Literature DB >> 26180781

Immunomodulatory Role of Adipose-Derived Stem Cells on Equine Endometriosis.

Maria Elena Falomo1, Letizia Ferroni2, Ilaria Tocco3, Chiara Gardin2, Barbara Zavan2.   

Abstract

Endometriosis is a degenerative process due to a chronic inflammatory damage leading to extracellular matrix components deposition and glandular fibrosis. It is known that mesenchymal stem cells secrete a wide range of bioactive molecules, some of them modulating the immune inflammatory response, and others providing regeneration and remodeling of injured tissue. We have performed in vitro experiments in order to analyze the capability of allogenic equine adipose-derived stem cells (ADSCs) to infiltrate mares' endometrial tissues and to stimulate the expression of cytokines and metallopeptidases. Differences in the biologic response to the exposure to ADSCs between pathological and healthy endometrial tissue have been identified. These results could challenge researchers to progress forward with future studies for the development of a biological therapy with a possible application in translational medicine.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26180781      PMCID: PMC4477049          DOI: 10.1155/2015/141485

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Mesenchymal stem cells (MSCs) are nowadays isolated from many different tissues, including bone marrow, umbilical cord blood and tissue, and adipose tissue, which constitute the most promising alternative for research and clinical purposes due to the easy accessibility. MSCs secrete a wide range of bioactive molecules, some of them modulating the immune inflammatory response, others providing regeneration and remodeling of injured tissue, and finally mitogens acting on lymphatic progenitors differentiation [1-10]. Thus, MSCs gained progressively higher attention in consideration of their bioactive features and started to be vastly used in research to test the effects of their multifactor dispensaries on clinical settings. Endometriosis is a multifactorial degenerative process of uterine glands and surrounding stroma, and it is considered a major cause of equine infertility [11, 12]. Endometrial tissue degeneration is due to a chronic inflammatory damage leading to extracellular matrix (ECM) components deposition and glandular fibrosis. In mares, the disease seems to be age-related, although a correlation with hormonal changes has not been demonstrated [13-15]. Etiology is still only partially clear, as studies show differences in mares' immune inflammatory response and thus susceptibility of the development of endometriosis [16-18]. Hypothesis has been made that differences in the expression rate of pro- and anti-inflammatory gene products in chronic inflammation are implied [17-19], involving especially ECM degrading-endopeptidases known as metallopeptidases (MMPs) and their inhibitors (TIMPs) [20, 21]. We previously and successfully isolated and expanded in vitro human adipose-derived stem cells (ADSCs) and observed their regenerative potential [22-24]. Based on current knowledge about the expression profile of inflammatory proteins, we aimed at analyzing the capacity of allogenic equine MSCs to integrate and influence the expression of these proteins in mares' endometrial tissue, possibly obtaining interesting data for translational purposes.

2. Materials and Methods

2.1. Samples Collection

Endometrial biopsies (40 × 40 × 3 mm) included in this study were collected postmortem from 12 mares: 6 younger than 6 years old and 6 older than 15 years old. Animals were classified according to Kenney's histological classes between healthy (classes I and IIA; n = 6) and pathological (class IIB and greater; n = 6) mares [25].

2.2. Equine ADSCs Isolation

Equine ADSCs were isolated from the fat of mares aging less than 5 years. The region above the dorsal gluteal muscle, at the base of the tail, was chosen as the adipose tissue collection site because of the availability of material, the absence of large veins, and ease of access. Adipose tissue samples (approximatively 100 gr each) were preserved in a sterile phosphate buffered saline (PBS) (Lonza, Walkersville, MD, USA) solution enriched with 1% penicillin/streptomycin (P/S) (EuroClone, Milan, Italy) and 1% amphotericin B (EuroClone) until processing. The samples were digested using a solution of 0.075% collagenase from Clostridium histolyticum type II (Sigma-Aldrich, St. Louis, MO, USA) in Hank's Balanced Salt Solution (HBSS) (Lonza), for 3 h at room temperature and in slow agitation. At the end of the digestion, the collagenase activity was blocked with an equal volume of complete Dulbecco's modified Eagle's medium (DMEM) (completed: cDMEM). cDMEM consisted of Dulbecco's modified Eagle's medium (DMEM, Lonza) supplemented with 10% fetal bovine serum (FBS, Bidachem S.p.A., Milano, Italy) and 1% P/S. After centrifugation for 7 min at 500 g, the pellet was washed in PBS and filtered with a 70 μM cell strainer (BD Biosciences, Mississauga, Ontario, Canada). The cell suspension was resuspended in cDMEM, transferred to a 25 cm2 tissue culture flask, and then incubated at 37°C and 5% CO2 for 15 days. Culture medium was changed every 2 days.

