest expression levels, with a Ct mean of 29.78. Ct refers to the cycle number at which the fluorescence intensity exceeds the set threshold. A high Ct value represents a low original template concentration, while a low Ct value represents a high original template concentration.

geNorm analysis

The stability values (M) of the reference genes were calculated using the geNorm algorithm. High M-values indicated high gene expression variability, whereas the most stable genes exhibited M-values <1.5. The M-values of the reference genes in the normal and fractured area of the sheep mandibular condyle as determined by geNorm, are shown in Table II and Fig. 1. In the control group, the most stable genes were RPL19 and ACTB, with an average M-value of 0.754. The second most stable gene was PGK1, with an average M-value of 0.948, whereas the least stable genes were SDHA and G6PD. However, in the test group, the most stable genes were S24 and B2M with an average M-value of 1.657, whereas the least stable genes were HPRT and YWHAZ. A comprehensive analysis of the combined group by geNorm identified the most stable genes to be RPL19 and ACTB, with an average M-value of 1.081. The second most stable gene in the combined group was PGK1, with an average M-value of 1.359. The remaining genes exhibited high M-values >1.5, with the least stable genes being SDHA and YWHAZ. Notably, SDHA and YWHAZ are considered conventional housekeeping genes in ovine blood (12).
Table II

Expression stability of candidate reference genes, as determined by geNorm.

Gene nameM-value
ControlTestCombined
ACTB0.745 (1)1.778 (3)1.081 (1)
RPL190.745 (1)1.868 (4)1.081 (1)
PGK10.948 (3)2.110 (6)1.359 (3)
18S1.074 (4)2.665 (9)2.206 (7)
GAPDH1.235 (5)2.001 (5)1.535 (4)
B2M1.518 (6)1.657 (1)1.743 (5)
HPRT1.713 (7)3.182 (11)2.774 (10)
S241.877 (8)1.657 (1)1.996 (6)
TFRC2.037 (9)2.480 (8)2.387 (8)
YWHAZ2.258 (10)3.861 (12)4.058 (12)
G6PD2.473 (11)2.350 (7)2.553 (9)
SDHA2.742 (12)2.943 (10)3.059 (11)

Control, normal ovine condyle; test, fractured ovine condyle; combined, both normal and fractured ovine condyle. Numbers in brackets represent ranking of genes by expression stability.

Figure 1

Candidate reference genes ranked according to their expression stability, as determined by geNorm. (Y-axis, stability values of the reference genes).

NormFinder analysis

NormFinder ranks candidate genes according to their expression stability values (ϱ) based on the similarity of their expression profiles. Lower values are assigned to the most stable genes. The candidate gene expression stabilities, as determined by NormFinder, are shown in Table III and Fig. 2. In the control group, the expression stability analysis demonstrated that ACTB was the most stable gene, with a ϱ-value of 0.838. In the test group, PGK1 was identified as the most stable reference gene, with a ϱ-value of 1.209. When the expression data were combined (combined group), the results confirmed that RPL19 was the most stable gene, with a ϱ-value of 1.146.
Table III

Expression stability of candidate reference genes, as determined by NormFinder.

Gene nameϱ-value
ControlTestCombined
ACTB0.838 (1)1.642 (4)1.252 (2)
HPRT1.015 (2)3.887 (11)2.933 (10)
18S1.073 (3)2.851 (9)2.266 (7)
RPL191.325 (4)1.413 (2)1.146 (1)
GAPDH1.439 (5)2.110 (7)1.884 (6)
S241.675 (6)2.086 (6)2.468 (8)
PGK11.696 (7)1.209 (1)1.296 (3)
TFRC1.937 (8)1.928 (5)1.723 (5)
B2M2.064 (9)2.233 (8)1.679 (4)
YWHAZ2.832 (10)6.895 (12)8.789 (12)
G6PD3.060 (11)1.602 (3)2.563 (9)
SDHA3.691 (12)3.351 (10)4.009 (11)

Control, normal ovine condyle; test, fractured ovine condyle; combined, both normal and fractured ovine condyle. Numbers in brackets represent ranking of genes by expression stability.

Figure 2

Candidate reference genes ranked according to their expression stability, as determined by NormFinder. (Y-axis, stability values of the reference genes).

BestKeeper analysis

Analysis of the reference gene expression levels was carried out using the BestKeeper software (Table IV and Fig. 3). In the control group, the results showed that ACTB was the most stable gene, with a stability value of 0.78. In the test group, PGK1 was identified as the most stable reference gene, with a stability value of 0.93. In the combined group, PGK1 was determined to be the most stably expressed reference gene with a stability value of 0.96, whereas YWAZH was the least stable reference gene.
Table IV

Expression stability of candidate reference genes, as determined by BestKeeper.

