Literature DB >> 26191467

Development and characterization of microsatellite loci for Ficus hirta (Moraceae).

Linna Zheng1, John D Nason2, Dan Liang1, Xuejun Ge3, Hui Yu3.   

Abstract

PREMISE OF THE STUDY: Microsatellite primers were developed to investigate population genetic structure in Ficus hirta (Moraceae). METHODS AND
RESULTS: Sixteen microsatellite primers were developed and optimized for F. hirta using Illumina paired-end sequencing of pre-receptive and receptive developmental-phase female flowers. Out of 16 primers, nine were found to be polymorphic in four populations of F. hirta. Alleles per locus ranged from two to 15 across the 94 F. hirta individuals, while within-population observed and expected heterozygosity per locus ranged from 0.000 to 0.955 and from 0.000 to 0.882, respectively. In addition, the 16 primers were tested in 29 additional Ficus species, with all found to amplify in at least 11 of these species and with most amplifying in a majority of the species.
CONCLUSIONS: This set of microsatellite primers is the first specifically developed for F. hirta and will facilitate studies of genetic diversity within and genetic differentiation among populations of Ficus species.

Entities:  

Keywords:  Ficus hirta; Moraceae; microsatellites; polymorphism; transcriptome sequencing

Year:  2015        PMID: 26191467      PMCID: PMC4504727          DOI: 10.3732/apps.1500034

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Figs (Ficus L., Moraceae) and their pollinating wasps (Hymenoptera: Agaonidae) are a textbook example of pollination mutualism and one of the best cases of coevolution known (Jousselin et al., 2003). With more than 750 species, figs are a common component of tropical and subtropical habitats and are completely dependent on their pollinator wasps for pollen dispersal and the production of viable seeds. In turn, the pollinating wasps gall a subset of the developing fig seeds and so are completely dependent on the fig for the completion of their life cycle. Ficus hirta Vahl is a dioecious shrub or small tree with a broad distribution at low elevations in Southeast Asia, where it plays an important role in forest succession and renewal in human-disturbed mountainous landscapes. Consequently, understanding the genetic diversity of this species is relevant to forest restoration and conservation, as well as coevolutionary studies. Microsatellite loci have become a powerful tool for analyzing population genetic structure, gene flow, and levels of inbreeding. Many microsatellite primers have been developed for genetic studies of figs (Zavodna et al., 2005; Crozier et al., 2006; Ikegami et al., 2009; Zhang et al., 2011). Moreover, microsatellite primers for F. hirta’s pollinator have been developed (Tian et al., 2011). Six of the microsatellite primers developed for other fig species are polymorphic in F. hirta; however, two of these loci exhibit significant excesses of homozygotes within populations, suggestive of null alleles (Yu et al., 2010). Additional marker loci are needed for population genetic studies of F. hirta; therefore, we have used a next-generation transcriptome sequencing approach (RNA-Seq) to develop microsatellites specifically for this species.

METHODS AND RESULTS

Plant material and RNA/DNA extraction

Fresh, female flowers from pre-receptive and from receptive male syconia of F. hirta growing at the South China Botanical Garden (IBSC; Guangdong Province) were excised with tweezers and then immediately frozen in liquid nitrogen for RNA extraction. A voucher specimen (Huiyu 368) has been preserved in the IBSC herbarium. Total mRNA was extracted from each of the two samples using a modified cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987). For each sample, an RNA-Seq library was constructed using the Illumina TruSeq RNA Sample Preparation Kit (Illumina, San Diego, California, USA) following the manufacturer’s recommendations, and then sequenced on an Illumina HiSeq 2000 platform. Both cDNA library construction and Illumina sequencing were carried out by Novogene (Beijing, China). In total, 56,047,406 (pre-receptive) and 60,136,746 (receptive) raw paired-end reads at least 100 bp in length were obtained. For testing new microsatellite loci, we sampled 94 individuals of F. hirta from four distinct, natural populations: three in China (DA: 19°33′02″N, 110°21′84″E; MH: 18°47′42″N, 110°23′27″E; WN: 21°58′46″N; 100°27′01″E) and one in Vietnam (YC: 20°15′182″N, 105°42′725″E). All of these individuals had morphological features typical of F. hirta var. hirta. Genomic DNA of each individual was extracted from silica gel–dried leaves using the modified CTAB method (Doyle and Doyle, 1987), and one voucher specimen per population was preserved in the IBSC herbarium (Huiyu-DA1, Huiyu-MH1, Huiyu-WN1, and Huiyu-YC1).

