Literature DB >> 26226636

miR-965 controls cell proliferation and migration during tissue morphogenesis in the Drosophila abdomen.

Pushpa Verma1, Stephen M Cohen1.   

Abstract

Formation of the Drosophila adult abdomen involves a process of tissue replacement in which larval epidermal cells are replaced by adult cells. The progenitors of the adult epidermis are specified during embryogenesis and, unlike the imaginal discs that make up the thoracic and head segments, they remain quiescent during larval development. During pupal development, the abdominal histoblast cells proliferate and migrate to replace the larval epidermis. Here, we provide evidence that the microRNA, miR-965, acts via string and wingless to control histoblast proliferation and migration. Ecdysone signaling downregulates miR-965 at the onset of pupariation, linking activation of the histoblast nests to the hormonal control of metamorphosis. Replacement of the larval epidermis by adult epidermal progenitors involves regulation of both cell-intrinsic events and cell communication. By regulating both cell proliferation and cell migration, miR-965 contributes to the robustness of this morphogenetic system.

Entities:  

Keywords:  D. melanogaster; cell migration; cell proliferation; developmental biology; microRNA; stem cells

Mesh:

Substances:

Year:  2015        PMID: 26226636      PMCID: PMC4538364          DOI: 10.7554/eLife.07389

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Tissue morphogenesis is a complex process, through which the organism coordinates cell proliferation and cell death with cell migration and rearrangements to achieve final organ shape and size. Mechanisms controlling these processes play important role in morphogenesis, tissue repair and regeneration, and in cancer (Friedl and Gilmour, 2009; Rorth, 2009). The abdominal epithelium of Drosophila provides a useful model system in which to study the dynamics of tissue morphogenesis in vivo and to explore the genetic and cellular mechanisms that control these complex morphogenetic processes. During metamorphosis, larval epidermal tissues undergo cellular restructuring and rearrangement to give rise to adult abdominal epithelium. The adult abdominal epithelium is produced from progenitor cells, known as histoblast cells. Histoblasts are small diploid cells, easily distinguishable from the large polyploid larval epidermal cells (LEC) that surround them. Histoblasts are specified in the embryo and lie quiescent throughout larval development (Guerra et al., 1973; Simcox et al., 1991). There are four pairs of histoblast nests in each segment, which merge to assemble the adult abdominal epidermis (Madhavan and Schneiderman, 1977). The anterior and posterior dorsal histoblast nests give rise to the external dorsal cuticle of the abdominal segments (tergites), while the ventral pair give rise to the ventral cuticle (sternites). During larval stages, histoblasts are arrested in the G2 phase of the cell cycle. At pupariation, an ecdysone pulse triggers the expression of string (cdc25), which activates cyclin/CDK and pushes the histoblasts into rapid proliferation (Edgar and O'Farrell, 1990; Gautier et al., 1991). The proliferative phase is divided into two stages with distinct features (Madhavan and Madhavan, 1980; Ninov et al., 2009). The early ‘division phase’ is characterized by rapid and synchronous cell division without intervening G2 phases to allow for cell growth. Cells double in number and decrease in size with each division, with little change in the size of the nests. This is followed by a phase of slower division, from 15–40 hr of pupal development, in which proliferation is accompanied by longer intervening gap phases to allow cell growth. During this phase, epidermal growth factor receptor (EGFR) and Insulin receptor/PI3K- signaling coordinate the growth of cells with proliferation (Ninov et al., 2009). During the growth phase, the histoblast nests begin to spread to replace the LEC. The expansion of the histoblast nests by cell migration is accompanied by programmed cell death, so that larval cells are replaced by the expanding histoblast population to maintain integrity of the epithelium (Bischoff and Cseresnyes, 2009; Nakajima et al., 2011). Patterning of the adult abdominal segments makes use of many of the signaling pathways that pattern the embryonic and larval segments, including hedgehog, wingless, decapentaplegic and EGFR. Interactions between morphogen gradients produced by some of these proteins determine anterior-posterior and dorsal-ventral patterning of segments (Sanicola et al., 1995; Shirras and Couso, 1996; Struhl et al., 1997; Kopp et al., 1999; Ninov et al., 2010). Although abdominal segmental patterning has been extensively studied, the molecular mechanisms regulating cell division, migration, cell replacement and their interactions during formation of segments remain less well understood. Here, we provide evidence that the microRNA, miR-965, is required in the histoblast nests, where it acts via regulation of string and wingless to control histoblast proliferation and migration during pupal morphogenesis.

Results

The miR-965 microRNA is located in the first intron of the kismet gene (Figure 1A). kismet and miR-965 are transcribed in the same direction. Quantitative PCR showed that a series of P-element insertional mutants near the first exon of the kismet gene reduced the level of mature miR-965 miRNA, suggesting that kismet and miR-965 arise from a single transcription unit (Figure 1—figure supplement 1).
Figure 1.

The miR-965 mutant.

(A) miR-965 is located within the first intron of the kismet gene. The targeting strategies used to produce two independent miR-965 deletion mutants by ends-out homologous recombination are shown below. Left and Right homology arms cloned into in the targeting vector are shown in black. The w+ KO1 mutant was made by replacing miR-965 with a mini-white reporter (red) flanked by LoxP sites (grey). Sections are not represented to scale. w-KO1 indicates the targeted allele after Cre-mediated excision of the mini-white cassette. The w+ KO2 mutant was made by replacing miR-965 with mini-white flanked by LoxP sites and inverted attP sites (pink). w-KO2 indicates the allele after Cre-mediated excision of mini-white. Use of RMCE to replace the mini-white cassette with the miRNA to produce the 965-Rescue allele is shown at bottom. (B) miR-965 RNA level measured by quantitative miRNA PCR. RNA was isolated from adult flies of the indicated genotypes. Control was w. Df indicates Df(2L)ED19. Data represent the average of 3 independent experiments ± standard deviation (SD). (C) RT-PCR using primers flanking the first intron of kismet. A PCR product of normal size was produced using RNA from flies of each of the indicated genotypes. No product was produced in the absence of reverse transcriptase. (D) Quantitative real-time RT-PCR showing kismet transcript levels in miR-965 mutants (KO1/KO2 and KO1/Df) and the heterozygous KO1/+ and Df/+ controls. Data represent the average of 3 independent experiments ± SD. (E) Dorsal aspect of the abdomen from females with the indicated mutant combinations. Control was w. The number of affected individuals is shown below. ANOVA: p < 0.0001 for each mutant genotype compared to the w control or to the rescued mutant.

DOI: http://dx.doi.org/10.7554/eLife.07389.003

Above: diagram of the kismet locus showing miR-965 in the first intron. kismet and miR-965 are transcribed in the same direction. Below: quantitative miRNA PCR showing the level of miR-965 miRNA. miR-965 levels were reduced in flies carrying several kismet alleles associated with different transgene insertions near the first exon, in which both copies of the miRNA gene should be intact. Genotypes are shown at left and the expected number of copies of miR-965 DNA is shown at right. miR-965 levels were somewhat lower than the expected 50% in the KO/+ heterozygote. ‘B’ indicates balancer chromosome. Refers to Figure 1A–D.

DOI: http://dx.doi.org/10.7554/eLife.07389.004

Images showing the three classes of defect: gaps, or lack of tissue; fusion, and polarity reversal. Right panels show higher magnification views of the bristle pattern to illustrate the polarity reversal phenotype. Refers to Figure 1E.

DOI: http://dx.doi.org/10.7554/eLife.07389.005

Large gaps associated with fusion of adjacent segments occurred in ∼10% of cases. Gap penetrance per segment is shown at right. n = 200 flies. Refers to Figure 1E.

DOI: http://dx.doi.org/10.7554/eLife.07389.006

Figure 1—figure supplement 1.

Evidence that kismet and miR-965 arise from a common transcription unit.

Above: diagram of the kismet locus showing miR-965 in the first intron. kismet and miR-965 are transcribed in the same direction. Below: quantitative miRNA PCR showing the level of miR-965 miRNA. miR-965 levels were reduced in flies carrying several kismet alleles associated with different transgene insertions near the first exon, in which both copies of the miRNA gene should be intact. Genotypes are shown at left and the expected number of copies of miR-965 DNA is shown at right. miR-965 levels were somewhat lower than the expected 50% in the KO/+ heterozygote. ‘B’ indicates balancer chromosome. Refers to Figure 1A–D.

DOI: http://dx.doi.org/10.7554/eLife.07389.004

The miR-965 mutant.

(A) miR-965 is located within the first intron of the kismet gene. The targeting strategies used to produce two independent miR-965 deletion mutants by ends-out homologous recombination are shown below. Left and Right homology arms cloned into in the targeting vector are shown in black. The w+ KO1 mutant was made by replacing miR-965 with a mini-white reporter (red) flanked by LoxP sites (grey). Sections are not represented to scale. w-KO1 indicates the targeted allele after Cre-mediated excision of the mini-white cassette. The w+ KO2 mutant was made by replacing miR-965 with mini-white flanked by LoxP sites and inverted attP sites (pink). w-KO2 indicates the allele after Cre-mediated excision of mini-white. Use of RMCE to replace the mini-white cassette with the miRNA to produce the 965-Rescue allele is shown at bottom. (B) miR-965 RNA level measured by quantitative miRNA PCR. RNA was isolated from adult flies of the indicated genotypes. Control was w. Df indicates Df(2L)ED19. Data represent the average of 3 independent experiments ± standard deviation (SD). (C) RT-PCR using primers flanking the first intron of kismet. A PCR product of normal size was produced using RNA from flies of each of the indicated genotypes. No product was produced in the absence of reverse transcriptase. (D) Quantitative real-time RT-PCR showing kismet transcript levels in miR-965 mutants (KO1/KO2 and KO1/Df) and the heterozygous KO1/+ and Df/+ controls. Data represent the average of 3 independent experiments ± SD. (E) Dorsal aspect of the abdomen from females with the indicated mutant combinations. Control was w. The number of affected individuals is shown below. ANOVA: p < 0.0001 for each mutant genotype compared to the w control or to the rescued mutant. DOI: http://dx.doi.org/10.7554/eLife.07389.003

Evidence that kismet and miR-965 arise from a common transcription unit.

Above: diagram of the kismet locus showing miR-965 in the first intron. kismet and miR-965 are transcribed in the same direction. Below: quantitative miRNA PCR showing the level of miR-965 miRNA. miR-965 levels were reduced in flies carrying several kismet alleles associated with different transgene insertions near the first exon, in which both copies of the miRNA gene should be intact. Genotypes are shown at left and the expected number of copies of miR-965 DNA is shown at right. miR-965 levels were somewhat lower than the expected 50% in the KO/+ heterozygote. ‘B’ indicates balancer chromosome. Refers to Figure 1A–D. DOI: http://dx.doi.org/10.7554/eLife.07389.004

Phenotype classification.

Images showing the three classes of defect: gaps, or lack of tissue; fusion, and polarity reversal. Right panels show higher magnification views of the bristle pattern to illustrate the polarity reversal phenotype. Refers to Figure 1E. DOI: http://dx.doi.org/10.7554/eLife.07389.005

Penetrance of defects in miR-965 mutants, shown as % of affected individuals.

