Literature DB >> 26177720

Orai/CRACM1 and KCa3.1 ion channels interact in the human lung mast cell plasma membrane.

S Mark Duffy1, Ian Ashmole1, Dawn T Smallwood1, Mark L Leyland2, Peter Bradding3,4.   

Abstract

BACKGROUND: Orai/CRACM1 ion channels provide the major Ca(2+) influx pathway for FcεRI-dependent human lung mast cell (HLMC) mediator release. The Ca(2+)-activated K(+) channel KCa3.1 modulates Ca(2+) influx and the secretory response through hyperpolarisation of the plasma membrane. We hypothesised that there is a close functional and spatiotemporal interaction between these Ca(2+)- and K(+)-selective channels.
RESULTS: Activation of FcεRI-dependent HLMC KCa3.1 currents was dependent on the presence of extracellular Ca(2+), and attenuated in the presence of the selective Orai blocker GSK-7975A. Currents elicited by the KCa3.1 opener 1-EBIO were also attenuated by GSK-7975A. The Orai1 E106Q dominant-negative mutant ablated 1-EBIO and FcεRI-dependent KCa3.1 currents in HLMCs. Orai1 but not Orai2 was shown to co-immunoprecipitate with KCa3.1 when overexpressed in HEK293 cells, and Orai1 and KCa3.1 were seen to co-localise in the HEK293 plasma membrane using confocal microscopy.
CONCLUSION: KCa3.1 activation in HLMCs is highly dependent on Ca(2+) influx through Orai1 channels, mediated via a close spatiotemporal interaction between the two channels.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26177720      PMCID: PMC4504158          DOI: 10.1186/s12964-015-0112-z

Source DB:  PubMed          Journal:  Cell Commun Signal        ISSN: 1478-811X            Impact factor:   5.712


Background

The aberrant activation of mast cells via the high affinity IgE receptor FcεRI results in the release of preformed granule-derived mediators such as histamine and tryptase, the synthesis and release of lipid mediators such as leukotriene (LT)C4 and prostaglandin (PG)D2, and the generation of numerous cytokines, including IL-4, IL-5 and IL-13 [1]. This process contributes to the pathophysiology of allergic diseases such as asthma, rhinitis, urticaria and anaphylaxis [1]. The influx of extracellular Ca2+ is an essential requirement for the FcεRI-dependent release of mast cell mediators [2]. Members of the recently discovered Orai (also known as CRACM) ion channel family provide the major pathway for this influx in both rodent and human lung mast cells (HLMCs) [3-5]. These channels carry Ca2+ selective currents (ICRAC) that are activated when endoplasmic reticulum (ER) Ca2+ stores are emptied. The family contains three members Orai1, Orai2 and Orai3 [6, 7]. They show a high degree of sequence homology but have distinct functional properties [6, 7]. The channel pore is contained within the Orai channel subunit [8-11]. An ER membrane protein, STIM1, acts as the sensor of the ER Ca2+ concentration and transmits this information to the channel pore [12]. Human and rodent mast cells express all three Orai subunits at the mRNA level, although Orai1 is the dominant channel which is activated following cross-linking of FcεRI [3-5]. In HLMCs pharmacological block of Orai channels reduces Ca2+ influx, degranulation, LTC4 release and cytokine secretion [3]. Similarly, Ca2+ influx, degranulation, LTC4 release and TNFα production are all greatly reduced in foetal liver-derived mast cells from an Orai1 knockout mouse [4]. Both human and rodent mast cells also express functional intermediate conductance Ca2+ activated K+ channels (KCa3.1) [13-15]. In human mast cells KCa3.1 constitutes the major K+ selective conductance [13, 14]. KCa3.1 channels are activated in mast cells by a rise in the cytosolic free Ca2+ concentration following FcεRI-dependent activation. Calmodulin, which is tightly bound near the C-terminus of the KCa3.1subunit, acts as the Ca2+ sensor. The key consequence of KCa3.1 opening during cell activation is the hyperpolarisation of the cell membrane. This maintains the electrical driving force for Ca2+ influx through store operated channels such as Orai, and enhances Ca2+ influx through Orai channels because they are strongly inwardly rectifying and therefore conduct larger currents at negative membrane potentials [16]. Thus, activation of KCa3.1 channels using the KCa3.1 channel opener 1-ethyl-2-benzimidazolinone (1-EBIO) enhanced IgE-dependent Ca2+ influx and degranulation in HLMCs [14]. In contrast IgE-dependent Ca2+ influx and degranulation was significantly reduced in bone-marrow derived mast cells isolated from a KCa3.1 knockout mouse [15]. KCa3.1 has also been shown to be important for HLMC migration [17]. KCa3.1 channel activity disappears when extracellular Ca2+ is removed from cultured human mast cells that have been activated through FcεRI [13], and channel activity is not induced by several stimuli that release Ca2+ from intracellular stores but which do not stimulate Ca2+ influx [17]. In addition, KCa3.1 currents were not elicited in HLMCs activated by the Ca2+ ionophore A23187 [13]. This suggests that the activation of KCa3.1 channels by Ca2+ under physiological conditions relies on a tight spatiotemporal Ca2+ signal provide by Ca2+ influx channels. We therefore hypothesised that there is a close functional relationship between KCa3.1 and Orai channels in HLMCs, and that the two channels may interact physically to maintain tight spatiotemporal control of their activity. To test this hypothesis we have examined the effects of Orai channel inhibition in HLMCs on KCa3.1 channel activity and used co-immunoprecipitation and confocal microscopy to examine the physical interaction between KCa3.1 and Orai channels in co-transfected HEK293 cells.