2.3. Equine ADSCs Labeling with Quantum Dots

Equine ADSCs at p3 were labeled with Qtracker 705 Cell Labeling Kit (Life Technologies, Carlsbad, CA, USA) following the manufacture's protocol. Quantum dots are nanocrystals made of semiconducting materials that, once inside the cells, provide stable fluorescence that can be traced through several generations and are not transferred to adjacent cells in a population [26].

2.4. Equine ADSCs Seeding on Endometrial Tissues

Endometrial biopsies from healthy and pathological mares were cut into 10 × 10 × 3 mm pieces. 5 × 105 equine ADSCs were then seeded onto each piece in cDMEM and incubated at 37°C and 5% CO2 for 3 days.

2.5. Histological Analyses

Endometrial biopsies were frozen in isopentane and liquid nitrogen. Samples were cut with cryostat (Leica CM1950, Leica Biosystems, Nußloch, Germany) in slivers of 7–10 μm. Healthy and pathological endometrial tissues before equine ADSCs seeding were stained with hematoxylin and eosin. On the contrary, endometrial samples treated with labeled equine ADSCs were stained with Hoechst 33342. All reagents were purchased from Sigma-Aldrich (Saint Louis, MO, USA).

2.6. Real-Time PCR

Total RNA was extracted using the TRIzol Reagent (Life Technologies) from healthy and pathological endometrial tissues before and after ADSCs seeding. The samples were quantified using the NanoDrop spectrophotometer (NanoDrop 1000, Thermo Scientific). For the first-strand cDNA synthesis, 1000 ng of total RNA was reverse transcribed using M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase, Life Technologies) according to the manufacturer's protocol. Equine primers were selected for each target gene with Primer 3 software (Table 1). Real-time PCRs were carried out using the designed primers at a concentration of 300 nM and FastStart SYBR Green Master (Roche Diagnostics, Mannheim, Germany) on a Rotor-Gene 3000 (Corbett Research, Sydney, Australia). Thermal cycling conditions were as follows: 15 min denaturation at 95°C, followed by 40 cycles of 15 s denaturation at 95°C, annealing for 30 s at 60°C, and 20 s elongation at 72°C. Values were normalized to the expression of the β-actin internal reference, whose abundance did not change under our experimental conditions. Experiments were performed with 3 different cell preparations and repeated at least 3 times.
Table 1

Equine primer sequences.

Gene symbolForward primer (5′→3′)Reverse primer (5′→3′)Product length (bp)
ACTBCTCCCAGCACGATGAAGAGTACTCCTGCTTGCTGATCC125
IL10GGCACCCAGTCTGAGAACAGCTGGTCCTTCATTTGAAAGAAAGTC115
IL1RNTGTGTCAAGTCTGGTGATGAGATGTTTGAGCGGATGAAGGTGA108
IL1BCAACGGAGAGAATACAAACCAACAAGGGCTTCCCATCTTTCATCCCA141
IL6 AGAACACAACAACTCACCTCATCCAGAGGAAGGAATGCCCATGAAC125
IL8TCCAAGAATTCCTCAGTAAAGATGCCCCTAGATACTGCGTGGGACAATG173
MMP14CAAGATGCCTCCTCAACCCAGCCACGGTGTCAAAGTTCC107
MMP2TGGTCCGTGTGAAGTATGGCTCGAAGTTGTAGGTGGTGGA139
MMP9ACAGTGCCTTTGGGTCCAGGTACCTCCCGTCCTTGAAGA102
TIMP2GCCAAAGCGGTCAGTGAGAGTAGATGAACTCGATGTCCTTGTCA132
TNFAACGGTGCTTGTGCCTCACGGTAACTGCTCTTCCCTCTG112

ACTB: actin beta; IL10: interleukin 10; IL1RN: interleukin 1 receptor antagonist; IL1B: interleukin 1 beta; IL6: interleukin 6; IL8: interleukin 8; MMP14: matrix metallopeptidase 14; MMP2: matrix metallopeptidase 2; MMP9: matrix metallopeptidase 9; TIMP2: TIMP metallopeptidase inhibitor 2; TNFA: tumor necrosis factor alpha.

2.7. Statistical Analysis

Data are presented as mean ± SD and MedCalc 9.0 software was used. The effect of ADSCs therapy on the total population was evaluated using paired matched Wilcoxon's rank test. A P value < 0.05 for the analysis was considered significant.