Microsatellite marker development

The program MISA (Thiel et al., 2003) was used to identify and localize putative microsatellite motifs in the F. hirta transcriptome sequence library. To be identified as a potential microsatellite locus, mononucleotide repeats were required to extend at least 10 repeats, dinucleotide repeats were required to extend at least six repeats, and repeats of all other motif lengths were required to extend at least five repeats. MISA identified 35,558 putative microsatellite loci. With this detailed information, the program Primer3 (Rozen and Skaletsky, 1999) was then used to design 11,468 primer pairs containing di-, tri-, tetra-, penta-, and hexanucleotide repeat motifs, with a melting temperature (Tm) ranging from 57°C to 63°C and fragment size from 100 to 300 bp.

Microsatellite screening

Primer pairs were synthesized (Invitrogen Trading Shanghai Co. Ltd., Shanghai, China) for 56 loci. The 56 loci were randomly selected with the constraint of having expected product sizes between 150 and 300 bp. Dinucleotide repeat loci had at least nine repeats and trinucleotide repeat loci had at least six repeats. These primer pairs were subsequently tested for proper PCR amplification in F. hirta using genomic DNA. PCRs were performed in a 20-μL volume containing 3 μL of 10× reaction buffer (containing Mg2+), 2 μL dNTP mix (10 mM; 2.5 mM each), 0.4 μM primers, 1 μL of 50 ng DNA, and 1 unit of Taq polymerase (TaKaRa Biotechnology Co., Dalian, China). PCR cycling was performed in the following conditions: one cycle of denaturation at 95°C for 3 min; 35 cycles for 45 s at 94°C, 45 s annealing at 60°C, and 45 s extension at 72°C; followed by a final 10-min extension at 72°C. The PCR products were checked on 1.5% agarose gels. Sixteen of the 56 primer pairs tested were found to amplify successfully in F. hirta (Table 1). To assess polymorphism of the 16 microsatellite primers, genomic DNA templates from the 94 F. hirta individuals from the four natural populations were used. PCR amplification was performed using forward primers labeled with fluorescent dyes (TAMRA, HEX, and FAM) with the same PCR reaction and cycling conditions as above. The PCR products were detected on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Carlsbad, California, USA) using Genotyper 4.0 and GeneScan 500 LIZ (Applied Biosystems) as an internal lane standard. Fragment lengths were calculated using GeneMapper 4.0 (Applied Biosystems) software. Nine of the 16 microsatellites were found to be polymorphic in F. hirta (Table 1).
Table 1.

Characteristics of 16 microsatellite loci developed for Ficus hirta.

LocusaPrimer sequences (5′–3′)Repeat motifAllele size (bp)Ta (°C)GenBank accession no.
FH1F: GCAGCAGTTGTGAGGGAAGA(ATA)6(AT)826660KP903721
R: TAGTGAAGAAGCGCATCCGG
FH3F: CTCCCACCCACAAATCCCTC(ACC)723160KP903722
R: GGTCCTCCAAACTCTTCGCA
FH5F: TCGTCGAAGGCTCAGATTCG(AG)918460KP903723
R: GCATTGTGTGGGGGAAGAGA
FH7F: AATCTTACTGGCGCGGGAAA(GA)915060KP903724
R: GTGCTGCGGATTTCGATTCC
FH10F: TGCTGGGGATAGGTCTTGGA(TC)9TAGCTTCTT(TC)614160KP903725
R: AATATCCAGAGCCGAAGCCG
FH14F: AGACACACCCCTTTGGAAGC(AAG)615560KP903726
R: TTCCCAAAAGAGCTGAGCCG
FH21F: AAGATCGTGGTGGTGAGCAG(AGT)625259KP903727
R: CGTGGTGCTCACAAACCTTG
FH23F: GCCGAGAGTGGAGAGCATTT(GAC)523260KP903728
R: TTCGAGAAAGATGCAGCCGT
FH47F: TTTCCGATCGATCTCAGCCG(AGA)625160KP903729
R: AAAATGGAGCCTCTCTGCCC
FH15F: TCAATTCTGTGGGTGTGCGA(TTTA)519260KP903730
R: TCCCTTTCTAATGTCGAGTTGAA
FH18F: ATCGAATCCGCCATGGCTAG(TCG)728060KP903731
R: TGTCGTCCTCATCAAAGGGC
FH32F: GGGTAGGTACAACCAGGCAC(TTA)626860KP903732
R: ACCCAACCAACCAACCAAGA
FH35F: AGAGCAAAGGGAAGACACCG(TTC)626260KP903733
R: CAAACCTACCTCGGTGACCC
FH37F: GGCACTTCAAGCAGCAATCC(GGT)623460KP903734
R: CCAAGATCGACCTCACCACC
FH42F: GATCCGGAACACTTGCATGC(CAT)620760KP903735
R: TGGTTTCTGGTTTCGCCACT
FH43F: CGCCCTTTTCGTTCTGTTGG(AATA)527560KP903736
R: CTGATTCTTCGCGATGCAGC

Note: Ta = annealing temperature.