Results

KCa3.1 requires extracellular Ca2+ for activation by FcεRI cross-linking in HLMCs

HLMC activation via FcεRI stimulates the release of Ca2+ from intracellular stores followed by the influx of extracellular Ca2+ through Orai channels. Influx of extracellular Ca2+ is essential for HLMC degranulation and lipid mediator synthesis [2]. We showed previously that KCa3.1 currents elicited in human mast cells by FcεRI-dependent activation disappear on removal of extracellular Ca2+, demonstrating the need for extracellular Ca2+ influx for the maintenance of KCa3.1 activity [13]. Here, activation of HLMCs by cross-linking FcεRI in the presence of extracellular Ca2+ evoked typical KCa3.1 currents as previously described in 81 % of cells studied, with a mean whole cell current at +40 mV in responding cells increasing from 6.8 ± 0.8 pA (reversal potential −31.4 ± 3.2 mV) at baseline to 75.6 ± 7.6 pA post anti-FcεRI (reversal potential −72.0 ± 9.3 mV) (n = 27 cells) (p < 0.0001 and p < 0.0001 for current and reversal potential respectively compared to baseline) (Fig. 1a). In contrast, in the absence of extracellular Ca2+, no KCa3.1 currents developed:current at +40 mV pre and post anti-FcεRI 4.5 ± 1.2 pA and 5.5 ± 1.1 pA respectively (p = 0.42), reversal potential pre and post anti-FcεRI −24.2 ± 1.8 mV and −22.0 ± 2.0 mV respectively (p = 0.71)(n = 9 cells)(Fig. 1b). Subsequent addition of extracellular Ca2+ (2 mM) to these cells following FcεRI-dependent activation induced only small KCa3.1 currents (11.0 ± 5.4 pA at +40 mV, p = 0.017 compared to no Ca2+) and a significant shift in reversal potential (−43.8 ± 7.4 mV, p = 0.015 compared to no Ca2+)(Fig. 1b). The small KCa3.1 currents seen here on subsequent addition Ca2+ here are in keeping with the known desensitisation of signalling pathways that occur when FcεRI is activated in the absence of extracellular Ca2+ [18, 19].
Fig. 1

FcεRI-dependent HLMC KCa3.1 currents require the presence of external Ca2+. a Current–voltage curves from HLMCs activated via FcεRI in the presence external Ca2+ (2 mM). b Current–voltage curves from HLMCs activated via FcεRI in the absence of external Ca2+. Typical KCa3.1 currents appear in the presence of Ca2+ (2 mM) but not when it is absent. Small KCa3.1 currents appear in (b) when Ca2+ is then introduced. Data presented as mean ± SEM

FcεRI-dependent HLMC KCa3.1 currents require the presence of external Ca2+. a Current–voltage curves from HLMCs activated via FcεRI in the presence external Ca2+ (2 mM). b Current–voltage curves from HLMCs activated via FcεRI in the absence of external Ca2+. Typical KCa3.1 currents appear in the presence of Ca2+ (2 mM) but not when it is absent. Small KCa3.1 currents appear in (b) when Ca2+ is then introduced. Data presented as mean ± SEM In summary, Ca2+ influx from the extracellular fluid is a critical requirement for the initial opening of KCa3.1 after FcεRI-dependent activation in HLMCs, as well as its maintenance following activation as described previously [13].

Orai channel block attenuates KCa3.1 activation

To assess whether Ca2+ influx through Orai channels contributes to KCa3.1 opening, we used the selective Orai channel blocker, GSK-7975A (a kind gift GlaxoSmithKline) [3, 20]. KCa3.1 currents elicited in response to FcεRI-dependent HLMC activation were significantly attenuated with the subsequent addition of 1 μM GSK-7975A, a concentration that suppresses Orai currents by >90 % in our hands [3] (Fig. 2a). Thus baseline whole cell currents of 6.8 ± 0.8 pA at +40 mV increased to 75.6 ± 7.6 pA post anti-FcεRI and were reduced to 40.9 ± 4.7 pA following addition of GSK-7975A (p < 0.0001, n = 27 cells). A small but significant positive shift in reversal potential was also evident with the addition of GSK-7975A (post anti-FcεRI −72.0 ± 9.3 mV, post GSK-7975A −61.3 ± 6.7 mV, p = 0.009) (Fig. 2a).
Fig. 2

FcεRI- and 1-EBIO-dependent HLMC KCa3.1 currents are attenuated by an Orai channel blocker. a KCa3.1 currents induced following FcεRI-dependent activation are attenuated in HLMCs following addition of the Orai channel blocker GSK-7975A (n = 27 cells). b KCa3.1 currents induced following 1-EBIO-dependent activation are attenuated following addition of the Orai channel blocker GSK-7975A (n = 29 cells). Data presented as mean ± SEM. c Overexpressed KCa3.1 channels in HLMCs were constitutively active and were not blocked by GSK-7975A (1 μM)(n = 4 cells, p = 0.43 at +40 mV)