3. Results and Discussion

3.1. Equine ADSCs Isolation and Expansion

Adipose-derived stem cells (ADSCs) were isolated after enzymatic digestion from equine abdominal fat and plated on a 25 cm2 tissue culture flask. After 3 days, the nonadherent cells were removed by replacing the medium with fresh complete medium. The adherent cells are defined as passage 0 (p0) cells. At this stage, the cell morphology varies between cuboidal shape and spindle shape (Figure 1(a)). After reaching 80% confluence, ADSCs were trypsinized and expanded until p3. Figure 1(b) shows that the cells acquire a spindle-shaped fibroblast-like morphology.
Figure 1

Equine ADSCs at phase-contrast microscope. (a) Equine ADSCs at p0. (b) Equine ADSCs at p3.

3.2. Equine ADSCs Labeling and Seeding on Endometrial Tissues

In order to verify if equine ADSCs could be able to infiltrate the endometrial tissue, we treated in vitro endometrial biopsies with ADSCs previously labeled with quantum dots. Equine ADSCs labeled at p3 show a well distribution of quantum dots nanocrystals in vesicles in the cytoplasm (Figure 2), thus suggesting the efficacy of the method for tracking the ADSCs seeded on the endometrial tissues.
Figure 2

Equine ADSCs at fluorescence microscope. Equine ADSCs at p3 stained with quantum dots (red) and Hoechst 33342 (blue).

The presence of fluorescent labeled ADSCs cultivated on endometrial tissue from both healthy and pathological mares has been observed after 3 days from seeding. As reported in Figures 3(a) and 3(b), the equine ADSCs were detected in both of the tissues, although in major quantity in the pathological samples. Furthermore, in the endometriosis-affected tissues, the labeled ADSCs were infiltrated in the periglandular space as well as in single glands. Hematoxylin and eosin staining of the endometrial tissues before ADSCs seeding confirms the different morphological structure between the healthy and the pathological tissues (Figures 3(c) and 3(d)), along with an evident inflammatory condition in the latter.
Figure 3

Equine endometrial biopsy from (a, c) healthy and (b, d) pathological mares incubated 3 days with equine ADSCs. (a, b) Fluorescent imaging of equine ADSCs labeled with quantum dots (red); nuclei stained with Hoechst 33342 (blue). (c, d) Hematoxylin and eosin staining of ADSCs-seeded healthy and pathological endometrial tissues.

3.3. Gene Expression of Inflammatory Factors before and after ADSCs Seeding

Endometriosis in mares is a degenerative process characterized by epithelial and stromal alterations and fibrosis. Although the disease is well-known and causes severe consequences such as early embryo death, contradictory hypotheses have been made around its etiology, the more supported being a malfunctioning of the immune system and a dysregulation of the inflammatory processes [16]. In order to test this hypothesis, the expression of different cytokines and MMPs has been evaluated in pathological in comparison to healthy endometrial tissues (Figure 4). Basal expression of interleukin 1 beta (IL1B), interleukin 6 (IL6), interleukin 8 (IL8), interleukin 10 (IL10), tumor necrosis factor alpha (TNFA), and MMP9 was strong in pathologic samples compared to healthy endometrial tissue and particularly significant for IL10 (P = 0.02) and TNFA (P = 0.003). These results confirmed the observations made by Fumuso et al. [27, 28] and Feghali and Wright [29] regarding a higher expression of IL1B, IL8, and TNFA in endometriosis. Conversely, the higher expression of IL6 and IL10 in pathologic samples contrasted with previous observations, where a low level of IL6 was thought to be associated with an increased risk of the development of endometriosis and high levels of IL10 were auspicated in consideration of its anti-inflammatory properties [27, 28]. Interleukin 1 receptor antagonist (IL1RN) expression levels were lower in pathologic endometrium compared to healthy tissue, confirming its role as a protective factor [17, 30]. MMPs expression levels gave contradictory results, as MMP2 and MMP14 were detected at lower levels in pathologic endometrium, whereas MMP9 was much higher when compared to healthy tissue values. TIMP2 expression followed the MMP2 and MMP14 trend. These discrepancies suggest that a profound dysregulation is active in endometriosis, leading to ECM accumulation and glandular fibrosis [12].
Figure 4

Gene expression levels (R) of cytokines and MMPs in pathological endometrial tissues (black) compared to healthy endometrial tissues (grey) before ADSCs seeding.