Large gaps associated with fusion of adjacent segments occurred in ∼10% of cases. Gap penetrance per segment is shown at right. n = 200 flies. Refers to Figure 1E. DOI: http://dx.doi.org/10.7554/eLife.07389.006 To explore the biological functions of miR-965, independently from those of kismet, we produced targeted deletion mutants to remove the miRNA from the kismet intron (Figure 1A; [Chen et al., 2014]). One mutant allele was made by homologous recombination using the pw25 vector (Gong and Golic, 2003). In this allele, the genomic region containing the miRNA hairpin was replaced by a mini-white reporter gene flanked by LoxP sites (Figure 1A, w+KO1). The presence of the intron-containing mini-white marker in the kismet intron was expected to disrupt kismet gene function. Cre-mediated excision of the LoxP-flanked mini-white cassette produced the KO1 allele, in which the miRNA was replaced by a single LoxP site (Figure 1A, w-KO1). A second independent deletion was produced using the pRMCE vector, which was designed to allow subsequent retargeting of the locus using Recombination Mediated Cassette Exchange (RMCE) (Weng et al., 2009). The miRNA hairpin was replaced by a mini-white marker flanked by inverted attP and LoxP sites. The KO2 allele was made by Cre-mediated excision of the LoxP flanked mini-white reporter (Figure 1A, w-KO2). Deletion of the miRNA was verified by quantitative miRNA PCR in animals heteroallelic for the mini-white deleted versions of KO1/KO2 and for the KO2 allele in trans to Df(2L)ED19, a chromosomal deletion that uncovers the kismet gene (Figure 1B). To produce a genetic rescue allele, we used RMCE to replace the mini-white cassette with a fragment containing the miR-965 hairpin (Figure 1A, 965-Rescue). miR-965 expression was restored to normal levels in the 965-Rescue allele (Figure 1B). In the w- versions of the KO1 and KO2 alleles, DNA in the kismet intron was replaced by a single LoxP site (Figure 1A). To ask whether kismet gene function was compromised in these mini-white excised alleles, we performed molecular and genetic tests. Figure 1C shows RT-PCR to assess splicing of the first kismet intron. A PCR product of normal size was produced in RNA isolated from miR-965/miR-965 and miR-965/Df animals. This qualitative assessment was confirmed by quantitative PCR (Figure 1D). kismet transcript levels were not reduced in the miR-965/miR-965 flies compared to controls, indicating that splicing of intron 1 was not impaired in these mutants. Genetic complementation tests also showed that the miR-965 and miR-965 mutant alleles were viable in trans to kismet, a lethal allele, as well as in trans to Df(2L)ED19, which removes kismet. Together, these data provide evidence that the mini-white excised mutant miR-965 and miR-965 alleles do not compromise kismet gene function. For brevity, these mini-white deleted alleles will be referred to as KO1 and KO2 in the text and figures that follow.

Abdominal segmentation defects

Mutants lacking miR-965 had only minor effects on survival during development. Mutant adults appeared to be morphologically normal with the exception of defects in abdominal segmentation (Figure 1E). Among the affected individuals, the predominant defect was a dorsal gap in one or more abdominal segments, in some cases leading to segment fusion (Figure 1—figure supplement 2). In addition, formation of ectopic bristles associated with a polarity defect was observed in ∼15% of affected individuals (Figure 1—figure supplement 3). Polarity reversal was always accompanied by a gap or segment fusion phenotype. These defects were rescued by restoring miRNA expression using the miR-965 RMCE rescue allele (Figure 1E).
Figure 1—figure supplement 2.

Phenotype classification.

Images showing the three classes of defect: gaps, or lack of tissue; fusion, and polarity reversal. Right panels show higher magnification views of the bristle pattern to illustrate the polarity reversal phenotype. Refers to Figure 1E.

DOI: http://dx.doi.org/10.7554/eLife.07389.005

Figure 1—figure supplement 3.

Penetrance of defects in miR-965 mutants, shown as % of affected individuals.

Large gaps associated with fusion of adjacent segments occurred in ∼10% of cases. Gap penetrance per segment is shown at right. n = 200 flies. Refers to Figure 1E.

DOI: http://dx.doi.org/10.7554/eLife.07389.006

miR-965 activity in histoblasts

The abdominal segmentation defects observed in miR-965 mutants suggested that the miRNA might be required in the histoblasts. To visualize miR-965 activity, we made use of a sensor transgene consisting of a ubiquitously expressed GFP reporter with a perfect target site for miR-965 in the 3′ UTR. Sensors of this design allow miRNA activity to be visualized by downregulation of GFP (Brennecke et al., 2003). The control sensor, lacking the miRNA-target site, was expressed at comparable levels in the large polyploid LEC and in the smaller histoblast cells (hb, Figure 2). miR-965 sensor GFP levels were lower in the histoblast nests, compared to the adjacent larval cells, particularly in the histoblast cells near the edge of the nests (Figure 2). This difference was lost when the sensor was introduced into the miR-965 mutant background, providing evidence that the reduced GFP level in the histoblasts is due to miR-965-mediated repression (Figure 2).
Figure 2.

miR-965 expression in histoblasts.

Top: design of the control and miR-965 sensor transgenes. EGFP was under control of the tubulin promoter. For the miR-965 sensor, 1 copy of a perfect miR-965 target sequence was placed into the SV40 UTR. Images showing GFP expression from the control sensor (left) and miR-965 sensor (middle) transgenes at 21 hr APF. Histoblast nests consist of small diploid histoblast cells (hb) surrounded by large polyploid larval epidermal cells (LEC). Nuclei were labeled with histone-RFP (red). Downregulation of GFP was lost when the transgene was placed in the KO1/KO2 miR-965 mutant background (right). Anterior (A), posterior (P). Scale bar: 100 µm.

DOI: http://dx.doi.org/10.7554/eLife.07389.007

miR-965 expression in histoblasts.

Top: design of the control and miR-965 sensor transgenes. EGFP was under control of the tubulin promoter. For the miR-965 sensor, 1 copy of a perfect miR-965 target sequence was placed into the SV40 UTR. Images showing GFP expression from the control sensor (left) and miR-965 sensor (middle) transgenes at 21 hr APF. Histoblast nests consist of small diploid histoblast cells (hb) surrounded by large polyploid larval epidermal cells (LEC). Nuclei were labeled with histone-RFP (red). Downregulation of GFP was lost when the transgene was placed in the KO1/KO2 miR-965 mutant background (right). Anterior (A), posterior (P). Scale bar: 100 µm. DOI: http://dx.doi.org/10.7554/eLife.07389.007

Defects in histoblast development

The escargot (esg) gene is expressed in histoblasts from the time of their specification in the embryo until the late pupal stage, and provides a marker to visualize histoblast development (Hayashi et al., 1993). Figure 3A presents still images taken from time-lapse videos of esg-GAL4, UAS-GFP pupae to visualize the first 3 mitotic divisions of the histoblasts. In the controls, cells became smaller and the number of cells doubled after each division (Video 1). This pattern of synchronous division was perturbed in the miR-965 mutant. Asynchronous division of miR-965 mutant histoblasts resulted in the presence of cells of different sizes (Figure 3A, Video 2). In the mutant, a subset of histoblast nuclei became pyknotic, fragmented and disappeared, indicating cell death (Video 3). Cell death was rare during this phase in the control samples. Synchronous division was restored and cell death was suppressed in the miR-965-rescue allele (Figure 3A, Video 4).
Figure 3.

Abnormal histoblast proliferation and migration in the miR-965 mutant.

(A) Still images taken from time-lapse videos of control, miR-965 mutant (KO1/KO2) and rescued mutant showing the reduction divisions of the early histoblast proliferation phase. M1, M2 and M3 indicate images taken after mitosis 1, 2 or 3. Imaging was started 0–1 hr APF. Histoblasts were labeled by esg-Gal4 directed expression of UAS-nuclear GFP. ADHN and PDHN represent anterior dorsal histoblast nests and posterior dorsal histoblast nests. Scale bars: 50 µm. Note the different cell sizes in the miR-965 mutant histoblast nests. (B) Still images taken from time-lapse videos at 24, 33 and 42 hr APF from control, miR-965 mutant and rescued mutant to illustrate expansion of the histoblast nests to replace LECs. Histoblasts were labeled by esg-Gal4 directed expression of cytoplasmic GFP. esg-GAL4 and UAS-GFP were recombined onto the miR-965 mutant and onto the miR-965 Rescue chromosome. Nuclei were labeled red with H2-RFP A and P indicate anterior and posterior orientation. Scale bars: 100 µm.

DOI: http://dx.doi.org/10.7554/eLife.07389.008

Each data point corresponds to one histoblast nest. The leading edge of each histoblast nest was tracked using imageJ. Speed was calculated measuring total distance covered (micrometer/hour). Genotypes: Control was esg-GAL4, UAS-GFP. esg-GAL4 and UAS-GFP were recombined onto the KO1 and KO2 chromosomes and onto the miR-965-Rescue chromosome. Data include examples with both recombinant mutant chromosomes. No difference between these two recombinants was apparent. n = 18 for the miR-965 (KO1/KO2) mutant combination. n = 15 for control and rescue. Left panel: p < 0.0001 comparing KO1/KO2 with control, p < 0.01 comparing KO1/KO2 with rescue using one-way ANOVA. Right panel: p < 0.001 comparing KO1/KO2 with control, p < 0.01 comparing KO1/KO2 with rescue using one-way ANOVA. Refers to Figure 3B and Videos 5–7.

DOI: http://dx.doi.org/10.7554/eLife.07389.009

Histoblast nests were labeled with esg-Gal4-directed expression of UAS-GFP at 24 hr APF. Note the presence of large polyploid cells in the histoblast nest in the miR-965 mutant (arrows). At the start of the imaging period, the large polyploid cells marked by the arrows did not express GFP, but began to express GFP after making contact with the expanding histoblast nests. Possible explanations for the appearance of GFP in large polyploidy cells include (1) induction of esg-Gal4 activity in the larval cells that cannot be eliminated by the expanding histoblast nests, perhaps by signals from the histoblasts; (2) fusion of polyploidy LEC with esg-Gal4-expressing histoblasts. Scale bar: 50 µm. Refers to Figure 3B.

DOI: http://dx.doi.org/10.7554/eLife.07389.010

Pupal survival was assayed for flies of the indicated genotypes. 6 batches of pupae were sampled/genotype. The data present the total number of surviving adults (live) and the total number of dead pupae (dead). There was no significant difference between the mutant and control genotypes used to make the videos: p = 0.67 comparing KO2 esgG4>GFP/+ vs KO2 esgG4>GFP/KO1 (Mann–Whitney test). p = 1 comparing KO1 esgG4>GFP/+ vs KO1 esgG4>GFP/KO2 (Mann–Whitney test). Refers to Figure 3B.

DOI: http://dx.doi.org/10.7554/eLife.07389.011

Video 1.

Control, division phase.

Early synchronous divisions of histoblast nests in Esg-GAL4>UAS-nuclear GFP controls. GFP was used to track anterior and posterior dorsal histoblast nests during the early division phase. Animals were collected for imaging at 0 hr APF, the white pre-pupal stage. ADHN: Anterior dorsal histoblast nest. PDHN: posterior dorsal histoblast nest. A and P indicate anterior and posterior orientation. Scale bar: 50 µM. Refers to Figure 3A.

DOI: http://dx.doi.org/10.7554/eLife.07389.012

Video 2.

miR-965 mutant division phase.

Early asynchronous divisions in the miR-965 mutant (KO2, esg-GAL4>UAS-nuclear GFP/KO1). Esg-GAL4>UAS-nuclear GFP was recombined onto miR-965 RMCE mutant (KO2) chromosome. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Animals were collected for imaging at 0 hr APF. Scale bar: 50 µM. Refers to Figure 3A.

DOI: http://dx.doi.org/10.7554/eLife.07389.013

Video 3.

miR-965 mutant apoptosis.

Apoptotic cells are seen during the early histoblast division phase in the miR-965 mutant. Esg-GAL4>UAS-nuclear GFP was recombined onto miR-965 RMCE mutant (KO2) chromosome. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Animals were collected for imaging at 0 hr APF. Scale bar: 50 µM. Refers to Figure 3A.

DOI: http://dx.doi.org/10.7554/eLife.07389.014

Video 4.

miR-965-Rescue division phase.

Early synchronous divisions of histoblasts in miR-965 RMCE rescue. Esg-GAL4>UAS-nuclear GFP was recombined onto miR-965 RMCE rescue chromosome. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Animals were collected for imaging at 0 hr APF. Scale bar: 50 µM. Refers to Figure 3A.

DOI: http://dx.doi.org/10.7554/eLife.07389.015

Abnormal histoblast proliferation and migration in the miR-965 mutant.