FcεRI- and 1-EBIO-dependent HLMC KCa3.1 currents are attenuated by an Orai channel blocker. a KCa3.1 currents induced following FcεRI-dependent activation are attenuated in HLMCs following addition of the Orai channel blocker GSK-7975A (n = 27 cells). b KCa3.1 currents induced following 1-EBIO-dependent activation are attenuated following addition of the Orai channel blocker GSK-7975A (n = 29 cells). Data presented as mean ± SEM. c Overexpressed KCa3.1 channels in HLMCs were constitutively active and were not blocked by GSK-7975A (1 μM)(n = 4 cells, p = 0.43 at +40 mV) 1-EBIO opens KCa3.1 by enhancing its sensitivity to [Ca2+]i. Thus at 100 μM EBIO, maximal K+ currents are achieved in the presence of 100 nM free Ca2+ [21], which is below the resting [Ca2+]i of most cell types including HLMCs [14]. Interestingly, 1-EBIO-dependent KCa3.1 currents were also attenuated although to a lesser degree by GSK-7975A (Fig. 2b). Thus baseline whole cell currents of 7.4 ± 0.8 pA at +40 mV increased to 76.8 ± 8.8 pA post 1-EBIO, and were reduced to 59.4 ± 7.2 pA following addition of GSK-7975A (p < 0.0001, n = 29 cells). The reduction in KCa3.1 current induced by GSK-7975A following FcεRI-dependent HLMC activation was significantly greater than following 1-EBIO-dependent KCa3.1 activation (p = 0.039). To confirm that GSK-7975A does not directly block KCa3.1 currents, GFP-KCa3.1 was overexpressed in HLMCs. This generated large (nA) constitutively active KCa3.1 currents that were not blocked by GSK-7975A (1 μM)(Fig. 2c).

The Orai1 E106Q dominant-negative mutant ablates KCa3.1 currents

To further investigate the role of Orai channels in the regulation of KCa3.1 in HLMCs, the effect of a dominant-negative mutant of Orai1 (E106Q) was assessed [5]. While 7/7 GFP-transduced control HLMCs expressed robust KCa3.1 currents following exposure to 1-EBIO (net current at +40 mV 40.9 ± 19.5 pA, n = 7 cells), no KCa3.1 currents could be elicited in cells transduced with Orai1-E106Q (net current at +40 mV −1.1 pA, n = 6 cells, p = 0.04 compared to GFP) (Fig. 3a and b).
Fig. 3

FcεRI- and 1-EBIO-dependent HLMC KCa3.1 currents are inhibited by expression of an Orai1-E106Q dominant-negative mutant. Transduction of HLMCs with an Orai1-E106Q dominant-negative mutant ablated (a) 1-EBIO- dependent and (b) FcεRI-dependent KCa3.1 currents. For clarity, data are presented as the subtracted net activation-dependent currents (activation minus baseline) for each condition, expressed as mean ± SEM

FcεRI- and 1-EBIO-dependent HLMC KCa3.1 currents are inhibited by expression of an Orai1-E106Q dominant-negative mutant. Transduction of HLMCs with an Orai1-E106Q dominant-negative mutant ablated (a) 1-EBIO- dependent and (b) FcεRI-dependent KCa3.1 currents. For clarity, data are presented as the subtracted net activation-dependent currents (activation minus baseline) for each condition, expressed as mean ± SEM Similarly 8/8 GFP-transduced control HLMCs expressed robust KCa3.1 currents following exposure to anti-FcεRI (net current at +40 mV 121.6 ± 34.2 pA, n = 8 cells), but no FcεRI-dependent KCa3.1 currents could be elicited in cells transduced with Orai1-E106Q (net current at +40 mV 4.1 ± 3.2 pA, n = 9 cells, p = 0.0023 compared to GFP)(Fig. 3b).

Orai1 but not Orai2 co-immunoprecipitates with KCa3.1

The proposed functional interaction between Orai and KCa3.1 channels in HLMCs led us to investigate whether these channels interact physically. We therefore expressed myc epitope-tagged Orai1 and Orai2 and FLAG epitope-tagged KCa3.1 in HEK293 cells and tested for potential interactions by co-immunoprecipitation. Expression of epitope tagged channels was confirmed by Western blotting using antibodies raised against the appropriate epitope tag (Fig. 4a). Multiple bands were observed on blotting for KCa3.1-FLAG protein using an anti-FLAG antibody, with band sizes of 48 kDa (the predicted size of KCa3.1), and less. A similar band pattern has recently been observed on Western blotting for KCa3.1 in human fibrocytes, lung fibroblasts and airway smooth muscle cells, and may reflect differential splicing modification [22-24]. When an anti c-myc antibody was used to immunoprecipitate Orai1-myc protein, KCa3.1-FLAG was found to be co-immunoprecipitated (Fig. 4b). Co-immunoprecipitation of KCa3.1-FLAG was observed only from lysates of cells expressing both Orai1-myc and KCa3.1-FLAG proteins. Similarly when an anti-FLAG antibody was used to immunoprecipitate KCa3.1-FLAG protein, Orai1-myc protein was co-immunoprecipitated (Fig. 4c). Again co-immunoprecipitation was dependent on co-expression of both proteins in HEK293 cells.
Fig. 4