The first nine primer pairs (bold locus names) were determined to be polymorphic in F. hirta.

Characteristics of 16 microsatellite loci developed for Ficus hirta. Note: Ta = annealing temperature. The first nine primer pairs (bold locus names) were determined to be polymorphic in F. hirta.

Microsatellite marker data analysis

Genotypes were scored by analyzing the electropherograms from the fragment analysis using GeneMarker version 1.95 (SoftGenetics, State College, Pennsylvania, USA). Descriptive statistics, including the number of alleles and the observed and expected heterozygosities for each F. hirta population, were estimated using GenAlEx version 6.1 (Peakall and Smouse, 2006) (Table 2). For each population, the number of alleles per locus at the nine loci ranged one to 11 with a total of 85 alleles summed across loci. Observed heterozygosity values ranged from 0.000 to 0.955, and expected heterozygosity ranged from 0.000 to 0.882. FSTAT 2.9.3 (Goudet, 2001) was used to test for deviations from Hardy–Weinberg equilibrium for each locus in each population and linkage disequilibrium between loci. Using a sequential Bonferroni correction for multiple comparisons (Rice, 1989), these tests revealed that two loci (FH1, FH21) were not in Hardy–Weinberg equilibrium (as expected for dioecious F. hirta), and that levels of linkage disequilibrium between loci were not significant.
Table 2.

Nine microsatellite locus–specific measures of genetic diversity across four populations of Ficus hirta.

DA (n = 24)MH (n = 24)WN (n = 24)YC (n = 22)
LocusAHoHeAHoHeAHoHeAHoHe
FH160.3500.75170.3890.71350.2080.66380.3330.685
FH370.7080.63560.7920.73480.6250.64950.6820.657
FH560.4580.53390.5880.65760.7080.66170.7270.702
FH7100.6670.80790.9550.847110.7500.874110.8180.882
FH1090.8750.72060.7890.72040.3330.572100.9090.823
FH1420.3480.38650.5420.57720.0830.08050.2270.211
FH2110.0000.00020.0000.27820.0000.33020.0000.496
FH2330.1250.19030.0870.23510.0000.00020.0910.087
FH4740.9170.69960.8750.76040.8750.70860.9550.728

Note: A = number of alleles sampled; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled.

Geographic coordinates for populations: DA = 19°33′02″N, 110°21′84″E; MH = 18°47′42″N, 110°23′27″E; WN = 21°58′46″N, 100°27′01″E; YC = 20°15′182″N, 105°42′725″E.

Nine microsatellite locus–specific measures of genetic diversity across four populations of Ficus hirta. Note: A = number of alleles sampled; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled. Geographic coordinates for populations: DA = 19°33′02″N, 110°21′84″E; MH = 18°47′42″N, 110°23′27″E; WN = 21°58′46″N, 100°27′01″E; YC = 20°15′182″N, 105°42′725″E.

Cross-species amplifications

The 16 primer pairs that amplified successfully in F. hirta were tested for amplification in one individual of each of 29 additional Ficus species, using the same procedures as above. All 16 were found to amplify in at least 11 of these species, with most amplifying in a majority of the species (Appendix 1).

CONCLUSIONS

The microsatellite loci described in this study provide an important resource for studying the factors affecting the distribution of genetic diversity in F. hirta and other Ficus species. We can use these loci to further investigate large-scale and fine-scale population genetic structure in F. hirta, building on our past work in this species investigating relative rates of pollen and seed migration (Yu et al., 2010) and the constraints to postglacial range expansion arising from restricted pollen or seed dispersal (Yu and Nason, 2013). Our results also demonstrate the application of RNA sequencing as a valuable tool for developing microsatellite loci in nonmodel species.
Appendix 1.

Amplification of 16 microsatellite primer pairs developed for Ficus hirta in 30 Ficus taxa.