(A) Still images taken from time-lapse videos of control, miR-965 mutant (KO1/KO2) and rescued mutant showing the reduction divisions of the early histoblast proliferation phase. M1, M2 and M3 indicate images taken after mitosis 1, 2 or 3. Imaging was started 0–1 hr APF. Histoblasts were labeled by esg-Gal4 directed expression of UAS-nuclear GFP. ADHN and PDHN represent anterior dorsal histoblast nests and posterior dorsal histoblast nests. Scale bars: 50 µm. Note the different cell sizes in the miR-965 mutant histoblast nests. (B) Still images taken from time-lapse videos at 24, 33 and 42 hr APF from control, miR-965 mutant and rescued mutant to illustrate expansion of the histoblast nests to replace LECs. Histoblasts were labeled by esg-Gal4 directed expression of cytoplasmic GFP. esg-GAL4 and UAS-GFP were recombined onto the miR-965 mutant and onto the miR-965 Rescue chromosome. Nuclei were labeled red with H2-RFP A and P indicate anterior and posterior orientation. Scale bars: 100 µm. DOI: http://dx.doi.org/10.7554/eLife.07389.008

Rate of histoblast nest expansion measured from time-lapse videos.

Each data point corresponds to one histoblast nest. The leading edge of each histoblast nest was tracked using imageJ. Speed was calculated measuring total distance covered (micrometer/hour). Genotypes: Control was esg-GAL4, UAS-GFP. esg-GAL4 and UAS-GFP were recombined onto the KO1 and KO2 chromosomes and onto the miR-965-Rescue chromosome. Data include examples with both recombinant mutant chromosomes. No difference between these two recombinants was apparent. n = 18 for the miR-965 (KO1/KO2) mutant combination. n = 15 for control and rescue. Left panel: p < 0.0001 comparing KO1/KO2 with control, p < 0.01 comparing KO1/KO2 with rescue using one-way ANOVA. Right panel: p < 0.001 comparing KO1/KO2 with control, p < 0.01 comparing KO1/KO2 with rescue using one-way ANOVA. Refers to Figure 3B and Videos 5–7. DOI: http://dx.doi.org/10.7554/eLife.07389.009

Large polyploid cells in miR-965 mutant histoblast nests.

Histoblast nests were labeled with esg-Gal4-directed expression of UAS-GFP at 24 hr APF. Note the presence of large polyploid cells in the histoblast nest in the miR-965 mutant (arrows). At the start of the imaging period, the large polyploid cells marked by the arrows did not express GFP, but began to express GFP after making contact with the expanding histoblast nests. Possible explanations for the appearance of GFP in large polyploidy cells include (1) induction of esg-Gal4 activity in the larval cells that cannot be eliminated by the expanding histoblast nests, perhaps by signals from the histoblasts; (2) fusion of polyploidy LEC with esg-Gal4-expressing histoblasts. Scale bar: 50 µm. Refers to Figure 3B. DOI: http://dx.doi.org/10.7554/eLife.07389.010

Pupal survival assays.

Pupal survival was assayed for flies of the indicated genotypes. 6 batches of pupae were sampled/genotype. The data present the total number of surviving adults (live) and the total number of dead pupae (dead). There was no significant difference between the mutant and control genotypes used to make the videos: p = 0.67 comparing KO2 esgG4>GFP/+ vs KO2 esgG4>GFP/KO1 (Mann–Whitney test). p = 1 comparing KO1 esgG4>GFP/+ vs KO1 esgG4>GFP/KO2 (Mann–Whitney test). Refers to Figure 3B. DOI: http://dx.doi.org/10.7554/eLife.07389.011

Control, division phase.

Early synchronous divisions of histoblast nests in Esg-GAL4>UAS-nuclear GFP controls. GFP was used to track anterior and posterior dorsal histoblast nests during the early division phase. Animals were collected for imaging at 0 hr APF, the white pre-pupal stage. ADHN: Anterior dorsal histoblast nest. PDHN: posterior dorsal histoblast nest. A and P indicate anterior and posterior orientation. Scale bar: 50 µM. Refers to Figure 3A. DOI: http://dx.doi.org/10.7554/eLife.07389.012

miR-965 mutant division phase.

Early asynchronous divisions in the miR-965 mutant (KO2, esg-GAL4>UAS-nuclear GFP/KO1). Esg-GAL4>UAS-nuclear GFP was recombined onto miR-965 RMCE mutant (KO2) chromosome. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Animals were collected for imaging at 0 hr APF. Scale bar: 50 µM. Refers to Figure 3A. DOI: http://dx.doi.org/10.7554/eLife.07389.013

miR-965 mutant apoptosis.

Apoptotic cells are seen during the early histoblast division phase in the miR-965 mutant. Esg-GAL4>UAS-nuclear GFP was recombined onto miR-965 RMCE mutant (KO2) chromosome. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Animals were collected for imaging at 0 hr APF. Scale bar: 50 µM. Refers to Figure 3A. DOI: http://dx.doi.org/10.7554/eLife.07389.014

miR-965-Rescue division phase.

Early synchronous divisions of histoblasts in miR-965 RMCE rescue. Esg-GAL4>UAS-nuclear GFP was recombined onto miR-965 RMCE rescue chromosome. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Animals were collected for imaging at 0 hr APF. Scale bar: 50 µM. Refers to Figure 3A. DOI: http://dx.doi.org/10.7554/eLife.07389.015 Subsequently, the rate of histoblast nest expansion was slower in the miR-965 mutant, compared to the controls (Figure 3B). Expansion of the histoblast nests was quantified in segments 3 and 4 by monitoring the speed of migration (Figure 3—figure supplement 1, Videos 5, 6). The average speed of migration of third and fourth histoblast nests in the control samples was 15 µm/hr, compare with ∼6.5 µm/hr in the mutant. The rate of nest expansion was increased to 12–14 µm/hr by restoring miR-965 expression with the rescue allele the miR-965 mutant background (Video 7).
Figure 3—figure supplement 1.

Rate of histoblast nest expansion measured from time-lapse videos.

Each data point corresponds to one histoblast nest. The leading edge of each histoblast nest was tracked using imageJ. Speed was calculated measuring total distance covered (micrometer/hour). Genotypes: Control was esg-GAL4, UAS-GFP. esg-GAL4 and UAS-GFP were recombined onto the KO1 and KO2 chromosomes and onto the miR-965-Rescue chromosome. Data include examples with both recombinant mutant chromosomes. No difference between these two recombinants was apparent. n = 18 for the miR-965 (KO1/KO2) mutant combination. n = 15 for control and rescue. Left panel: p < 0.0001 comparing KO1/KO2 with control, p < 0.01 comparing KO1/KO2 with rescue using one-way ANOVA. Right panel: p < 0.001 comparing KO1/KO2 with control, p < 0.01 comparing KO1/KO2 with rescue using one-way ANOVA. Refers to Figure 3B and Videos 5–7.

DOI: http://dx.doi.org/10.7554/eLife.07389.009

Video 7.

miR-965 Rescue growth phase.

Migration of histoblast nests during the growth phase in the miR-965 RMCE rescue genotype. Esg-GAL4>UAS-cytoplasmic GFP was recombined onto the miR-965 RMCE rescue chromosome. H2-RFP (red) marks the nuclei. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Scale bar: 100 µM. Refers to Figure 3—figure supplement 1.

DOI: http://dx.doi.org/10.7554/eLife.07389.018

Control, growth phase.

Migration of histoblast nests during the growth phase in an Esg-GAL4>UAS-cytoplasmic GFP control pupa. GFP (green) is used to monitor growth and migration of histoblast nests. H2-RFP (red) marks the nuclei. Big nuclei are LECs and small nuclei are histoblast cells. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Scale bar: 100 µM. Refers to Figure 3—figure supplement 1. DOI: http://dx.doi.org/10.7554/eLife.07389.016

miR-965 mutant growth phase.

Delayed migration of histoblast nests during the growth phase in the miR-965 mutant. Esg-GAL4>UAS-cytoplasmic GFP was recombined onto both KO1 and KO2 mutant chromosomes. This video shows a KO2, esg-GAL4>UAS-cytoplasmic GFP/KO1 pupa. H2-RFP (red) marks the nuclei. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Scale bar: 100 µM. Refers to Figure 3—figure supplement 1. DOI: http://dx.doi.org/10.7554/eLife.07389.017

miR-965 Rescue growth phase.

Migration of histoblast nests during the growth phase in the miR-965 RMCE rescue genotype. Esg-GAL4>UAS-cytoplasmic GFP was recombined onto the miR-965 RMCE rescue chromosome. H2-RFP (red) marks the nuclei. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Scale bar: 100 µM. Refers to Figure 3—figure supplement 1. DOI: http://dx.doi.org/10.7554/eLife.07389.018 LEC generally undergo programmed cell death as the histoblasts nests start to grow (Nakajima et al., 2011). In miR-965 mutants, we observed that some of these cells were still present in the nests, suggesting a failure to eliminate LECs in the mutant (Figure 3—figure supplement 2). Delayed expansion of the histoblast nests, combined with the persistence of LECs, is likely to be responsible for the gaps observed in adult abdominal segments.
Figure 3—figure supplement 2.

Large polyploid cells in miR-965 mutant histoblast nests.

Histoblast nests were labeled with esg-Gal4-directed expression of UAS-GFP at 24 hr APF. Note the presence of large polyploid cells in the histoblast nest in the miR-965 mutant (arrows). At the start of the imaging period, the large polyploid cells marked by the arrows did not express GFP, but began to express GFP after making contact with the expanding histoblast nests. Possible explanations for the appearance of GFP in large polyploidy cells include (1) induction of esg-Gal4 activity in the larval cells that cannot be eliminated by the expanding histoblast nests, perhaps by signals from the histoblasts; (2) fusion of polyploidy LEC with esg-Gal4-expressing histoblasts. Scale bar: 50 µm. Refers to Figure 3B.

DOI: http://dx.doi.org/10.7554/eLife.07389.010

It was noted that the migration defects observed in the videos seem to be more severe than the segmentation defects observed in the adult flies. However, we did not observe significant pre-eclosion lethality (Figure 3—figure supplement 3). Given that there was no evidence for loss of a class of more severely affected animals, we suggest that the apparent difference reflects a delay in tissue replacement in the mutant, so that most animals end up with milder defects by the end of pupariation than were apparent during the early pupal time-window in the videos.
Figure 3—figure supplement 3.

Pupal survival assays.

Pupal survival was assayed for flies of the indicated genotypes. 6 batches of pupae were sampled/genotype. The data present the total number of surviving adults (live) and the total number of dead pupae (dead). There was no significant difference between the mutant and control genotypes used to make the videos: p = 0.67 comparing KO2 esgG4>GFP/+ vs KO2 esgG4>GFP/KO1 (Mann–Whitney test). p = 1 comparing KO1 esgG4>GFP/+ vs KO1 esgG4>GFP/KO2 (Mann–Whitney test). Refers to Figure 3B.

DOI: http://dx.doi.org/10.7554/eLife.07389.011

miR-965 regulates string and wingless

miR-965 is predicted to target 69 genes (www.targetscan.org). polycomb, string, wingless, homothorax, Tor, Hsp83 and jumeau were selected for further analysis based on the quality of the predicted target site and on Flybase annotation suggesting roles in segmentation. Of these, only string and wingless (wg) mRNAs were upregulated in RNA isolated from miR-965 mutant pupae, and were also restored to near normal levels in the rescued mutant (Figure 4A,B), as would be expected for functional miRNA targets.
Figure 4.

miR-965 regulates string and wingless.