Orai1 and KCa3.1 proteins co-immunoprecipitate. a Western blots using either an antibody recognising the myc epitope (left) or an antibody recognising the FLAG epitope (right) of HEK293 cell lysates. Lysates expressed either myc epitope tagged Orai1, FLAG epitope-tagged KCa3.1, or both as indicated in the panel above. b Lysates of HEK293 cells expressing the indicated proteins were immunoprecipitated with an anti-myc antibody. Immunoprecipitates were then Western blotted using either an anti-Orai1 antibody (left) or an anti-FLAG antibody (right). c As (b) except cell lysates were immunoprecipitated with an anti-FLAG antibody and then Western blotted with an anti-FLAG antibody (left) or an anti-myc antibody (right). Blots shown are representative of 3 independent experiments

Orai1 and KCa3.1 proteins co-immunoprecipitate. a Western blots using either an antibody recognising the myc epitope (left) or an antibody recognising the FLAG epitope (right) of HEK293 cell lysates. Lysates expressed either myc epitope tagged Orai1, FLAG epitope-tagged KCa3.1, or both as indicated in the panel above. b Lysates of HEK293 cells expressing the indicated proteins were immunoprecipitated with an anti-myc antibody. Immunoprecipitates were then Western blotted using either an anti-Orai1 antibody (left) or an anti-FLAG antibody (right). c As (b) except cell lysates were immunoprecipitated with an anti-FLAG antibody and then Western blotted with an anti-FLAG antibody (left) or an anti-myc antibody (right). Blots shown are representative of 3 independent experiments In contrast, under identical reaction conditions, no co-immunoprecipitation of KCa3.1-FLAG protein was observed when the anti c-myc antibody was used to immunoprecipitate Orai2-myc protein (Fig. 5a and b). Similarly in the reverse experiment using the anti-FLAG antibody to immunoprecipitate KCa3.1-FLAG, no Orai2-myc protein was co-immunoprecipitated (Fig. 5c). We were unable to test for Orai3-myc and KCa3.1-FLAG co-immunoprecipitation, since we were unable to satisfactorily demonstrate co-expression of Orai3-myc and KCa3.1-FLAG protein in HEK293 cells (data not shown).
Fig. 5

Orai2 and KCa3.1 proteins do not co-immunoprecipitate under the conditions used to co-immunoprecipitate Orai1 and KCa3.1. a Western blots using either an antibody recognising the myc epitope (left) or an antibody recognising the FLAG epitope (right) of HEK293 cell lysates. Lysates expressed either myc epitope tagged Orai2, FLAG epitope-tagged KCa3.1, or both as indicated in the panel above. b HEK293 cell lysates expressing the proteins indicated in the panel above were immunoprecipitated with an anti-myc antibody. Immunoprecipitates were then Western blotted using either an anti-Orai2 antibody (left) or an anti-FLAG antibody (right). Control HEK293 cell lysate expressing KCa3.1-FLAG protein. c As (b) except cell lysates were immunoprecipitated with an anti-FLAG antibody and then Western blotted with an anti-Orai2 antibody (left) or an anti-FLAG antibody (right). Control HEK293 cell lysate expressing Orai2-myc protein. Blots shown are representative of 3 independent experiments

Orai2 and KCa3.1 proteins do not co-immunoprecipitate under the conditions used to co-immunoprecipitate Orai1 and KCa3.1. a Western blots using either an antibody recognising the myc epitope (left) or an antibody recognising the FLAG epitope (right) of HEK293 cell lysates. Lysates expressed either myc epitope tagged Orai2, FLAG epitope-tagged KCa3.1, or both as indicated in the panel above. b HEK293 cell lysates expressing the proteins indicated in the panel above were immunoprecipitated with an anti-myc antibody. Immunoprecipitates were then Western blotted using either an anti-Orai2 antibody (left) or an anti-FLAG antibody (right). Control HEK293 cell lysate expressing KCa3.1-FLAG protein. c As (b) except cell lysates were immunoprecipitated with an anti-FLAG antibody and then Western blotted with an anti-Orai2 antibody (left) or an anti-FLAG antibody (right). Control HEK293 cell lysate expressing Orai2-myc protein. Blots shown are representative of 3 independent experiments

Orai1 and KCa3.1 co-localise in the plasma membrane of HEK-293 cells

To assess whether Orai1 and KCa3.1 co-localise in plasma membranes, we dually transfected HEK-293 with FLAG-tagged KCa3.1and myc-tagged Orai1 or Orai2 (HLMCs cannot be transfected efficiently). Subsequent analysis of the immunostained tags using confocal microscopy showed clear co-localisation of Orai1 and KCa3.1 in the HEK293 plasma membrane (Fig. 6a and b), but minimal co-localisation of KCa3.1 with Orai2 (Fig. 6c and d).
Fig. 6

Orai1 and KCa3.1 co-localise in the plasma membrane. a HEK293 cells, dually transfected with FLAG-tagged KCa3.1 and myc-tagged Orai1 and then immunostained, show co-localisation in the plasma membrane by single plane confocal microscopy (top panels). Dually transfected HEK293 show negative staining for appropriate isotype controls (bottom panels): rabbit IgG control, dual stained with anti-myc, and mouse IgG1 control dual stained with anti-FLAG. b Fluorescence intensity plot shows increased fluorescence at the plasma membrane. myc-Orai1 is shown in green and FLAG-KCa3.1 in red. Arrows indicate increased fluorescence where the region of interest (ROI) intersects the plasma membrane. c HEK293 cells, dually transfected with FLAG-tagged KCa3.1 and myc-tagged Orai2 and then immunostained, show poor co-localisation in the plasma membrane by single plane confocal microscopy (top panels). Dually transfected HEK293 show negative staining for appropriate isotype controls (bottom panels): rabbit IgG control, dual stained with anti-myc, and mouse IgG1 control dual stained with anti-FLAG. d Fluorescence intensity plot shows poor co-localisation of KCa3.1 and Orai2 signals. myc-Orai2 is shown in green and FLAG-KCa3.1 in red. Scale bars are 10 μm