Ficus taxa (subgenus)FH1FH3FH5FH7FH10FH14FH15FH18FH21FH23FH32FH35FH37FH42FH43FH47
F. deltoidea Jack (Ficus)+++++++
F. esquiroliana H. Lév. (Ficus)+++++++++++++++
F. formosana Maxim. (Ficus)++++++++++++
F. gasparriniana Miq. var. viridescens (H. Lév. & Vaniot) Corner (Ficus)++++++++++++++++
F. hirta Vahl (Ficus)++++++++++++++++
F. ischnopoda Miq. (Ficus)++++++
F. stenophylla Hemsl. (Ficus)+++++++++++++++
F. vasculosa Wall. ex Miq. (Pharmacosycea)+++++++++++++++
F. cyrtophylla (Wall. ex Miq.) Miq. (Sycidium)++++++++++++++
F. heterophylla L. f. (Sycidium)++++++++++++++++
F. subincisa Buch.-Ham. ex Sm. (Sycidium)++++++++++++++++
F. tinctoria G. Forst. subsp. gibbosa (Blume) Corner (Sycidium)+++++++++++++++
F. auriculata Lour. (Sycomorus)+++++++++++++++
F. hainanensis Merr. & Chun (Sycomorus)+++++++++++++
F. hispida L. f. (Sycomorus)+++++++++++
F. sarmentosa Buch.-Ham. ex Sm. var. henryi (King ex Oliv.) Corner (Synoecia)+++++++++++
F. altissima Blume (Urostigma)++++++++++++
F. annulata Blume (Urostigma)+++++++++++++
F. benjamina L. (Urostigma)++++++++++++
F. concinna (Miq.) Miq. (Urostigma)+++++++++++++
F. curtipes Corner (Urostigma)+++++++++
F. cyathistipula Warb. (Urostigma)++++++++++
F. drupacea Thunb. (Urostigma)+++++++++++
F. drupacea var. pubescens (Roemer & Schultes) Roth & Corner (Urostigma)++++++++++++++
F. elastica Roxb. (Urostigma)++++++++++++
F. glaberrima Blume (Urostigma)++++++++++++++++
F. lyrata Warb. (Urostigma)+++++++++++++++
F. maclellandii King (Urostigma)++++++++++++++++
F. microcarpa L. f. (Urostigma)++++++++++++++
F. stricta (Miq.) Miq. (Urostigma)+++++++++++++

Note: + = primers amplified successfully in the species; — = primers did not amplify in the species.

  9 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  Convergence and coevolution in a mutualism: evidence from a molecular phylogeny of Ficus.

Authors:  Emmanuelle Jousselin; Jean-Yves Rasplus; Finn Kjellberg
Journal:  Evolution       Date:  2003-06       Impact factor: 3.694

3.  Slatkin's Paradox: when direct observation and realized gene flow disagree. A case study in Ficus.

Authors:  Hui Yu; John D Nason; Xuejun Ge; Jiqing Zeng
Journal:  Mol Ecol       Date:  2010-09-14       Impact factor: 6.185

4.  Development of microsatellite loci for Blastophaga javana (Agaonidae), the pollinating wasp of Ficus hirta (Moraceae).

Authors:  En-Wei Tian; Hui Yu; Da-Yong Zhang; John D Nason
Journal:  Am J Bot       Date:  2011-01-21       Impact factor: 3.844

5.  ANALYZING TABLES OF STATISTICAL TESTS.

Authors:  William R Rice
Journal:  Evolution       Date:  1989-01       Impact factor: 3.694

6.  Nuclear and chloroplast DNA phylogeography of Ficus hirta: obligate pollination mutualism and constraints on range expansion in response to climate change.

Authors:  Hui Yu; John D Nason
Journal:  New Phytol       Date:  2012-11-05       Impact factor: 10.151

7.  Development and polymorphism of microsatellite primers in Ficus pumila L. (Moraceae).

Authors:  Jian Zhang; Kai Jiang; Yi-Su Shi; Min Liu; Xiao-Yong Chen
Journal:  Am J Bot       Date:  2011-06-23       Impact factor: 3.844

8.  Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.).

Authors:  T Thiel; W Michalek; R K Varshney; A Graner
Journal:  Theor Appl Genet       Date:  2002-09-14       Impact factor: 5.699

9.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

  9 in total
  3 in total

1.  Development of 14 polymorphic microsatellite loci for Ficus tikoua (Moraceae).

Authors:  Lu-Shui Zhang; Lu Tan; Dai-Mei Hu; Yan Chen
Journal:  Appl Plant Sci       Date:  2016-03-03       Impact factor: 1.936

2.  High genetic diversity and low population differentiation of a medical plant Ficus hirta Vahl., uncovered by microsatellite loci: implications for conservation and breeding.

Authors:  Yi Lu; Jianling Chen; Bing Chen; Qianqian Liu; Hanlin Zhang; Liyuan Yang; Zhi Chao; Enwei Tian
Journal:  BMC Plant Biol       Date:  2022-07-12       Impact factor: 5.260

3.  Development and characterization of 16 novel microsatellite markers by Transcriptome sequencing for Angelica dahurica and test for cross-species amplification.

Authors:  Qianqian Liu; Zuyu Lu; Wei He; Fang Li; Wenna Chen; Chan Li; Zhi Chao; Enwei Tian
Journal:  BMC Plant Biol       Date:  2020-04-08       Impact factor: 4.215

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.