(A, B) string (stg) and wingless (wg) transcript levels measured by quantitative real time RT-PCR in RNA isolated from w control, KO1/KO2 and 965-rescue pupae at 21 hr APF. Data represent the average of three independent RNA collections ± SD. ANOVA: p < 0.01 comparing KO1/KO2 with control or with rescue for stg and wg. (C) Top: diagram of the predicted miR-965 target site in the wg 3′ UTR, showing pairing to the miRNA seed sequence. Residues shown in red were mutated in the mutant version of the wg 3′ UTR luciferase reporter. Below: luciferase activity in S2 cells transfected to express a tubulin-promoter miR-965 transgene, Renilla luciferase and the indicated firefly luciferase reporters. Control indicates the luciferase reporter with the SV40 3′ UTR, which lacks miRNA binding sites. wg UTR indicates the intact full-length wg 3′ UTR. Mut indicates the wg 3′ UTR with the miRNA seed site mutated as indicated in red. Data represent the average of 3 independent experiments ± SD. ANOVA: p < 0.001 comparing control to the intact 3′ UTR. p = 0.001 comparing the intact and site mutant versions of the 3′ UTR. (D) Top: diagram of the predicted miR-965 target site in the stg 3′ UTR, showing pairing to the miRNA seed. Residues shown in red were mutated in the seed mutant version of the reporter. The changes made in the extended target site mutant reporter are shown in Figure 3. Below: luciferase activity as in panel C. Data represent the average of 3 independent experiments ± SD. ANOVA: p < 0.0001 comparing control to the intact 3′ UTR and comparing intact to seed mutant and multiple mutant UTR reporters.

DOI: http://dx.doi.org/10.7554/eLife.07389.019

Based on the potential for strong 3′ pairing in the Seed 1 mutant (shown in Figure 4D), as well as the presence of a second nearby non-canonical seed match (seed 2), a more extensively mutated UTR was made to eliminate pairing to both potential sites. Nucleotides mutated are shown in red. Refers to Figure 4D. (B) Structure of the miR-965 site in the string 3′ UTR, as predicted by RNAHybrid (http://bibiserv.techfak.uni---bielefeld.de/).

DOI: http://dx.doi.org/10.7554/eLife.07389.020

miR-965 regulates string and wingless.

(A, B) string (stg) and wingless (wg) transcript levels measured by quantitative real time RT-PCR in RNA isolated from w control, KO1/KO2 and 965-rescue pupae at 21 hr APF. Data represent the average of three independent RNA collections ± SD. ANOVA: p < 0.01 comparing KO1/KO2 with control or with rescue for stg and wg. (C) Top: diagram of the predicted miR-965 target site in the wg 3′ UTR, showing pairing to the miRNA seed sequence. Residues shown in red were mutated in the mutant version of the wg 3′ UTR luciferase reporter. Below: luciferase activity in S2 cells transfected to express a tubulin-promoter miR-965 transgene, Renilla luciferase and the indicated firefly luciferase reporters. Control indicates the luciferase reporter with the SV40 3′ UTR, which lacks miRNA binding sites. wg UTR indicates the intact full-length wg 3′ UTR. Mut indicates the wg 3′ UTR with the miRNA seed site mutated as indicated in red. Data represent the average of 3 independent experiments ± SD. ANOVA: p < 0.001 comparing control to the intact 3′ UTR. p = 0.001 comparing the intact and site mutant versions of the 3′ UTR. (D) Top: diagram of the predicted miR-965 target site in the stg 3′ UTR, showing pairing to the miRNA seed. Residues shown in red were mutated in the seed mutant version of the reporter. The changes made in the extended target site mutant reporter are shown in Figure 3. Below: luciferase activity as in panel C. Data represent the average of 3 independent experiments ± SD. ANOVA: p < 0.0001 comparing control to the intact 3′ UTR and comparing intact to seed mutant and multiple mutant UTR reporters. DOI: http://dx.doi.org/10.7554/eLife.07389.019

(A) Predicted miR-965 sites in the string 3′UTR.

Based on the potential for strong 3′ pairing in the Seed 1 mutant (shown in Figure 4D), as well as the presence of a second nearby non-canonical seed match (seed 2), a more extensively mutated UTR was made to eliminate pairing to both potential sites. Nucleotides mutated are shown in red. Refers to Figure 4D. (B) Structure of the miR-965 site in the string 3′ UTR, as predicted by RNAHybrid (http://bibiserv.techfak.uni---bielefeld.de/). DOI: http://dx.doi.org/10.7554/eLife.07389.020 The wg 3′UTR was used to make a luciferase reporter transgene and tested for regulation by miR-965 in S2 cells. miR-965 expression reduced wg 3′UTR reporter activity, and this regulation was lost in the wg UTR reporter mutated to disrupt pairing with the miRNA seed sequence (Figure 4C, mutated residues shown in red). miR-965 expression also reduced expression of the string 3′UTR luciferase reporter (Figure 4D). Mutation of the predicted target site to disrupt seed pairing partially offset regulation of the string 3′UTR luciferase reporter (Figure 4D, mutated residues in red). We noted the presence of a second potential target site nearby (Figure 4—figure supplement 1). More extensive mutation to disrupt both sites further compromised regulation by miR-965 (Figure 4D). Other non-canonical target sites might be responsible for the remaining regulation by miR-965, however, we do not exclude the possibility that there could also be indirect effects of miR-965 on expression of this reporter. These findings provide evidence that miR-965 can regulate expression of string and wg.
Figure 4—figure supplement 1.

(A) Predicted miR-965 sites in the string 3′UTR.

Based on the potential for strong 3′ pairing in the Seed 1 mutant (shown in Figure 4D), as well as the presence of a second nearby non-canonical seed match (seed 2), a more extensively mutated UTR was made to eliminate pairing to both potential sites. Nucleotides mutated are shown in red. Refers to Figure 4D. (B) Structure of the miR-965 site in the string 3′ UTR, as predicted by RNAHybrid (http://bibiserv.techfak.uni---bielefeld.de/).

DOI: http://dx.doi.org/10.7554/eLife.07389.020

Contributions of string and wingless to the miR-965 mutant phenotype

To ask whether the increases in string and wg expression might be responsible for the miR-965 mutant phenotype, we first asked if overexpressing them in an otherwise normal genetic background could phenocopy the mutant. esg-Gal4 driven expression of a UAS-string transgene produced abdominal segment gaps, segment fusion and polarity reversal phenotypes, similar to those observed in the miR-965 mutant (Figure 5A Figure 5—figure supplement 1). The proportion of flies with defects caused by string overexpression was similar to that in the miR-965 mutant (Figure 5B). string overexpression caused asynchronous histoblast division and apoptosis during the early division phase (Figure 5—figure supplement 2, Video 8). Expansion of the string-overexpressing histoblast nests was slowed, and the histoblasts were unable to fully replace the LECs (Figure 5—figure supplements 2, 3, Video 9), similar to what was observed in miR-965 mutants. Thus, string overexpression was sufficient to reproduce the miR-965 mutant phenotype.
Figure 5.

Overexpression of string and wg contributes to the miR-965 mutant phenotype.

(A) Dorsal views of abdomens from adult female esg-Gal4 UAS-string flies illustrating the segment gap, segment fusion and polarity reversal phenotypes. (B) Penetrance of abdominal defects of all classes in esg-Gal4 UAS-string vs mutant. esg-Gal4 UAS-string: n = 97/469; KO1/KO2 n = 110/446. p = 0.16 Fishers exact test. (C) Penetrance of abdominal defects in esg-Gal4 UAS-wgts flies reared at 18° and 25°C vs KO1/KO2. esg-Gal4 UAS-wgts reared at 18°C: n = 9/129; esg-Gal4 UAS-wgts at 25°C n = 1/254; KO1/KO2 n = 110/446. p = 0.014 comparing wgts at 18 vs 25°C, Fishers exact test. (D) Penetrance of abdominal defects comparing KO1/KO2 mutants with KO1/KO2 mutants carrying one copy of string or string alleles. p < 0.001 comparing KO1/KO2 to KO1/KO2; stgEY/+ or stg4/+ using Fisher's exact test. (E) Confocal micrographs showing dorsal histoblast nests of wild-type (WT) and miR-965 mutant (KO) at ∼24 hr APF labeled with anti-Wg (red). Nuclei were labeled with DAPI (blue). Scale bar: 20 µm. Anterior and dorsal histoblast nests in the miR-965 mutants were not yet fused at 24 hr APF, due to delayed migration. Images were captured using identical microscope settings. (F) Penetrance of abdominal segmentation defects comparing KO1/KO2 mutants with KO1/KO2 mutants carrying one copy of wg or wg temperature sensitive alleles or carrying one copy of wg and stg together. p < 0.05 comparing KO1/KO2 to KO1, wgSP-1/KO2 using Fisher's exact test. KO1/KO2 was not significantly different from KO1, wgI-12/KO2, perhaps because wg is a weaker, temperature sensitive allele. p < 0.001 comparing KO1/KO2 with KO1, wgSP-1/KO2; stg4/+ using Fisher's exact test.

DOI: http://dx.doi.org/10.7554/eLife.07389.021

Penetrance of the three types of abdominal defect in flies overexpressing UAS-String under esg-Gal4 control. n = 102 flies. Refers to Figure 5A.

DOI: http://dx.doi.org/10.7554/eLife.07389.022

Left: rapid proliferation phase. Note the presence of cells of different sizes, indicative of asynchronous division. Images represent 0 hr and mitosis M1, M2 and M3. Genotype: esg-Gal4, UAS-string, UAS-GFP. Right: growth and migration phase. Note the delayed spreading and incomplete replacement of the LEC, compared to controls at the equivalent time points (Figure 3C). Genotype: esg-Gal4, UAS-string, UAS-GFP. Refers to Figure 5B and Videos 8, 9.

DOI: http://dx.doi.org/10.7554/eLife.07389.023

n = 15 for control, n = 18 for KO1/KO2 and n = 11 for esg-GAL4>UAS-stg. p < 0.001 comparing control and esg-GAL4>UAS-stg using one-way ANOVA. esg-GAL4>UAS-stg is not significantly different from the miR-965 mutant (KO1/KO2). Control and miR-965 mutant samples are same as in Figure 3—figure supplement 1. Refers to Figure 5B and Video 9.

DOI: http://dx.doi.org/10.7554/eLife.07389.024

Left: still images taken from a time-lapse video showing histoblast divisions in the miR-965 mutant (KO1/KO2) with reduced levels of string transcript using the stg allele. M1 and M2 indicate mitosis 1 and 2. Cell membranes were labeled using Atpα-GFP (green). Nuclei were labeled using Histone2-RFP (red). ADHN: anterior dorsal histoblast nest. PDHN: posterior dorsal histoblast nest. Scale bars: 50 µM. Right: still images taken from a time-lapse video showing histoblast nest migration in animals of the same genotypes. Scale bars: 100 µM. Refers to Figure 5D and Video 11.

DOI: http://dx.doi.org/10.7554/eLife.07389.025

Left: speed of histoblast nest migration in the third abdominal segment. p < 0.05 comparing KO1/KO2 with KO1/KO2; stgEY12388. Control (n = 15), KO1/KO2 (n = 18) and KO1/KO2; stgEY12388 (n = 14). The Control and KO1/KO2 samples are the same as those in Figure 3—figure supplement 1. The two experiments were done together. Right: speed of histoblast migration in the fourth abdominal segment. p < 0.05 comparing KO1/KO2 with KO1/KO2; stgEY12388. Refers to Figure 5D and Video 11.

DOI: http://dx.doi.org/10.7554/eLife.07389.026

Figure 5—figure supplement 1.

The proportion of flies with defects caused by string overexpression.

Penetrance of the three types of abdominal defect in flies overexpressing UAS-String under esg-Gal4 control. n = 102 flies. Refers to Figure 5A.

DOI: http://dx.doi.org/10.7554/eLife.07389.022

Figure 5—figure supplement 2.

Still images from a time-lapse video of esg-Gal4>UAS-string histoblasts.

Left: rapid proliferation phase. Note the presence of cells of different sizes, indicative of asynchronous division. Images represent 0 hr and mitosis M1, M2 and M3. Genotype: esg-Gal4, UAS-string, UAS-GFP. Right: growth and migration phase. Note the delayed spreading and incomplete replacement of the LEC, compared to controls at the equivalent time points (Figure 3C). Genotype: esg-Gal4, UAS-string, UAS-GFP. Refers to Figure 5B and Videos 8, 9.

DOI: http://dx.doi.org/10.7554/eLife.07389.023

Video 8.

Esg-Gal4 UAS-Stg division phase.