Orai1 and KCa3.1 co-localise in the plasma membrane. a HEK293 cells, dually transfected with FLAG-tagged KCa3.1 and myc-tagged Orai1 and then immunostained, show co-localisation in the plasma membrane by single plane confocal microscopy (top panels). Dually transfected HEK293 show negative staining for appropriate isotype controls (bottom panels): rabbit IgG control, dual stained with anti-myc, and mouse IgG1 control dual stained with anti-FLAG. b Fluorescence intensity plot shows increased fluorescence at the plasma membrane. myc-Orai1 is shown in green and FLAG-KCa3.1 in red. Arrows indicate increased fluorescence where the region of interest (ROI) intersects the plasma membrane. c HEK293 cells, dually transfected with FLAG-tagged KCa3.1 and myc-tagged Orai2 and then immunostained, show poor co-localisation in the plasma membrane by single plane confocal microscopy (top panels). Dually transfected HEK293 show negative staining for appropriate isotype controls (bottom panels): rabbit IgG control, dual stained with anti-myc, and mouse IgG1 control dual stained with anti-FLAG. d Fluorescence intensity plot shows poor co-localisation of KCa3.1 and Orai2 signals. myc-Orai2 is shown in green and FLAG-KCa3.1 in red. Scale bars are 10 μm

Discussion

The release of mast cell mediators following cell activation requires the influx of extracellular Ca2+. We and others have shown that members of the Orai channel family play a major role in this Ca2+ influx in both human and rodent mast cells [3, 4]. The intermediate conductance Ca2+ activated K+ channel KCa3.1 is also a key regulator of Ca2+ influx into mast cells [13-15], as activated KCa3.1 channels maintain the driving force for Ca2+ entry by hyperpolarising the plasma membrane. Here we show for the first time that KCa3.1 activation has an obligate dependency on Ca2+ influx through Orai1 channels, which appears to be mediated via an intimate spatiotemporal interaction. We have demonstrated previously that KCa3.1 opens in HLMCs following FcεRI-dependent activation, disappears on removal of extracellular Ca2+, and does not open after stimulation with other agonists which globally raise intracellular Ca2+ in HLMCs such as chemokines, PAF, LPA and the Ca2+ ionophore A23187 [13, 17, 25]. This suggested that tight Ca2+ microdomains regulate KCa3.1 activity. Here we found that activation of FcεRI-dependent KCa3.1 currents required the presence of extracellular Ca2+, were attenuated by a selective Orai channel blocker, and were ablated by transduction of a dominant-negative Orai1 mutant. This implies that Ca2+ engages KCa3.1 at the point of entry through Orai channels. The ability of KCa3.1 to co-immunoprecipitate and co-localise with Orai1, the dominant Orai channel in HLMCs, suggests the presence of a tight Orai1-KCa3.1 signalplex in the HLMC plasma membrane. It is perhaps surprising that Orai1 interacted physically with KCa3.1 but Orai2 did not. However, Orai1 contains a C-terminal SHYA sequence which may act as a PDZ binding site. Although it does not conform to the class II or class III binding sites which are characterised by X-Hydrophobic-X-Hydrophobic or X-Neg charged-X-V/I/A, there is variation and other sequences will bind as well. If this is a PDZ binding site, then there is the potential for KCa3.1 and Orai1 to form part of a macromolecular complex organised by PDZ-containing scaffolding proteins. Orai1also interacts with TRPC family channels via a direct physical interaction at the N- and C-termini, but this is also true for Orai2 and Orai3 [26], so it seems unlikely that this is the mechanism mediating the interaction of Orai1 with KCa3.1. However, the N-terminus of Orai1 but not Orai3 forms a membrane-delimited signalplex with NFAT via the scaffolding protein AKAP79 [27]. Further work will be required to establish the exact mechanism of the KCa3.1-Orai1 interaction. Orai1 currents are only activated following store depletion by STIM1, and our data do not directly address whether STIM1 plays a role in the co-regulation of Orai1 and KCa3.1. However, the co-immunoprecipitation and confocal imaging experiments were performed in resting cells following over-expression, while the functional interaction is evident in lung mast cells following IgE-dependent activation, so it is likely that the interaction occurs independently of Ca2+ store depletion. This would