Gene nameStability value
ControlTestCombined
ACTB0.78 (1)1.39 (2)1.18 (2)
18S0.87 (2)2.51 (9)1.88 (6)
PGK11.00 (3)0.93 (1)0.96 (1)
RPL191.08 (4)1.66 (4)1.46 (3)
GAPDH1.42 (5)1.81 (5)1.80 (5)
S241.46 (6)1.51 (3)1.74 (4)
HPRT1.50 (7)4.16 (12)2.69 (10)
B2M1.98 (8)2.28 (8)2.16 (9)
TFRC2.07 (9)2.16 (7)1.94 (7)
YWHAZ2.23 (10)3.23 (11)4.93 (12)
G6PD3.56 (11)1.92 (6)2.14 (8)
SDHA4.08 (12)2.51 (9)2.98 (11)

Control, normal ovine condyle; test, fractured ovine condyle; combined, both normal and fractured ovine condyle. Numbers in brackets represent ranking of genes by expression stability.

Figure 3

Candidate reference genes ranked according to their expression stability, as determined by BestKeeper. (Y-axis, stability values of the reference genes).

ΔCt analysis

The ΔCt method ranks a set of genes according to the repeatability of the gene expression differences among various samples (STDEV average). The results of the ΔCt analysis are shown in Table V and Fig. 4. In the control group, ACTB was the most stable reference gene followed by 18S, with stability values of 2.07 and 2.21, respectively. In the test group, G6PD and RPL19 were the highest stably expressed genes with stability values of 2.28 and 3.09, respectively. The combined results (combined group) identified RPL19 and ACTB as the most stable genes, with stability values of 3.02 and 3.06, respectively. YWHAZ and SDHA were the least stably expressed genes, with stability values of 9.05 and 4.88, respectively.
Table V

Expression stability of candidate reference genes, as determined by the ΔCt method.

Gene nameStability value
ControlTestCombined
ACTB2.07 (1)3.11 (2)3.06 (2)
18S2.21 (2)3.91 (9)3.67 (8)
RPL192.24 (3)3.09 (1)3.02 (1)
HPRT2.30 (4)4.65 (11)4.18 (10)
GAPDH2.38 (5)3.38 (6)3.37 (4)
PGK12.47 (6)3.12 (3)3.16 (3)
S242.63 (7)3.35 (5)3.64 (7)
B2M2.77 (8)3.42 (8)3.42 (5)
TFRC2.79 (9)3.41 (7)3.49 (6)
YWHAZ3.40 (10)7.25 (12)9.05 (12)
G6PD11.00 (11)2.28 (4)3.77 (9)
SDHA12.00 (12)4.36 (10)4.88 (11)

Control, normal ovine condyle; test, fractured ovine condyle; combined, normal and fractured ovine condyle. Numbers in brackets represent ranking of genes by expression stability.

Figure 4

Candidate reference genes ranked according to their expression stability, as determined by the ΔCt method. (Y-axis, stability values of the reference genes).

Comprehensive analysis

The combined results obtained from geNorm, BestKeeper, the ΔCt method, and NormFinder were analyzed comprehensively using RefFinder (Table VI and Fig. 5). In the control group, RefFinder identified ACTB as the most stably expressed gene, with a stability value of 1.00. In the test group, PGK1 was the most stable reference gene with a stability value of 2.06. The combined results of the two groups (combined group) identified RPL19 as the most stably expressed reference gene with a stability value of 1.32, whereas YWAZH was the least stable reference gene. Candidate reference genes of the control group, test group and combined group, ranked using five different methods, were compared in Figs. 6–8, respectively. Though each algorithm employs a different method to determine the most suitable reference gene, the results obtained from all of the methods exhibited a similar trend.
Table VI

Expression stability of candidate reference genes, as determined by RefFinder.

Gene nameStability value
ControlTestCombined
ACTB1.00 (1)2.63 (3)1.68 (2)
RPL192.63 (2)2.38 (2)1.32 (1)
18S2.63 (3)9.00 (9)6.96 (8)
PGK14.41 (4)2.06 (1)2.28 (3)
HPRT4.45 (5)11.24 (11)10.00 (10)
GAPDH5.00 (6)5.69 (7)4.68 (4)
S246.70 (7)3.08 (4)6.05 (6)
B2M7.67 (8)4.76 (6)5.48 (5)
TFRC8.74 (9)6.65 (8)6.40 (7)
YWHAZ10.00 (10)11.74 (12)2.00 (12)
G6PD11.00 (11)4.74 (5)8.74 (9)
SDHA12.00 (12)10.00 (10)11.00 (11)

Control, normal ovine condyle; test, fractured ovine condyle; combined, both normal and fractured ovine condyle. Numbers in brackets represent ranking of genes by expression stability.