Early divisions in a pupa overexpressing String under esg-GAL4 control (genotype: esg-GAL4, UAS-nuclear GFP/UAS-stg). ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Animals were collected for imaging at 0 hr APF. Scale bar: 50 µM. Refers to Figure 5—figure supplement 2.

DOI: http://dx.doi.org/10.7554/eLife.07389.027

Video 9.

Esg-Gal4 UAS-Stg growth phase.

Growth and migration phase in a pupa overexpressing String under esg-GAL4 control, as in Video 8. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Scale bar: 100 µM. Refers to Figure 5—figure supplements 2, 3.

DOI: http://dx.doi.org/10.7554/eLife.07389.028

Overexpression of string and wg contributes to the miR-965 mutant phenotype.

(A) Dorsal views of abdomens from adult female esg-Gal4 UAS-string flies illustrating the segment gap, segment fusion and polarity reversal phenotypes. (B) Penetrance of abdominal defects of all classes in esg-Gal4 UAS-string vs mutant. esg-Gal4 UAS-string: n = 97/469; KO1/KO2 n = 110/446. p = 0.16 Fishers exact test. (C) Penetrance of abdominal defects in esg-Gal4 UAS-wgts flies reared at 18° and 25°C vs KO1/KO2. esg-Gal4 UAS-wgts reared at 18°C: n = 9/129; esg-Gal4 UAS-wgts at 25°C n = 1/254; KO1/KO2 n = 110/446. p = 0.014 comparing wgts at 18 vs 25°C, Fishers exact test. (D) Penetrance of abdominal defects comparing KO1/KO2 mutants with KO1/KO2 mutants carrying one copy of string or string alleles. p < 0.001 comparing KO1/KO2 to KO1/KO2; stgEY/+ or stg4/+ using Fisher's exact test. (E) Confocal micrographs showing dorsal histoblast nests of wild-type (WT) and miR-965 mutant (KO) at ∼24 hr APF labeled with anti-Wg (red). Nuclei were labeled with DAPI (blue). Scale bar: 20 µm. Anterior and dorsal histoblast nests in the miR-965 mutants were not yet fused at 24 hr APF, due to delayed migration. Images were captured using identical microscope settings. (F) Penetrance of abdominal segmentation defects comparing KO1/KO2 mutants with KO1/KO2 mutants carrying one copy of wg or wg temperature sensitive alleles or carrying one copy of wg and stg together. p < 0.05 comparing KO1/KO2 to KO1, wgSP-1/KO2 using Fisher's exact test. KO1/KO2 was not significantly different from KO1, wgI-12/KO2, perhaps because wg is a weaker, temperature sensitive allele. p < 0.001 comparing KO1/KO2 with KO1, wgSP-1/KO2; stg4/+ using Fisher's exact test. DOI: http://dx.doi.org/10.7554/eLife.07389.021

The proportion of flies with defects caused by string overexpression.

Penetrance of the three types of abdominal defect in flies overexpressing UAS-String under esg-Gal4 control. n = 102 flies. Refers to Figure 5A. DOI: http://dx.doi.org/10.7554/eLife.07389.022

Still images from a time-lapse video of esg-Gal4>UAS-string histoblasts.

Left: rapid proliferation phase. Note the presence of cells of different sizes, indicative of asynchronous division. Images represent 0 hr and mitosis M1, M2 and M3. Genotype: esg-Gal4, UAS-string, UAS-GFP. Right: growth and migration phase. Note the delayed spreading and incomplete replacement of the LEC, compared to controls at the equivalent time points (Figure 3C). Genotype: esg-Gal4, UAS-string, UAS-GFP. Refers to Figure 5B and Videos 8, 9. DOI: http://dx.doi.org/10.7554/eLife.07389.023

Speed of histoblast nest migration.

n = 15 for control, n = 18 for KO1/KO2 and n = 11 for esg-GAL4>UAS-stg. p < 0.001 comparing control and esg-GAL4>UAS-stg using one-way ANOVA. esg-GAL4>UAS-stg is not significantly different from the miR-965 mutant (KO1/KO2). Control and miR-965 mutant samples are same as in Figure 3—figure supplement 1. Refers to Figure 5B and Video 9. DOI: http://dx.doi.org/10.7554/eLife.07389.024

Rescue of the migration defect of miR-965 mutants with reduced levels of string.

Left: still images taken from a time-lapse video showing histoblast divisions in the miR-965 mutant (KO1/KO2) with reduced levels of string transcript using the stg allele. M1 and M2 indicate mitosis 1 and 2. Cell membranes were labeled using Atpα-GFP (green). Nuclei were labeled using Histone2-RFP (red). ADHN: anterior dorsal histoblast nest. PDHN: posterior dorsal histoblast nest. Scale bars: 50 µM. Right: still images taken from a time-lapse video showing histoblast nest migration in animals of the same genotypes. Scale bars: 100 µM. Refers to Figure 5D and Video 11.
Video 11.

miR-965 mutant with reduced string levels with reduced string levels growth phase.

Normal growth and migration of histoblast nests in the miR-965 mutant with reduced string levels. The string mutant allele, stg was used to reduce string levels in the miR-965 mutant (KO1/KO2) background. Atpα-GFP (green) was used to mark cell membranes. H2-RFP (red) marks the nuclei. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Scale bar: 50 µM. Refers to Figure 5—figure supplements 4, 5.

DOI: http://dx.doi.org/10.7554/eLife.07389.030

DOI: http://dx.doi.org/10.7554/eLife.07389.025

Speed of histoblast migration restored by reduced string activity.

Left: speed of histoblast nest migration in the third abdominal segment. p < 0.05 comparing KO1/KO2 with KO1/KO2; stgEY12388. Control (n = 15), KO1/KO2 (n = 18) and KO1/KO2; stgEY12388 (n = 14). The Control and KO1/KO2 samples are the same as those in Figure 3—figure supplement 1. The two experiments were done together. Right: speed of histoblast migration in the fourth abdominal segment. p < 0.05 comparing KO1/KO2 with KO1/KO2; stgEY12388. Refers to Figure 5D and Video 11. DOI: http://dx.doi.org/10.7554/eLife.07389.026

Esg-Gal4 UAS-Stg division phase.

Early divisions in a pupa overexpressing String under esg-GAL4 control (genotype: esg-GAL4, UAS-nuclear GFP/UAS-stg). ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Animals were collected for imaging at 0 hr APF. Scale bar: 50 µM. Refers to Figure 5—figure supplement 2. DOI: http://dx.doi.org/10.7554/eLife.07389.027

Esg-Gal4 UAS-Stg growth phase.

Growth and migration phase in a pupa overexpressing String under esg-GAL4 control, as in Video 8. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Scale bar: 100 µM. Refers to Figure 5—figure supplements 2, 3. DOI: http://dx.doi.org/10.7554/eLife.07389.028 To assess the contribution of wg overexpression, we made use of a UAS transgene directing expression of a temperature sensitive form of Wg protein (Wilder and Perrimon, 1995). Use of Wgts was required to allow stage specific activation of Wg in the histoblasts. Continuous expression of wild-type Wg under esg-Gal4 control was lethal. Wgts protein is inactive at 25°C. Flies carrying esg-Gal4 and UAS-wgts were reared at 25°C or shifted to 18°C in the third larval instar to allow expression of active Wg as the histoblasts began proliferation. This resulted in a phenocopy of the segment gap phenotype in 7% of animals (Figure 5C). Phenocopy was rare in the animals raised continuously at 25°C to maintain low Wg activity (0.4% affected, Figure 5C; p = 0.014 comparing UAS-wgts at 18° vs 25°, Fisher's exact test). Next we asked whether limiting target gene overexpression could suppress the mutant phenotype. Lowering string activity by introducing string mutant alleles reduced the penetrance of the segment gap phenotype in the miR-965 (KO1/KO2) mutant background from 25% to 6–7% (Figure 5D, Video 10, p < 0.001 comparing KO1/KO2 vs KO1/KO2; stg or stg4/+, Fisher's exact test). Lowering string activity also suppressed the asynchronous division phenotype and the slow cell migration phenotype of the miR-965 mutant (Figure 5—figure supplements 4, 5, Video 11).
Video 10.

miR-965 mutant with reduced string levels division phase.

The string mutant allele, stg was used to reduce string levels in the miR-965 mutant (KO1/KO2) background. Atpα-GFP (green) was used to mark cell membranes. H2-RFP (red) marks the nuclei. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Scale bar: 50 µM. Refers to Figure 5D.

DOI: http://dx.doi.org/10.7554/eLife.07389.029

miR-965 mutant with reduced string levels division phase.

The string mutant allele, stg was used to reduce string levels in the miR-965 mutant (KO1/KO2) background. Atpα-GFP (green) was used to mark cell membranes. H2-RFP (red) marks the nuclei. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Scale bar: 50 µM. Refers to Figure 5D. DOI: http://dx.doi.org/10.7554/eLife.07389.029

miR-965 mutant with reduced string levels with reduced string levels growth phase.

Normal growth and migration of histoblast nests in the miR-965 mutant with reduced string levels. The string mutant allele, stg was used to reduce string levels in the miR-965 mutant (KO1/KO2) background. Atpα-GFP (green) was used to mark cell membranes. H2-RFP (red) marks the nuclei. ADHN and PDHN indicate anterior and posterior dorsal histoblast nests. Scale bar: 50 µM. Refers to Figure 5—figure supplements 4, 5. DOI: http://dx.doi.org/10.7554/eLife.07389.030 Wingless protein (Wg) is expressed in the anterior dorsal histoblast nests, during their growth and migration (Kopp et al., 1999). The level of Wg protein was higher in the miR-965 mutant (Figure 5E). Wg is a secreted protein, and its distribution appears to be broader, reaching some of the LECs in the mutant, perhaps reflecting the higher level of protein produced (Figure 5E). To ask whether this elevated Wg expression contributes to the defects in the mutant, we introduced wg mutant alleles into the miR-965 (KO1/KO2) mutant background. The segment gap phenotype was reduced comparing KO1/KO2 vs KO1 wg/KO2 (Figure 5F, p < 0.05, Fisher's exact test; suppression by the wg allele was not statistically significant). Next, we tested the effect of removing one copy each of stg and wg. The segment gap phenotype was reduced comparing KO1/KO2 vs KO1 wg/KO2; stg/+ (Figure 5F, p < 0.001, Fisher's exact test). Taking out one copy each of stg and wg lowered penetrance of the phenotype to ∼4%, compared with 6–7% for stg/+ alone or 12% for wg/+ alone. These experiments provide evidence that overexpression of string and wg each contribute to the miR-965 mutant histoblast phenotypes. The effect of limiting Wg expression in the mutant background may appear to be smaller than that of limiting String. However, to make a meaningful comparison of the relative contribution of these two targets, it would be necessary to restore each of them to normal levels. The genetic method used to reduce target activity in the mutant background does not allow precise control over the final target level, so this question cannot be addressed. We also do not exclude the possibility that there could be other functionally significant targets in addition to Wg and String.

Ecdysone mediated regulation of miR-965

Ecdysone pulses at the beginning of pupariation have been shown to induce string expression in order to reactive histoblast proliferation (Ninov et al., 2009). In light of the relationship between miR-965 and string, we asked whether miR-965 expression might be under Ecdysone control at this stage. We made use of a UAS-EcRRNAi transgene expressed under esg-Gal4 to reduce Ecdysone receptor levels in the histoblasts. RNAi-mediated depletion of EcR mRNA led to an increase in the level of the miR-965 primary transcript and mature miRNA (Figure 6A, Figure 6—figure supplement 1), and to reduced string mRNA levels in RNA samples isolated from early pupae (Figure 6A). EcR binding sites have been identified near the host gene, kismet (Gauhar et al., 2009), consistent with the possibility that ecdysone regulates expression of both kismet and miR-965. When miR-965 was overexpressed in the histoblast cells using esg-GAL4, string transcript levels were reduced (Figure 6B) and histoblast cell divisions were arrested (Figure 6C, Video 12). This phenotype resembles EcR-B mutants, in which histoblast division is compromised (Bender et al., 1997). Pupae overexpressing miR-965 in histoblast cells did not survive beyond ∼12 APF, so it was not possible to monitor the later stages of histoblast migration in this genotype.
Figure 6.