be in keeping with previous studies showing that another Ca2+ activated K+ channel, KCa1.1 (bKCa), forms a signalling complex consisting of the β2-adrenoreceptor, the L-type calcium channel Cav1.2 and the A-kinase anchoring proteins AKAP79 and AKAP150 [28]. The Ca2+required for activation of KCa1.1 is provided by voltage-gated Ca2+ channels, either Cav1.2, Cav2.1 or Cav2.2 [29]. There is also limited evidence that KCa3.1 may form a signalplex with the β2-adrenoreceptor [30], so it will be interesting to assess whether a similar complex utilises KCa3.1 and Orai1. A close association of KCa1.1 with voltage-gated Ca2+ channels is thought to be necessary because activation requires a relatively high intracellular Ca2+ concentration of 10 μM or more. Such concentrations are thought only to be found in so called Ca2+ nanodomains in the immediate vicinity of the open Cav channels. In contrast, KCa3.1 has a far higher affinity for Ca2+, with a value for half maximal activation (EC50) of approximately 0.3 μM [31]. This high affinity has been considered to obviate the requirement for a close interaction with a Ca2+ source [32]. However, it is clear that if KCa3.1 is coupled closely to a particular Ca2+ entry pathway and signalplex, there will be greater sensitivity and specificity with regards to KCa3.1 channel activation. Furthermore, Orai channels have a very low single channel conductance, estimated to be more than 100-fold lower than for voltage-gated Ca2+ channels [33, 34]. As a consequence the increase in Ca2+ concentration in the vicinity of an open Orai channel is likely to be relatively small. In mast cells the Ca2+ concentration has been estimated to be of the order of 2 μM at a distance of 10 nm from an open Orai channel, falling steeply with increasing distance [35]. While clustering of (open) Orai channels in mast cells would lead to considerably higher local Ca2+concentrations, a close association of Orai1 with KCa3.1 in mast cells may therefore be required to ensure efficient activation of KCa3.1 channels and so regulation of Ca2+ influx. The importance of Ca2+ microdomains for the regulation of specific Ca2+-dependent cell responses was highlighted recently by Parekh [35, 36]. For example there is evidence of distinct Orai channel signalling domains regulating the activity plasma membrane-associated enzymes such as Syk and cPLA2, and transcription factors such as NFAT [27, 37, 38]. A close KCa3.1-Orai1 interaction would therefore appear to make sense from several perspectives. The activation of KCa3.1 independently of global intracellular Ca2+ will fine-tune signals requiring Orai1 activation, with rapid and selective feedback ensuring that the Ca2+ signal is maintained, supporting Ca2+-dependent local membrane-associated signalling events. Furthermore, modulation of KCa3.1 by de-phosphorylation for example [39], or β2-adrenoceptor signalling [30], has the potential to feedback on Orai1 and limit Ca2+ entry. In resting cells where KCa3.1 and perhaps Orai1 expression may be relatively low [40], their co-localisation would ensure that efficient signalling could occur during an initial cell response. In addition, in cells expressing numerous KCa3.1 and Orai channels, there would be enhanced sensitivity to low grade stimuli, thus increasing the dynamic range, specificity and fidelity of the response to an external stimulus. It is also evident that KCa3.1 and Orai channels are localised to specific regions of activated cells. For example, localised KCa3.1 channel activity regulates shrinkage of the uropod in migrating cells even although the channels are distributed throughout the plasma membrane [41], while both Orai1 and KCa3.1 co-localise at the immunological synapse in activated T cells [42, 43]. Their ability to form a close physical interaction would ensure that they interact specifically in these regions. It is also clear that Orai1-3 have distinct physiological roles and electrophysiological characteristics [6, 44, 45]. A selective interaction between Orai1 and KCa3.1 would ensure that unwanted KCa3.1 activation does not occur in Orai2 or Orai3-dependent cell responses. The physiological relevance of this interpretation is supported by previous work in HLMCs. These cells express both Orai1 and Orai2 protein, but FcεRI-dependent degranulation and leukotriene release is driven largely by Orai1 [5].