Figure 5

Candidate reference genes ranked, as determined by comprehensive analysis. (Y-axis, stability values of the reference genes).

Figure 6

Candidate reference genes of the control group ranked using five different methods. (Y-axis, stability values of the reference genes).

Figure 7

Candidate reference genes of the test group ranked using five different methods. (Y-axis, stability values of the reference genes).

Figure 8

Candidate reference genes of the combined group ranked using five different methods. (Y-axis, stability values of the reference genes).

Discussion

Due to its high specificity, sensitivity, efficiency and repetitiveness, RT-qPCR has been widely used to measure the expression levels of target genes. The advantages of RT-qPCR also includes rapid detection, simple design, and low cost. However, the primary limitation of relative quantification is that a reference gene must be included as an internal control. Numerous reference genes, such as GAPDH, ACTB, 18S, and G6PD, have previously been identified. However, to date, no reference gene has been shown to be constitutively expressed in all cell types and under all experimental conditions. Therefore, evaluating the expression stability of candidate reference genes and identifying the most stable gene is important in order to ensure the authenticity and reliability of a given study. Numerous reference genes have been identified as suitable for various ovine tissue samples. SDHA and YWHAZ are considered to be the most suitable internal controls for RT-qPCR analysis of ovine blood (12), ACTB for the cerebrum and spleen, and GAPDH for the mesenteric lymph node (7). However, little is currently known regarding the most suitable reference gene for the bone, particularly for the sheep mandibular condyle. Sheep have an important role in the study of human bone diseases, particularly studies associated with temporomandibular diseases (13,14). Therefore, the identification of a reference gene suitable for the normalization of sheep mandibular condyle RT-qPCR analyses is necessary. In the present study, the expression stability of 12 housekeeping genes were examined in both normal and fractured sheep mandibular condyles using the following algorithms: geNorm, NormFinder, BestKeeper, and the ΔCt method. geNorm (15) calculates the expression ratio of two ideal internal control genes in two identical samples, regardless of the experimental conditions or cell type. For each control gene, the pairwise variation is determined as the standard deviation of the logarithmically transformed expression ratios, and the internal control gene-stability value (M) is determined as the average pairwise variation of a particular gene with all other control genes. NormFinder (3) ranks the candidate genes according to their expression stability values (ϱ) based on the similarity of their expression profiles. BestKeeper (16) identifies the most suitable reference genes using a pairwise correlation analysis of all pairs of candidate genes, and calculates the geometric mean of the most suitable genes. The ΔCt (17) method ranks a set of genes according to the repeatability of the gene expression differences among various samples (average of STDEV). Although each algorithm employs a different method to determine the most suitable reference gene, in the present study the results obtained from all five methods exhibited a similar trend (Fig. 6–8). All methods determined that RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle, regardless of whether the candidate genes were analyzed for the normal group, the fracture group, or the combined group. The results obtained from the various algorithms were comprehensively analyzed using RefFinder. Based on the rankings obtained from each algorithm, RefFinder assigns an appropriate weight to an individual gene, and calculates the geometric mean of these weights, in order to obtain an overall final ranking. The results demonstrated that ACTB and RPL19 were the most stable reference genes expressed in the normal sheep mandibular condyle, PGK1 and RPL19 were the most stable reference genes expressed in the fractured sheep mandibular condyle, whereas RPL19 and ACTB were the most stably expressed reference genes in both the normal and fractured sheep mandibular condyle (combined group). The results of the present study identified RPL19 as the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 were shown to be suitable alternatives. These results differ from previous reports of sheep reference gene suitability, which included the identification of SDHA and YWHAZ as the most stable reference genes for ovine blood (12), ACTB for the cerebrum and spleen, and GAPDH for the mesenteric lymph node (7). In conclusion, the results of the present study suggested that if these previously reported genes were to be used as reference genes in studies associated with the sheep mandibular condyle, the results of such a study may be negatively affected.
  17 in total

1.  Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper--Excel-based tool using pair-wise correlations.