Regulation of miR-965 by ecdysone at the beginning of pupariation.

(A) Quantitative RT-PCR showing levels of miR-965 primary transcript, EcR, and string mRNAs in RNA isolated from pupae expressing esg-GAL4 (control) and esg-GAL4 driving UAS-EcR-RNAi to deplete EcR mRNA. Samples were collected at 0 hr APF. Data were normalized to rp49 and to the esg-GAL4 control. Data represents average of three independent samples ± SD. (B) Quantitative RT-PCR showing string mRNA in 0 hr pupae overexpressing miR-965 in histoblast cells. For quantitative microRNA PCR, data were normalized to U14, U27, SnoR422. Data were normalized to rp49 for string mRNA qPCR. Data represent the average of four independent samples ± SD. (C) Images from time-lapse videos showing the effects of miR-965 overexpression in histoblast cells during the synchronous division phase. M1, M2 and M3 indicate three consecutive mitotic divisions in dorsal histoblast nests. Scale bar: 50 µm. (D) Quantitative RT-PCR showing levels of string, EcR primary transcript (EcR-PT) and mature mRNA in RNA isolated from pupae expressing esg-GAL4 (control), esg-GAL4 in the miR-965 mutant with and without UAS-EcR-RNAi to deplete EcR mRNA. esg-GAL4 was recombined onto the KO2 mutant chromosome. Samples were collected at 0 hr APF. Data were normalized to rp49 and to the esg-GAL4 control. Data represents average of six independent samples ± SD. p = 0.37 for stg levels between KO2, esg-GAL4/KO1 and KO2, esg-GAL4/KO1>EcR-RNAi. p ≤ 0.01 comparing primary and mature EcR transcripts between esg-GAL4 control and KO2, esg-GAL4/KO1 mutant samples. (E) Diagram of the regulatory relationships between EcR, miR-965 and the miR-965 targets string and wg. The symbols represent repression of gene expression. miR-965 and EcR repress each other at the primary transcript level. The effect of miR-965 on EcR primary transcript is most likely indirect.

DOI: http://dx.doi.org/10.7554/eLife.07389.031

miRNA quantitative RT-PCR showing the levels of mature miR-965 in RNA extracted from 0 hr pupae. esg-GAL4 was used to direct UAS-EcR expression in histoblasts. Data were normalized to U27 and snoR422 and to the esg-GAL4/+ control sample. Data represent the average of three independent biological samples ± SD. Refers to Figure 6A.

DOI: http://dx.doi.org/10.7554/eLife.07389.032

A reporter transgene containing the n EcR 3′ UTR linked to GFP was introduced into the miR-965 KO1/KO2 mutant background. GFP expression (green) did not increase in the histoblast nests in the miRNA mutant compared to the control. Thus, there was no indication that the miRNA acts directly on EcR transcript. There were no good quality miR-965 sites predicted in the various EcR 3′ UTR isoforms. Nuclei were labeled with H2-RFP. Scale bar—100 µM. Refers to Figure 6D.

DOI: http://dx.doi.org/10.7554/eLife.07389.033

Figure 6—figure supplement 1.

Mature miR-965 miRNA regulation by EcR.

miRNA quantitative RT-PCR showing the levels of mature miR-965 in RNA extracted from 0 hr pupae. esg-GAL4 was used to direct UAS-EcR expression in histoblasts. Data were normalized to U27 and snoR422 and to the esg-GAL4/+ control sample. Data represent the average of three independent biological samples ± SD. Refers to Figure 6A.

DOI: http://dx.doi.org/10.7554/eLife.07389.032

Video 12.

miR-965 overexpression.

Early division arrest in a pupa overexpressing miR-965 under esg-GAL4 control (genotype: esg-GAL4, UAS-nuclear GFP/UAS-miR-965). Animals were collected for imaging at 0 hr APF. Scale bar: 50 µM. Refers to Figure 6C.

DOI: http://dx.doi.org/10.7554/eLife.07389.034

Regulation of miR-965 by ecdysone at the beginning of pupariation.

(A) Quantitative RT-PCR showing levels of miR-965 primary transcript, EcR, and string mRNAs in RNA isolated from pupae expressing esg-GAL4 (control) and esg-GAL4 driving UAS-EcR-RNAi to deplete EcR mRNA. Samples were collected at 0 hr APF. Data were normalized to rp49 and to the esg-GAL4 control. Data represents average of three independent samples ± SD. (B) Quantitative RT-PCR showing string mRNA in 0 hr pupae overexpressing miR-965 in histoblast cells. For quantitative microRNA PCR, data were normalized to U14, U27, SnoR422. Data were normalized to rp49 for string mRNA qPCR. Data represent the average of four independent samples ± SD. (C) Images from time-lapse videos showing the effects of miR-965 overexpression in histoblast cells during the synchronous division phase. M1, M2 and M3 indicate three consecutive mitotic divisions in dorsal histoblast nests. Scale bar: 50 µm. (D) Quantitative RT-PCR showing levels of string, EcR primary transcript (EcR-PT) and mature mRNA in RNA isolated from pupae expressing esg-GAL4 (control), esg-GAL4 in the miR-965 mutant with and without UAS-EcR-RNAi to deplete EcR mRNA. esg-GAL4 was recombined onto the KO2 mutant chromosome. Samples were collected at 0 hr APF. Data were normalized to rp49 and to the esg-GAL4 control. Data represents average of six independent samples ± SD. p = 0.37 for stg levels between KO2, esg-GAL4/KO1 and KO2, esg-GAL4/KO1>EcR-RNAi. p ≤ 0.01 comparing primary and mature EcR transcripts between esg-GAL4 control and KO2, esg-GAL4/KO1 mutant samples. (E) Diagram of the regulatory relationships between EcR, miR-965 and the miR-965 targets string and wg. The symbols represent repression of gene expression. miR-965 and EcR repress each other at the primary transcript level. The effect of miR-965 on EcR primary transcript is most likely indirect. DOI: http://dx.doi.org/10.7554/eLife.07389.031

Mature miR-965 miRNA regulation by EcR.

miRNA quantitative RT-PCR showing the levels of mature miR-965 in RNA extracted from 0 hr pupae. esg-GAL4 was used to direct UAS-EcR expression in histoblasts. Data were normalized to U27 and snoR422 and to the esg-GAL4/+ control sample. Data represent the average of three independent biological samples ± SD. Refers to Figure 6A. DOI: http://dx.doi.org/10.7554/eLife.07389.032

EcR 3′ UTR reporter expression in the miR-965 mutant.

A reporter transgene containing the n EcR 3′ UTR linked to GFP was introduced into the miR-965 KO1/KO2 mutant background. GFP expression (green) did not increase in the histoblast nests in the miRNA mutant compared to the control. Thus, there was no indication that the miRNA acts directly on EcR transcript. There were no good quality miR-965 sites predicted in the various EcR 3′ UTR isoforms. Nuclei were labeled with H2-RFP. Scale bar—100 µM. Refers to Figure 6D. DOI: http://dx.doi.org/10.7554/eLife.07389.033

miR-965 overexpression.

Early division arrest in a pupa overexpressing miR-965 under esg-GAL4 control (genotype: esg-GAL4, UAS-nuclear GFP/UAS-miR-965). Animals were collected for imaging at 0 hr APF. Scale bar: 50 µM. Refers to Figure 6C. DOI: http://dx.doi.org/10.7554/eLife.07389.034 In light of the finding that EcR limits miR-965 expression, we asked whether Ecdysone signaling might act via miR-965 to regulate string. We introduced a UAS-EcRRNAi into the miR-965 mutant background and measured the levels of string mRNAs. Depletion of EcR did not reduce string mRNA in animals lacking miR-965 (Figure 6D). This provides evidence that Ecdysone signaling is mediated through regulation of the miR-965 miRNA to regulate histoblast proliferation. In the course of this analysis, we observed that EcR transcript levels increased in the miR-965 mutant (Figure 6D). Both mature and primary transcript levels increased, suggesting an indirect effect of the miRNA on EcR transcription. To ask if there might also be a post-transcriptional component to the regulation of EcR by miR-965, we used an EcR 3′ UTR reporter transgene linked to GFP (Varghese and Cohen, 2007). GFP expression in the histoblast nests did not increase in the miRNA mutant background, indicating indirect regulation of EcR by miR-965 (Figure 6—figure supplement 2). These experiments provide evidence for a regulatory feedback relationship between miR-965 and the Ecdysone receptor (Figure 6E). EcR activity limits miR-965 expression. miR-965 activity limits EcR primary transcript levels, suggesting an effect on transcription.
Figure 6—figure supplement 2.

EcR 3′ UTR reporter expression in the miR-965 mutant.

A reporter transgene containing the n EcR 3′ UTR linked to GFP was introduced into the miR-965 KO1/KO2 mutant background. GFP expression (green) did not increase in the histoblast nests in the miRNA mutant compared to the control. Thus, there was no indication that the miRNA acts directly on EcR transcript. There were no good quality miR-965 sites predicted in the various EcR 3′ UTR isoforms. Nuclei were labeled with H2-RFP. Scale bar—100 µM. Refers to Figure 6D.

DOI: http://dx.doi.org/10.7554/eLife.07389.033

Discussion

Our findings link regulation of the miR-965 microRNA to the onset of histoblast proliferation at the larval to pupal transition. Previous reports have provided evidence that Ecdysone signaling activates string expression to trigger the onset of histoblast proliferation at the beginning of pupal development (Ninov et al., 2009). Our findings provide evidence that Ecdysone signaling works though regulation of miR-965, which in turn regulates string. Interestingly, we also find evidence for negative feedback regulation of miR-965 on EcR. Mutual repression circuitry of this type can contribute a switch-like function: EcR activity lowers miR-965 activity, which allows greater EcR expression/activity by alleviating miR-965 mediated repression. In a circuit of this design, there will be a delay between reduced transcription of the miRNA primary transcript and the decay of the mature miRNA product. Hence sustained EcR activity is needed to throw the switch. We have previously reported that EcR shows positive transcriptional autoregulation and that this is buffered by miR-14 in a mutual repression circuit (Varghese and Cohen, 2007). Positive feedback allows for a sharp switch-like response, but also makes the system very sensitive to stochastic fluctuation in EcR activity. Coupling EcR positive auto-feedback to miRNA-mediated repression allows a robust switch function upon Ecdysone stimulation, while protecting the system from the effects of biological noise. This study provides evidence that miR-965 plays an analogous role in regulating EcR response and suggests that miR-965 confers robustness to the EcR response in the histoblasts. Upregulation of string in the miR-965 mutant contributes to the defects in histoblast proliferation. How misregulation of string might contribute to the migration defects is less immediately obvious. Previous work has shown that cell cycle progression in the histoblast population is required to trigger programmed cell death in the surrounding LEC (Nakajima et al., 2011). Those authors provided evidence that cell growth and the expansion of the histoblast nests may be required to elicit LEC apoptosis. Although the mechanism by which expansion of the histoblasts triggers LEC death is not clear, elevated string expression in the miR-965 mutant is likely to be responsible for the cell cycle progression defects during this phase, hindering normal LEC removal and histoblast migration. Persistence of the LECs might also be a consequence of the increased expression of Wg protein in the mutant histoblast nests. Wg acts in combination with EGFR and Dpp signals to control abdominal segment patterning (Shirras and Couso, 1996; Kopp et al., 1999; Ninov et al., 2009, 2010). These signals are thought to control differential cell adhesion, which may be important for elimination of the LECs as well as for proper segmental fusion of the histoblast nests. Elevated expression of Wg protein may lead to an expanded range of action, perhaps resulting in ectopic Wg activity in the LECs. Each adult abdominal segment has a well-defined anterior-posterior polarity. Wg is required from 15–20 hr APF for bristle formation and from 18–28 hr APF for tergite differentiation and pigmentation. Overexpression of wg has been shown to cause ectopic bristle formation, and shaggy mutant clones, which constitutively activate wg signaling, can cause polarity reversal in abdominal bristles, while EGFR, FGF, dpp and Notch signaling have no effect on the polarity of bristles in adult epidermis (Lawrence et al., 2002). Wg levels are normally higher in the posterior region of the anterior histoblast nests and lower more anteriorly. Our finding that Wg levels were elevated and that the distribution of Wg was broader than normal suggests ectopic Wg activity throughout the histoblast nest, including cells that normally experience low Wg levels. Ectopic spread of Wg could be responsible for the formation of ectopic bristles and for the occasional instances of polarity reversal observed in the anterior part of tergites in the miR-965 mutants. Replacement of the larval epidermis during metamorphosis involves regulation of both cell-intrinsic events in the abdominal histoblasts and communication between histoblasts and the larval cells they will replace. miR-965 acts on at least two separate processes required during histoblast morphogenesis. A miRNA with multiple targets can add a layer of regulation, acting across different pathways to integrate their activities (Herranz and Cohen, 2010). In doing so, the miR-965 miRNA appears to contribute to the robustness of this complex morphogenetic system.