In order to evaluate the effects of ADSCs seeding on endometrial tissue of healthy and pathological mares, the expression pattern of the same panel of inflammatory secretory factors has been analyzed (Figures 5(a) and 5(b)). The profile obtained from equine endometrial tissues after the treatment with allogenic ADSCs showed a general reduction for expression levels of IL1B, IL10, TNFA, and IL1RN and an increase of expression levels of IL6 and IL8 in both groups. These results suggest both positive and negative effects of equine ADSCs on the inflammatory processes regulation in the endometrium, as a reduction in IL1B and TNFA is auspicious to downregulate chronic inflammatory processes [29], whereas high levels of IL10 and IL1RN are desirable in consideration of their anti-inflammatory properties [17, 28]. A recent study showed contrasting effects for IL6 in the inflammatory process, being related to the recruitment of neutrophils in the early inflammatory phase while inducing neutrophils apoptosis and monocyte phagocytic properties in the late stages [31]. Another cytokine which showed an increased expression rate in both groups after ADSCs seeding was IL8. In consideration of its proinflammatory activity, the effect could be potentially negative in the treatment of endometriosis.
Figure 5

Gene expression profile of cytokines and MMPs after seeding of equine ADSCs in (a) healthy endometrial tissues and (b) pathological endometrial tissues. The results are expressed as ratio (R) with respect to mRNA expression of endometrial tissue without ADSCs.

Regarding MMPs and their inhibitors, the expression of MMP2 and TIMP2 decreased, whereas expression levels of MMP9 increased in both pathological and healthy endometrial tissues after ADSCs seeding. As far as MMPs are concerned, the reduced expression of MMP2 after ADSCs culture should have a positive effect in treating endometriosis [12, 19, 21]. The positive effect comprises also the increased expression of MMP9 in both groups. In fact, previous observations made by Aresu et al. [12] detected a standard expression of MMP9 in endometriosis, hypothesizing a positive role coming from an increased activity of tissue remodeling [21]. However we must notice that our pathologic samples already showed a higher expression of MMP9 compared to healthy ones. MMP14 expression levels increased only in healthy tissues. MMP14 can degrade different matrix components and activate other MMPs, in particular MMP2 and MMP9 [12]. Furthermore, TIMPs can influence all MMPs-related processes. Little is published regarding TIMP2 expression in mares' endometriosis [12], but studies on human hepatic fibrosis proved that the recovery phase is characterized by a decrease of TIMP2 expression levels [21].

4. Conclusions

All things considered, in the present work we could not detect a clear potential clinical effect of ADSCs on equine endometriosis. The balance between pro- and anti-inflammatory, lytic, and fibrotic environment is very subtle, and many actors are involved in the scene, providing a complex pattern of interactions to consider when trying to influence biologic processes. Nevertheless, we highlighted important differences in the biologic response of endometrial tissue to the exposure to ADSCs, challenging researchers to progress forward with future studies hopefully for the development of a biological therapy in clinical trials.
  30 in total

1.  Uterine clearance and resistance to persistent endometritis in the mare.

Authors:  M H Troedsson
Journal:  Theriogenology       Date:  1999-08       Impact factor: 2.740

Review 2.  Quantum dots as cellular probes.

Authors:  A Paul Alivisatos; Weiwei Gu; Carolyn Larabell
Journal:  Annu Rev Biomed Eng       Date:  2005       Impact factor: 9.590

3.  Immune parameters in mares resistant and susceptible to persistent post-breeding endometritis: effects of immunomodulation.

Authors:  Elida Ana Fumuso; Javier Aguilar; Steeve Giguère; Margarita Rivulgo; José Wade; Dragan Rogan
Journal:  Vet Immunol Immunopathol       Date:  2007-05-03       Impact factor: 2.046

4.  Human mesenchymal stem cells promote survival of T cells in a quiescent state.

Authors:  Federica Benvenuto; Stefania Ferrari; Ezio Gerdoni; Francesca Gualandi; Francesco Frassoni; Vito Pistoia; Gianluigi Mancardi; Antonio Uccelli
Journal:  Stem Cells       Date:  2007-03-29       Impact factor: 6.277

5.  A novel strategy of mesenchymal stem cells delivery in the uterus of mares with endometrosis.

Authors:  L I Mambelli; G H Z Winter; A Kerkis; E Malschitzky; R C Mattos; I Kerkis
Journal:  Theriogenology       Date:  2012-12-25       Impact factor: 2.740

6.  Dynamics of prostaglandin secretion, intrauterine fluid and uterine clearance in reproductively normal mares and mares with delayed uterine clearance.

Authors:  M E Cadario; W W Thatcher; E Klapstein; A M Merrit; L F Archbald; M J Thatcher; M M LeBlanc
Journal:  Theriogenology       Date:  1999-11       Impact factor: 2.740

7.  Matrix metalloproteinase 2 (MMP-2) and tissue transglutaminase (TG 2) are expressed in periglandular fibrosis in horse mares with endometrosis.