Conclusions

There is a close spatio-temporal and functional interaction between KCa3.1 channels and Orai1 channels in HLMCs with evidence of a physical interaction leading to a restricted membrane-delimited signalplex. This is likely to facilitate the selective activation and fine-tuning of KCa3.1-Orai1-dependent cell processes.

Methods

Human mast cell purification and cell culture

HLMCs were purified from enzymatically dispersed healthy human lung obtained within one hour of surgery for lung cancer [46, 47]. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) containing 10 % foetal calf serum and 100 ng/ml stem cell factor, 50 ng/ml IL-6 and 10 ng/ml IL-10 as previously described [47]. All human subjects donating lung tissue gave written informed consent and the study was approved by the Leicestershire Research Ethics Committee. Final mast cell purity was >99 %. HEK293 cells were cultured in DMEM containing 10 % FCS.

Orai and KCa3.1 protein expression and co-immunoprecipitation

The construction of vectors directing the expression of c-Myc epitope-tagged Orai1 and Orai2 has been described previously [3]. Briefly full length Orai1 and −2 cDNAs were cloned in frame immediately following the c-Myc epitope tag in vector pCruz Myc (Santa Cruz Biotechnology Inc). For the expression of FLAG epitope tagged KCa3.1, a PCR fragment containing the entire human KCa3.1open reading frame (ORF), an EcoR1 site immediately adjacent to the ATG initiation codon and an Xho1 site immediately adjacent to the stop codon was cloned into the EcoR1/Xho1 sites of vector pcDNA3 (Invitrogen). The stop codon was then removed by site directed mutagenesis. Oligonucleotides 5′ TCGAGGACTACAAAGACGATGACGACAAGTAGC 3′ and 5′ TCGAGCTACTTGTCGTCATCGTCTTTGTAGTCC 3′ encoding the FLAG eiptope (DYKDDDDK) were annealed together and inserted at the Xho1 site of the mutant KCa3.1 construct. The resulting vector directs the expression of KCa3.1 with a FLAG epitope in frame with the last codon of the KCa3.1 ORF. The construct was verified by DNA sequencing. HEK293 cells were transiently transfected with vectors directing the expression of c-Myc epitope tagged Orai1 and −2 and/or FLAG epitope-tagged KCa3.1 using GeneJuice transfection reagent (Merck Bioscience Ltd). Cells were harvested for lysis 24 h later and lysed in a buffer containing 50 mM Tris pH8.0, 150 mM NaCl, 1 % Triton X-100 and a protease inhibitor cocktail (Sigma). Lysates were centrifuged at 13,200 rpm for 15 min at 4 °C and supernatants used for co-immunoprecipitation experiments. For the immunoprecipitation of Orai1 or Orai2, supernatants were pre-cleared with protein G-sepharose beads and then incubated with a mouse monoclonal anti-c-Myc antibody (clone 9E10, Sigma) for 16–18 h at 4 °C. Immune complexes were recovered by incubation with protein G-sepharose beads for 15 min at 4 °C and washed 5 times with lysis buffer. Immunoprecipitation of KCa3.1 was as above except rabbit polyclonal anti-FLAG antibody (Sigma) and protein A-agarose were used. Proteins were separated on 12 % Bis-Tris Nu-Page gels (Invitrogen) and then blotted onto polyvinylidene fluoride membranes. Membranes were blocked with 5 % nonfat milk in phosphate buffered saline. Blots were then probed with rabbit polyclonal antibodies recognising either Orai1 or Orai2 (both Alomone Labs Ltd) [3], anti-c-Myc antibody and/or anti-FLAG antibody as required. Blots were subsequently probed with Clean-Blot IP-horseradish peroxidase conjugate (Thermo Scientific). Immunoreactive bands were visualised using Pierce ECL Western Blotting Substrate (Fisher Scientific, Loughborough, United Kingdom). HLMCs were transduced with adenoviruses expressing Orai E106Q and GFP control as described previously [5]. HLMCs were also transduced with GFP-KCa3.1 using the same methodology.

Patch clamp electrophysiology

The whole-cell variant of the patch-clamp technique was used [3, 13]. Patch pipettes were made from borosilicate fibre-containing glass (Harvard Instruments, UK), and their tips were heat polished, typically resulting in resistances of 4–6 MΩ. The standard pipette solution contained (in mM): KCl (140), MgCl2 (2), HEPES (10), NaATP (2) GTP (0.1); pH 7.3 with KOH. The standard external solution contained (in mM), NaCl (140), KCl (5), CaCl2 (2), MgCl2 (1), HEPES (10) and glucose (5); pH 7.3 with NaOH. For recording, mast cells were placed in 35 mm dishes containing standard external solution. Whole cell currents were recorded using an Axoclamp 200A amplifier (Axon Instruments, Foster City, CA, USA), and currents usually evoked by applying voltage commands to a range of potentials in 10 mV steps from a holding potential of −20 mV. The currents were digitised (sampled at a frequency of 10 kHz), stored on computer and subsequently analysed using pClamp10 software (Axon Instruments). Capacitance transients were minimised using the capacitance neutralisation circuits on the amplifier. Correction for series resistance was not routinely applied. Experiments were performed at 27 °C, temperature being controlled by a Peltier device. Drugs were added directly to the recording chamber as required.

Confocal microscopy

HEK-293 cells (3×105) were seeded on 25 mm cover glasses and 24 h later dual-transfected with FLAG-tagged KCa3.1 and myc-tagged Orai1 or Orai2 using GeneJuice Transfection Reagent (Novagen). After 24 h, cells were methanol fixed and immunostained. The myc tag was detected with anti-myc 9E10 (gift from ADAS, Nottingham, UK) plus rabbit anti-mouse FITC (F0313, DAKO) alongside anti-mouse IgG1 (X0931, DAKO) isotype control. The FLAG tag was detected by anti-FLAG (F7425, Sigma) plus sheep anti-rabbit RPE (STAR35, AbD Serotec) alongside anti-rabbit IgG (550875, BD Pharmingen) isotype control. Fluorescence microscopy was performed using a Leica TCS SP5 confocal microscope and analysed with ImageJ software. Identical exposures were used for isotype controls.

Statistical analysis

Data were compared using paired or unpaired t test as appropriate. P < 0.05 was considered statistically significant.
  47 in total

1.  STIM1 is a Ca2+ sensor that activates CRAC channels and migrates from the Ca2+ store to the plasma membrane.

Authors:  Shenyuan L Zhang; Ying Yu; Jack Roos; J Ashot Kozak; Thomas J Deerinck; Mark H Ellisman; Kenneth A Stauderman; Michael D Cahalan
Journal:  Nature       Date:  2005-10-06       Impact factor: 49.962

2.  A human intermediate conductance calcium-activated potassium channel.

Authors:  T M Ishii; C Silvia; B Hirschberg; C T Bond; J P Adelman; J Maylie
Journal:  Proc Natl Acad Sci U S A       Date:  1997-10-14       Impact factor: 11.205

3.  Single L-type calcium channel conductance with physiological levels of calcium in chick ciliary ganglion neurons.

Authors:  P J Church; E F Stanley
Journal:  J Physiol       Date:  1996-10-01       Impact factor: 5.182

4.  Activation of the human intermediate-conductance Ca(2+)-activated K(+) channel by 1-ethyl-2-benzimidazolinone is strongly Ca(2+)-dependent.