Materials and methods

Fly strains

w was used as the control genotype unless otherwise indicated. esg-GAL4, UAS-GFP was obtained from Shigeo Hayashi. UAS-stg.N4, stg, stg, wg, wg, Kis, Kis, Kis, Kis, Kis, Kis, Kis, Df(2L)Exe7702, Df(2L)ED19 are from Bloomington stock center. EcR-RNAi (v37059) was from Vienna Drosophila Research Center and P{GawB}esg and ZCL2207 (Atpα-GFP) was from DGRC, Kyoto.

Mutant generation

miR-965 (KO1) and miR-965RMCE (KO2) deletion mutants were generated by targeted homologous recombination as described (Chen et al., 2011, 2014). Left and right homology arms were amplified by PCR from genomic DNA. The 4055 bp left homology arm was amplified with primers: LF- 5′ TTAGAGCTATTGCAACGAAAAGTG 3′, LR- 5′ GTGTAACGGGGATAATAGGATCTG 3′; the 4435 bp right arm was amplified with: RF- 5′ AACACACACAGATGCAGATACAGA 3′ and RR- 5′ AAATAAACGGTTCACTTCTTCTGC 3′. Following recombination, 153 bp spanning the miRNA-965 hairpin was deleted and replaced with a mini-white cassette. miR-965 mutants were crossed to heat shock-CRE flies and given heat shock treatment to excise the mini-white cassette. Deletion of miR-965 in both mutants was confirmed by genomic DNA PCR and by microRNA quantitative-PCR. All genetic tests were done using flies carrying two independently generated alleles or an allele in trans to a chromosomal deletion, Df(2L)ED19, which removes the miR-965 locus. For generation of Rescue allele, 158 bp of genomic region containing miR-965 hairpin was amplified with primers F- 5′ GCGGGCATGTCGAGGTCGACAAGTAAAATAGCGGAATCAAAATAAT 3′, R- 5′ GCTCTAGAACTAGTGGATCCAACACTTTTCGTTGCAATAGCTC 3′ and replaced mini-white gene in miR-965 (KO2) mutant allele.

Sensor and overexpression transgenic generation

miR-965 sensor: for microRNA-GFP sensors, mature miR-965 sequence with primers F- 5′ CTAGAAAGGGGAAAAGCTATACGCTTAC 3′ and R- 5′ TCGAGTAAGCGTATAGCTTTTCCCCTTT 3′ was cloned into 3′UTR of EGFP driven by tubulin promoter in pCasper4. For UAS constructs, the miR-965 hairpin was amplified using F- 5′ TATAGCGGCCGCAAGTAAAATAGCGGAATCAAAATAAT 3′ and R- 5′ TATATCTAGAAACACTTTTCGTTGCAATAGCTC 3′ and cloned into pUAST-DsRed.

3′UTR reporter assays

miR-965 expression plasmids were generated by cloning the miR-965 hairpin into pCasper-tub-SV40 with primers F- 5′ TCTAGACTTTCATTTTAAGTAAAATAGCGG 3′ and R- 5′ CCTCGAGAACACTTTTCGTTGCAATAGCTCT 3′. For luciferase reporter constructs, 3′UTR of target genes were cloned into pCasper4-tub-Fluc-SV40 firefly luciferase vector. The following primers were used for cloning 3′UTRs into luciferase vector. Stg 3′UTR F- 5′ GATCGCCGTGTAATTCTAGAGATGATCGTGCAGTTCGTTATC 3′. Stg 3′UTR R- 5′ GGCTGCAGGTCGACCTCGAGTTCTTTTTCGTCGTGTATTAATGT 3′. Wg 3′UTR F- 5′ GATCGCCGTGTAATTCTAGACCGCCCTCTTCGTTCTTTGT 3′. Wg 3′UTR R- 5′ GGCTGCAGGTCGACCTCGAGACTCATTGTCGTTTTGTGTTTTT 3′. Mutation in the miR-965 seed region in stg 3′UTR was done using following primers: Stg mut UTR up F- 5′ GGGCGGAAAGATCGCCGTGTAATTCTAGAGATGATCGTGCAGTTCG 3′. Stg mut UTR up R- 5′ CAAATAATGATCATAAATTGTACCTAGCAGAAGTT 3′. Stg mut UTR down F- 5′ TTATGATCATTATTTGTTTATTTTTATGTAATCCG 3′. Stg mut UTR down F- 5′ ATAAACAAATAAAATTGTACCTAGCAGAAGTT 3′. Stg extensive mut 1F- 5′ GATCGCCGTGTAATTCTAGAGATGATCGTGCAGTTCGTTATC 3′. Stg extensive mut 1R- 5′ CATCACTTAGGCGTAATGTCGGATAAATAAAGTTTTATGG 3′. Stg extensive mut 2F- 5′ACGCCTAAGTGATGCCAGATGTACCCTACTGCTAGGTACAATTTA 3′. Stg extensive mut 2R- 5′ GGCTGCAGGTCGACCTCGAGTTCTTTTTCGTCGTGTATTAATGT 3′. Mutation in miR-965 seed region in wg 3′UTR was done using primers: Wg mut up F- 5′ GAACTGCCTGCGTGAGATTCTCGCATGCCAGAGATCCTA 3′. Wg mut up R- 5′ CTAATAACAAAGGCTGAGTGGAGACAAAATACATAACACA 3′. Wg mut down F- 5′ TGTGTTATGTATTTTGTCTCCACTCAGCCTTTGTTATTAG 3′. Wg mut down R- 5′GGCTGCAGGTCGACCTCGAGACTCATTGTCGTTTTGTGTTTTT 3′. Drosophila Schneider cells (S2) were grown at 25°C in the absence of CO2, with serum free medium (SFM, Gibco) supplemented with L-Glutamine. 2 × 106 S2 cells were transfected in 24-well plates with 25 ng of the firefly luciferase reporter and Renilla luciferase control plasmids, and 250 ng of the miRNA-965 expression plasmid or empty vector. Transfection was done using Cellfectin II (Invitrogen). Transfections were performed in triplicate and each experiment was performed in at least three independent replicates. Cells were lysed 2.5 days after transfection in 100 μl passive lysis buffer, shaken at room temperature for 20 min and dual-luciferase assays were performed according to the manufacturers protocol (Promega).

Quantitative RT-PCR

Total RNA was extracted from 0 hr or 21 hr pupae and used for cDNA synthesis. Mature miR-965 transcript level was measured by using TaqMan miRNA assays and normalized to U14, U27 or snoR422 control primers. For target mRNA qRT-PCR, total RNA was treated with RNAse-free DNAse. First strand cDNA was synthesized using oligo-dT primers and SuperScript RT-III (Invitrogen). qRT-PCR was performed using SYBR green (Applied Biosystems). Measurements were normalized to Ribosomal Protein 49. Primers: rp49 F- GCTAAGCTGTCGCACAAA and rp49 R- TCCGGTGGGCAGCATGTG. kis F- TTCACGGAAATCATCAAGGA and kis R- CTGTTGCTGTAGCGGATGTG stg F- ATTCTCCCATTTTCCCAGTTTT and stg R- CTTCCCATCCTATCCTTTCCTT. wg F- GTCAGGGACGCAAGCATAAT and wg R- GCGAAGGCTCCAGATAGACA. EcR F- TAACGGCCAACTGATTGTACG and EcR R- GCGGCCAAGACTTTGTTAAGA. Pri-965 F- AAATCACAAAGCAGAAGAAGTGAA and Pri-965 R- ACAGAAGGGCACATATAACGTACA.

Live imaging of pupae

For video of the division phase (0–8 hr), 0 hr white pupa were washed with PBS, dried and stuck to imaging dishes (MatTek) with a drop of mineral oil. For growth phase videos, white pupae and allowed to age until 15–20 hr at 25°C. The outer cuticle was removed without damaging internal tissues. Pupae were mounted into imaging dishes with a drop of mineral oil. Zeiss LSM700 and Leica SP5 microscopes were used for imaging and videos were processed by imageJ and photoshop. videos were taken at 5 frames/s for division phase and 10 frames/s for growth phase. For measurement of speed of migration of histoblast nests, the distance moved by the leading edges of the histoblast nests from segment 3 and 4 was measured and migration speed was calculated in micrometer/hour.

Adult cuticle preparation

Adult flies were soaked in Ethanol:Glycerol (3:1), then boiled with 10% KOH at 90°C for 2–5 min. Cuticles were rinsed once with PBT (PBS with 0.1% TritonX-100), then 3 times with PBS, 15 min each and mounted with glycerol.

Immunohistochemistry

For immunostaining, 0 hr white pupae were transferred to fresh vials and raised at 25°C for staging. Pupae ∼24 hr APF were attached to double sided tape and bisected with a blade. Gut and fat body were removed without disturbing the inner epithelial layer. Cuticle with attached epithelium was washed with PBS and fixed with 4% paraformaldehyde for one and half hour at 4°C. Samples were rinsed 4 × 15 min with PBT (PBS with 0.1% Triton X-100) and blocked for 2 hr with 1% BSA in PBT. Samples were incubated with mouse anti-Wg antibody (1:20, DSHB) overnight at 4°C. Samples were washed with PBT (4 × 15 min) and incubated with AlexaFluor secondary antibody (1:500, Invitrogen) for 2 hr at room temperature. Samples were washed again 4 × 15 min with PBT and stained with DAPI (1:1000) for 10 min at room temperature before mounting. eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers. Thank you for sending your work entitled “miR-965 controls cell proliferation and migration during tissue morphogenesis in the Drosophila abdomen” for consideration at eLife. Your article has been favorably evaluated by K VijayRaghavan (Senior Editor), a Reviewing Editor, and three reviewers. The reviewers agree that this paper addresses an interesting topic and that the regulation of histoblast proliferation and migration by miR-965 is in principle suitable for eLife. There were however, some concerns that the conclusions are not fully supported by the current data. The main areas of concern are as follows: 1) There is an apparent discrepancy between the severe defects in pupal histoblast proliferation and spreading, and the rather mild adult defects. This needs clarification: are the adults escapers with a more mild initial phenotype? What are the frequencies of the phenotypes and pre-eclosion lethality? Generally, the phenotypic analysis needs quantification and explanation. 2) Although the effects on stg look robust, the role of miR-965 on wg is less convincing. The effects of loss of miR-965 on wg expression was weak, and reduction of wg was not a very effective suppressor. This needs clarification with further data or, failing that, the conclusion that wg is a significant target of miR-965 in histoblast development needs to be more cautious. 3) Since mutation of the miR-965 site in the stg 3' UTR does not fully rescue the luciferase reporter expression, it is possible that miR-965 might have other indirect effects which might effect stg. This ought to be acknowledged. 4) mir-965 is predicted to target 69 genes, so it should be clarified whether these are the only two targets with functional relevance to the phenotypes observed. This can be addressed by testing whether reduction of both stg and wg together completely rescue the phenotype of mir-965 mutants? At least it needs to be clear whether there are other relevant targets, even if they are unidentified. 5) The role of ecdysone, which is an important physiological element of the model, also needs some further clarification. How functionally important is the ecdysone regulation of stg in histoblasts? Is it dependent on miR-965? And the effect of EcR loss on wg expression was not explored: if wg is a significant player, this is a gap that needs to be addressed. Overall, we have limited our major comments to issues that the reviewers believe are necessary to support the model, not to extend it. It is acknowledged that this will require some additional data but the consensus is that these are necessary. 1) There is an apparent discrepancy between the severe defects in pupal histoblast proliferation and spreading, and the rather mild adult defects. This needs clarification: are the adults escapers with a more mild initial phenotype? What are the frequencies of the phenotypes and pre-eclosion lethality? Generally, the phenotypic analysis needs quantification and explanation. We have checked pupal survival rates and see no evidence of pre-eclosion lethality (Author response image 1).
Author response image 1.