Authors:  Michael W Pfaffl; Ales Tichopad; Christian Prgomet; Tanja P Neuvians
Journal:  Biotechnol Lett       Date:  2004-03       Impact factor: 2.461

2.  Gene expression studies in prostate cancer tissue: which reference gene should be selected for normalization?

Authors:  Falk Ohl; Monika Jung; Chuanliang Xu; Carsten Stephan; Anja Rabien; Mick Burkhardt; Andreas Nitsche; Glen Kristiansen; Stefan A Loening; Aleksandar Radonić; Klaus Jung
Journal:  J Mol Med (Berl)       Date:  2005-10-07       Impact factor: 4.599

3.  Effect of scrapie on the stability of housekeeping genes.

Authors:  J Lyahyai; C Serrano; B Ranera; J J Badiola; P Zaragoza; I Martin-Burriel
Journal:  Anim Biotechnol       Date:  2010       Impact factor: 2.282

4.  Real time quantitative PCR.

Authors:  C A Heid; J Stevens; K J Livak; P M Williams
Journal:  Genome Res       Date:  1996-10       Impact factor: 9.043

5.  Positive correlation between relative mRNA expression of PRNP and SPRN in cerebral and cerebellar cortex of sheep.

Authors:  Evelyne Lampo; Mario Van Poucke; Jo Vandesompele; Tim Erkens; Alex Van Zeveren; Luc J Peelman
Journal:  Mol Cell Probes       Date:  2008-11-24       Impact factor: 2.365

6.  Morphological evaluation of temporomandibular joint after open and closed treatment of type B diacapsular condylar fractures in sheep.

Authors:  Fan-Wen Meng; Kai-Jin Hu; Liang Kong; Yan-Tao Zhao; Yan-Pu Liu; Shu-Xia Zhou
Journal:  Ann Anat       Date:  2009-02-12       Impact factor: 2.698

7.  Evaluation of internal reference genes for quantitative expression analysis by real-time PCR in ovine whole blood.

Authors:  Simone Peletto; Simone Bertuzzi; Chiara Campanella; Paola Modesto; Maria Grazia Maniaci; Claudio Bellino; Dario Ariello; Antonio Quasso; Maria Caramelli; Pier Luigi Acutis
Journal:  Int J Mol Sci       Date:  2011-11-09       Impact factor: 5.923

8.  Selection of reference genes for normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries.

Authors:  Margaret Passmore; Maria Nataatmadja; John F Fraser
Journal:  BMC Mol Biol       Date:  2009-07-23       Impact factor: 2.946

9.  Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR.

Authors:  Nicholas Silver; Steve Best; Jie Jiang; Swee Lay Thein
Journal:  BMC Mol Biol       Date:  2006-10-06       Impact factor: 2.946

10.  Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.

Authors:  Jo Vandesompele; Katleen De Preter; Filip Pattyn; Bruce Poppe; Nadine Van Roy; Anne De Paepe; Frank Speleman
Journal:  Genome Biol       Date:  2002-06-18       Impact factor: 13.583

View more
  4 in total

1.  Developmental programming: Metabolic tissue-specific changes in endoplasmic reticulum stress, mitochondrial oxidative and telomere length status induced by prenatal testosterone excess in the female sheep.

Authors:  Muraly Puttabyatappa; Joseph N Ciarelli; Adam G Chatoff; Vasantha Padmanabhan
Journal:  Mol Cell Endocrinol       Date:  2021-02-17       Impact factor: 4.102

2.  A tissue-based approach to selection of reference genes for quantitative real-time PCR in a sheep osteoporosis model.

Authors:  Felix Schulze; Deeksha Malhan; Thaqif El Khassawna; Christian Heiss; Anja Seckinger; Dirk Hose; Angela Rösen-Wolff
Journal:  BMC Genomics       Date:  2017-12-19       Impact factor: 3.969

3.  Gene Expression Profile Analysis is Directly Affected by the Selected Reference Gene: The Case of Leaf-Cutting Atta Sexdens.

Authors:  Kalynka G do Livramento; Natália C Freitas; Wesley P F Máximo; Ronald Zanetti; Luciano V Paiva
Journal:  Insects       Date:  2018-02-08       Impact factor: 2.769

4.  Identification of extracellular vesicles and characterization of miRNA expression profiles in human blastocoel fluid.

Authors:  R Battaglia; S Palini; M E Vento; A La Ferlita; M J Lo Faro; E Caroppo; P Borzì; L Falzone; D Barbagallo; M Ragusa; M Scalia; G D'Amato; P Scollo; P Musumeci; M Purrello; E Gravotta; C Di Pietro
Journal:  Sci Rep       Date:  2019-01-14       Impact factor: 4.379

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.