Authors:  I Walter; J Handler; I Miller; C Aurich
Journal:  Histol Histopathol       Date:  2005-10       Impact factor: 2.303

8.  Effect of sperm numbers and concentration on sperm transport and uterine inflammatory response in the mare.

Authors:  Sandra Mara Fiala; Cláudio Alves Pimentel; Ana Luiza Gelpi Mattos; Ricardo Macedo Gregory; Rodrigo Costa Mattos
Journal:  Theriogenology       Date:  2006-10-10       Impact factor: 2.740

Review 9.  The interleukin-1 system and female reproduction.

Authors:  N Gérard; M Caillaud; A Martoriati; G Goudet; A-C Lalmanach
Journal:  J Endocrinol       Date:  2004-02       Impact factor: 4.286

10.  Degenerative endometrial changes do not change the functional capacity of immigrating uterine neutrophils in mares.

Authors:  H Zerbe; F Engelke; E Klug; H-A Schoon; W Leibold
Journal:  Reprod Domest Anim       Date:  2004-04       Impact factor: 2.005

View more
  8 in total

1.  The Fate of Autologous Endometrial Mesenchymal Stromal Cells After Application in the Healthy Equine Uterus.

Authors:  B Elisabeth Rink; Teresa Beyer; Hilari M French; Elaine Watson; Christine Aurich; F Xavier Donadeu
Journal:  Stem Cells Dev       Date:  2018-06-29       Impact factor: 3.272

2.  Growth and function of equine endothelial colony forming cells labeled with semiconductor quantum dots.

Authors:  Randolph L Winter; Wen J Seeto; Yuan Tian; Fred J Caldwell; Elizabeth A Lipke; Anne A Wooldridge
Journal:  BMC Vet Res       Date:  2018-08-23       Impact factor: 2.741

3.  Adipose micro-grafts enhance tendinopathy healing in ovine model: An in vivo experimental perspective study.

Authors:  Angela Palumbo Piccionello; Valentina Riccio; Letizia Senesi; Antonella Volta; Luca Pennasilico; Riccardo Botto; Giacomo Rossi; Adolfo Maria Tambella; Livio Galosi; Carlotta Marini; Cecilia Vullo; Antonio Gigante; Barbara Zavan; Francesco De Francesco; Michele Riccio
Journal:  Stem Cells Transl Med       Date:  2021-08-16       Impact factor: 6.940

Review 4.  Pre-conditioning Strategies for Mesenchymal Stromal/Stem Cells in Inflammatory Conditions of Livestock Species.

Authors:  Benjamin Uberti; Anita Plaza; Claudio Henríquez
Journal:  Front Vet Sci       Date:  2022-03-16

5.  Metallopeptidades 2 and 9 genes epigenetically modulate equine endometrial fibrosis.

Authors:  Joana Alpoim-Moreira; Carina Fernandes; Jorge Pimenta; Miguel Bliebernicht; Maria Rosa Rebordão; Pedro Castelo-Branco; Anna Szóstek-Mioduchowska; Dariusz J Skarzynski; Graça Ferreira-Dias
Journal:  Front Vet Sci       Date:  2022-08-12

Review 6.  Adipose-Derived Stromal/Stem Cells from Large Animal Models: from Basic to Applied Science.

Authors:  Joanna Bukowska; Anna Zuzanna Szóstek-Mioduchowska; Marta Kopcewicz; Katarzyna Walendzik; Sylwia Machcińska; Barbara Gawrońska-Kozak
Journal:  Stem Cell Rev Rep       Date:  2020-10-06       Impact factor: 5.739

7.  Proteome Profiling of Membrane-Free Stem Cell Components by Nano-LS/MS Analysis and Its Anti-Inflammatory Activity.

Authors:  Venu Venkatarame Gowda Saralamma; Preethi Vetrivel; Seong Min Kim; Sang Eun Ha; Ho Jeong Lee; Sang Joon Lee; Young Sil Kim; Jung Eun Pak; Hye Jin Lee; Jeong Doo Heo; Gon Sup Kim
Journal:  Evid Based Complement Alternat Med       Date:  2019-11-04       Impact factor: 2.629

Review 8.  The Usefulness of Mesenchymal Stem Cells beyond the Musculoskeletal System in Horses.

Authors:  Alina Cequier; Carmen Sanz; Clementina Rodellar; Laura Barrachina
Journal:  Animals (Basel)       Date:  2021-03-25       Impact factor: 2.752

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.