Authors:  K A Pedersen; R L Schrøder; B Skaaning-Jensen; D Strøbaek; S P Olesen; P Christophersen
Journal:  Biochim Biophys Acta       Date:  1999-08-20

5.  Biochemical analysis of desensitization of mouse mast cells.

Authors:  T Ishizaka; A R Sterk; M Daeron; E L Becker; K Ishizaka
Journal:  J Immunol       Date:  1985-07       Impact factor: 5.422

6.  A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function.

Authors:  Stefan Feske; Yousang Gwack; Murali Prakriya; Sonal Srikanth; Sven-Holger Puppel; Bogdan Tanasa; Patrick G Hogan; Richard S Lewis; Mark Daly; Anjana Rao
Journal:  Nature       Date:  2006-04-02       Impact factor: 49.962

7.  Immunological stimulation of single rat basophilic leukemia RBL-2H3 cells co-activates Ca(2+)-entry and K(+)-channels.

Authors:  M Gericke; O Dar; G Droogmans; I Pecht; B Nilius
Journal:  Cell Calcium       Date:  1995-01       Impact factor: 6.817

8.  Mitogen-regulated Ca2+ current of T lymphocytes is activated by depletion of intracellular Ca2+ stores.

Authors:  A Zweifach; R S Lewis
Journal:  Proc Natl Acad Sci U S A       Date:  1993-07-01       Impact factor: 11.205

9.  Depletion of intracellular calcium stores activates a calcium current in mast cells.

Authors:  M Hoth; R Penner
Journal:  Nature       Date:  1992-01-23       Impact factor: 49.962

10.  Close functional coupling between Ca2+ release-activated Ca2+ channels, arachidonic acid release, and leukotriene C4 secretion.

Authors:  Wei-Chiao Chang; Anant B Parekh
Journal:  J Biol Chem       Date:  2004-05-07       Impact factor: 5.157

View more
  9 in total

Review 1.  K+ channel signaling in irradiated tumor cells.

Authors:  Benjamin Stegen; Lukas Klumpp; Milan Misovic; Lena Edalat; Marita Eckert; Dominik Klumpp; Peter Ruth; Stephan M Huber
Journal:  Eur Biophys J       Date:  2016-05-10       Impact factor: 1.733

Review 2.  CRAC channels in secretory epithelial cell function and disease.

Authors:  Haiping Liu; Ahmed Kabrah; Malini Ahuja; Shmuel Muallem
Journal:  Cell Calcium       Date:  2018-12-31       Impact factor: 6.817

Review 3.  Structure, Gating and Basic Functions of the Ca2+-activated K Channel of Intermediate Conductance.

Authors:  Luigi Sforna; Alfredo Megaro; Mauro Pessia; Fabio Franciolini; Luigi Catacuzzeno
Journal:  Curr Neuropharmacol       Date:  2018       Impact factor: 7.363

Review 4.  Molecular Choreography and Structure of Ca2+ Release-Activated Ca2+ (CRAC) and KCa2+ Channels and Their Relevance in Disease with Special Focus on Cancer.

Authors:  Adéla Tiffner; Isabella Derler
Journal:  Membranes (Basel)       Date:  2020-12-15

5.  Manipulations of Glutathione Metabolism Modulate IP3-Mediated Store-Operated Ca2+ Entry on Astroglioma Cell Line.

Authors:  Nawfel Mokrane; Yassin Snabi; Thierry Cens; Janique Guiramand; Pierre Charnet; Anaïs Bertaud; Claudine Menard; Matthieu Rousset; Marie-Céleste de Jesus Ferreira; Jean-Baptiste Thibaud; Catherine Cohen-Solal; Michel Vignes; Julien Roussel
Journal:  Front Aging Neurosci       Date:  2021-12-17       Impact factor: 5.750

6.  Investigating CFTR and KCa3.1 Protein/Protein Interactions.

Authors:  Hélène Klein; Asmahan Abu-Arish; Nguyen Thu Ngan Trinh; Yishan Luo; Paul W Wiseman; John W Hanrahan; Emmanuelle Brochiero; Rémy Sauvé
Journal:  PLoS One       Date:  2016-04-19       Impact factor: 3.240

Review 7.  Role of KCa3.1 Channels in Modulating Ca2+ Oscillations during Glioblastoma Cell Migration and Invasion.

Authors:  Luigi Catacuzzeno; Fabio Franciolini
Journal:  Int J Mol Sci       Date:  2018-09-29       Impact factor: 5.923

8.  Orai1 Boosts SK3 Channel Activation.

Authors:  Adéla Tiffner; Valentina Hopl; Romana Schober; Matthias Sallinger; Herwig Grabmayr; Carmen Höglinger; Marc Fahrner; Victoria Lunz; Lena Maltan; Irene Frischauf; Denis Krivic; Rajesh Bhardwaj; Rainer Schindl; Matthias A Hediger; Isabella Derler
Journal:  Cancers (Basel)       Date:  2021-12-17       Impact factor: 6.575

Review 9.  The Role of Lipids in CRAC Channel Function.

Authors:  Lena Maltan; Ana-Marija Andova; Isabella Derler
Journal:  Biomolecules       Date:  2022-02-23
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.