DOI: http://dx.doi.org/10.7554/eLife.07389.037

DOI: http://dx.doi.org/10.7554/eLife.07389.037 Pupal survival was assayed for flies of the indicated genotypes. The data present the total number of surviving adults (live) and the total number of dead pupae (dead). There was no significant difference between the mutant and control genotypes used to make the movies: p=0.67 comparing KO2 esgG4>GFP/+ vs KO2 esgG4>GFP/KO1 (Mann-Whitney test). p=1 comparing KO1 esgG4>GFP/+ vs KO1 esgG4>GFP/KO2 (Mann-Whitney test). Given that there was no significant loss of a class of more severely affected animals, we suggest that the apparent difference reflects a delay in tissue replacement in the mutant, so that most animals end up with milder defects by the end of pupariation than were apparent during the time window for making the movies. These data are shown in Figure 3–figure supplement 3 and mentioned in the text. Quantification: please note that the quantification of the segment gap phenotype was given in Figure 1E. The number of affected individuals and total number examined was shown for each genotype. Quantification of the polarity and further detail on the gap phenotype was provided in Figure 1–figure supplement 3. 2) Although the effects on stg look robust, the role of miR-965 on wg is less convincing. The effects of loss of miR-965 on wg expression was weak, and reduction of wg was not a very effective suppressor. This needs clarification with further data or, failing that, the conclusion that wg is a significant target of miR-965 in histoblast development needs to be more cautious. Wg protein level was higher and its range expanded in the mutant (Figure 5E). The question is whether that upregulation has an impact on the phenotype. The evidence in Figure 5F says that Wg upregulation does contribute. The reviewers’ point is based on the magnitude of the effects of manipulating stg and wg activity in the mir-965 mutant background. Because these data are represented in a quantitative manner, it is tempting to interpret the magnitude of the effect as an indication of how “significant” misregulation of the target is to the phenotype. This might be misleading, for the following reason. In order to be able to compare the relative contribution of each target, we would need to be able to reduce each of them back to normal levels in the mutant background. We lack the means to control target levels so precisely. So, we prefer to limit our interpretation of this class of experiment to a qualitative assessment: Does upregulation of Wg contribute to the mutant phenotype? We believe that the evidence presented answers this question. In response to the reviewers’ comments, we have changed the text to highlight that the magnitude of the effects of Wg are smaller than those of String. We have added the following text to help the reader think about how to interpret the magnitude differences: “Next, we tested the effect of removing one copy each of stg and wg. The segment gap phenotype was reduced comparing KO1/KO2 vs KO1 wg/KO2; stg/+ (Figure 5F, p<0.001, Fisher’s exact test). Taking out one copy each of stg and wg lowered penetrance of the phenotype to ∼4%, compared with 6-7% for Stg/+ alone or 12% for Wg/+ alone. These experiments provide evidence that overexpression of string and wg each contribute to the miR-965 mutant histoblast phenotypes. The effect of limiting Wg expression in the mutant background may appear to be smaller than that of limiting String. However, to make a meaningful comparison of the relative contribution of these two targets, it would be necessary to restore each of them to normal levels. The genetic method used to reduce target activity in the mutant background does not allow precise control over the final target level, so this question cannot be addressed. We do not exclude the possibility that there could be other functionally significant targets in addition to Wg and String.” 3) Since mutation of the miR-965 site in the stg 3' UTR does not fully rescue the luciferase reporter expression, it is possible that miR-965 might have other indirect effects which might effect stg. This ought to be acknowledged. We added: “however, we do not exclude the possibility that there could also be indirect effects of miR-965 on expression of this reporter. ” 4) mir-965 is predicted to target 69 genes, so it should be clarified whether these are the only two targets with functional relevance to the phenotypes observed. This can be addressed by testing whether reduction of both stg and wg together completely rescue the phenotype of mir-965 mutants? At least it needs to be clear whether there are other relevant targets, even if they are unidentified. Data on the combined effects of lowering stg and wg have been added to Figure 5F. Removing both together further suppressed the defect, beyond the level reached by either alone. ∼4% of individuals still showed a phenotype. This could be due to partial offsetting of the increase in target expression (ie residual target excess not allowing complete suppression) or it could be interpreted to mean that there are other targets. Please see the response to point 2 above. The new text highlights the possibility of additional targets. 5) The role of ecdysone, which is an important physiological element of the model, also needs some further clarification. The reviewers raise multiple points. I’ve separated them for clarity. How functionally important is the ecdysone regulation of stg in histoblasts? Is it dependent on miR-965? To address this, we asked if depletion of EcR would affect string mRNA levels in the miR-965 mutant background. String levels were not affected, so it appears that up-regulation of miR-965 is needed for EcR to act on string mRNA at this stage. Data are in the new Figure 6D. And the effect of EcR loss on wg expression was not explored: if wg is a significant player, this is a gap that needs to be addressed. We examined the relationship between EcR and string at the onset of pupariation (0hr white prepupae), when the Ecdysone pulse induces string to trigger histoblast proliferation. Wg expression begins in the histoblast nests from 15hr after pupariation, so it is not evident that we should expect the link between EcR and wg to be analogous to that with string. Nonetheless, we did test wg transcript in the 0hr prepupal RNA samples used for the string experiment: there was no effect (Author response image 2). We did not include the wg data in the revised Figure 6, but can do so if the editors request it.
Author response image 2.

DOI: http://dx.doi.org/10.7554/eLife.07389.038

DOI: http://dx.doi.org/10.7554/eLife.07389.038 New data added on the relationship between EcR and miR965: While exploring the relationship between EcR and miR-965, we’ve made an interesting new finding: EcR and miR-965 appear to be linked in a mutual repression feedback loop in which EcR and miR-965 repress each other. The new data on repression of EcR by miR965 consists of: 1) qPCR to show that both EcR mRNA levels increase in the miR-965 background. Both mature and primary transcript were affected, suggesting that miR-965 acts indirectly to limit EcR transcription. Data are in the new Figure 6D. 2) We also tested for possible direct effects of miR-965 on an EcR 3’ UTR reporter transgene, but did not see evidence for direct regulation of EcR by the miRNA. The data are in Figure 6–figure supplement 2. Mutual repression circuitry of this type can contribute a switch-like function: EcR activity lowers 965 activity, which allows greater EcR expression/activity by alleviating miR-965 mediated repression. In a circuit of this design, there will be a delay between reduced transcription of the miRNA primary transcript and the decay of the mature miRNA product. Hence sustained EcR activity is needed to throw the switch. We previously reported that EcR shows positive transcriptional autoregulation and that this is buffered by miR-14 in a mutual repression circuit (Varghese & Cohen, 2007). Positive feedback allows for a sharp switch-like response, but also makes the system very sensitive to stochastic fluctuation in EcR activity. Coupling EcR positive feedback to miRNA-mediated mutual repression allows a robust switch function upon Ecdysone stimulation, while protecting the system from the effects of random fluctuation in EcR levels that might otherwise trigger a feedback response. Our new data provides evidence that miR-965 plays an analogous role in regulating EcR response and suggests that miR-965 confers robustness to the EcR response in the histoblasts.
  27 in total

1.  bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila.

Authors:  Julius Brennecke; David R Hipfner; Alexander Stark; Robert B Russell; Stephen M Cohen
Journal:  Cell       Date:  2003-04-04       Impact factor: 41.582

2.  Ends-out, or replacement, gene targeting in Drosophila.

Authors:  Wei J Gong; Kent G Golic
Journal:  Proc Natl Acad Sci U S A       Date:  2003-02-14       Impact factor: 11.205

3.  Establishment of imaginal discs and histoblast nests in Drosophila.

Authors:  A A Simcox; E Hersperger; A Shearn; J R Whittle; S M Cohen
Journal:  Mech Dev       Date:  1991-03       Impact factor: 1.882

4.  The three postblastoderm cell cycles of Drosophila embryogenesis are regulated in G2 by string.

Authors:  B A Edgar; P H O'Farrell
Journal:  Cell       Date:  1990-08-10       Impact factor: 41.582

5.  The development of the imaginal abdomen of Drosophila melanogaster.

Authors:  M Guerra; J H Postlethwait; H A Schneiderman
Journal:  Dev Biol       Date:  1973-06       Impact factor: 3.582

6.  Drawing a stripe in Drosophila imaginal disks: negative regulation of decapentaplegic and patched expression by engrailed.

Authors:  M Sanicola; J Sekelsky; S Elson; W M Gelbart
Journal:  Genetics       Date:  1995-02       Impact factor: 4.562

7.  Morphogenesis of the epidermis of adult abdomen of Drosophila.

Authors:  M M Madhavan; K Madhavan
Journal:  J Embryol Exp Morphol       Date:  1980-12

8.  cdc25 is a specific tyrosine phosphatase that directly activates p34cdc2.

Authors:  J Gautier; M J Solomon; R N Booher; J F Bazan; M W Kirschner
Journal:  Cell       Date:  1991-10-04       Impact factor: 41.582

9.  Towards a model of the organisation of planar polarity and pattern in the Drosophila abdomen.

Authors:  Peter A Lawrence; José Casal; Gary Struhl
Journal:  Development       Date:  2002-06       Impact factor: 6.868

10.  Control of imaginal cell development by the escargot gene of Drosophila.

Authors:  S Hayashi; S Hirose; T Metcalfe; A D Shirras
Journal:  Development       Date:  1993-05       Impact factor: 6.868

View more
  6 in total

1.  MicroRNAs Establish Uniform Traits during the Architecture of Vertebrate Embryos.

Authors:  Dionna M Kasper; Albertomaria Moro; Emma Ristori; Anand Narayanan; Guillermina Hill-Teran; Elizabeth Fleming; Miguel Moreno-Mateos; Charles E Vejnar; Jing Zhang; Donghoon Lee; Mengting Gu; Mark Gerstein; Antonio Giraldez; Stefania Nicoli
Journal:  Dev Cell       Date:  2017-03-27       Impact factor: 12.270

2.  20-Hydroxyecdysone-responsive microRNAs of insects.

Authors:  Xiaoli Jin; Xiaoyan Wu; Lanting Zhou; Ting He; Quan Yin; Shiping Liu
Journal:  RNA Biol       Date:  2020-06-16       Impact factor: 4.652

Review 3.  MicroRNA function in Drosophila melanogaster.

Authors:  Richard W Carthew; Pamela Agbu; Ritika Giri
Journal:  Semin Cell Dev Biol       Date:  2016-03-18       Impact factor: 7.727

4.  Ecdysone signaling induces two phases of cell cycle exit in Drosophila cells.

Authors:  Yongfeng Guo; Kerry Flegel; Jayashree Kumar; Daniel J McKay; Laura A Buttitta
Journal:  Biol Open       Date:  2016-11-15       Impact factor: 2.422

5.  microRNA target prediction programs predict many false positives.

Authors:  Natalia Pinzón; Blaise Li; Laura Martinez; Anna Sergeeva; Jessy Presumey; Florence Apparailly; Hervé Seitz
Journal:  Genome Res       Date:  2016-11-15       Impact factor: 9.043

6.  MicroRNA Tissue Atlas of the Malaria Mosquito Anopheles gambiae.

Authors:  Lena Lampe; Elena A Levashina
Journal:  G3 (Bethesda)       Date:  2018-01-04       Impact factor: 3.154

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.