| Literature DB >> 26175726 |
Mónica N Alves1, Sónia E Neto1, Alexandra S Alves1, Bruno M Fonseca1, Afonso Carrêlo1, Isabel Pacheco1, Catarina M Paquete1, Cláudio M Soares1, Ricardo O Louro1.
Abstract
The versatile anaerobic metabolism of the Gram-negative bacterium Shewanella oneidensis MR-1 (SOMR-1) relies on a multitude of redox proteins found in its periplasm. Most are multiheme cytochromes that carry electrons to terminal reductases of insoluble electron acceptors located at the cell surface, or bona fide terminal reductases of soluble electron acceptors. In this study, the interaction network of several multiheme cytochromes was explored by a combination of NMR spectroscopy, activity assays followed by UV-visible spectroscopy and comparison of surface electrostatic potentials. From these data the small tetraheme cytochrome (STC) emerges as the main periplasmic redox shuttle in SOMR-1. It accepts electrons from CymA and distributes them to a number of terminal oxidoreductases involved in the respiration of various compounds. STC is also involved in the electron transfer pathway to reduce nitrite by interaction with the octaheme tetrathionate reductase (OTR), but not with cytochrome c nitrite reductase (ccNiR). In the main pathway leading the metal respiration STC pairs with flavocytochrome c (FccA), the other major periplasmic cytochrome, which provides redundancy in this important pathway. The data reveals that the two proteins compete for the binding site at the surface of MtrA, the decaheme cytochrome inserted on the periplasmic side of the MtrCAB-OmcA outer-membrane complex. However, this is not observed for the MtrA homologues. Indeed, neither STC nor FccA interact with MtrD, the best replacement for MtrA, and only STC is able to interact with the decaheme cytochrome DmsE of the outer-membrane complex DmsEFABGH. Overall, these results shown that STC plays a central role in the anaerobic respiratory metabolism of SOMR-1. Nonetheless, the trans-periplasmic electron transfer chain is functionally resilient as a consequence of redundancies that arise from the presence of alternative pathways that bypass/compete with STC.Entities:
Keywords: Shewanella oneidensis MR-1; dissociation constant; electron transfer; electrostatics; extracellular respiration; paramagnetic NMR; periplasmic cytochromes
Year: 2015 PMID: 26175726 PMCID: PMC4484225 DOI: 10.3389/fmicb.2015.00665
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Primers used in this study.
| Primer | Sequence (5′-3′) |
|---|---|
| DmsE_Stop_Forw | GCGGCAGCAATTTTGCCCGTTGAGGCGAGCTCAAGCTTGAAGGTAAGCC |
| DmsE_Stop_Rev | GGCTTACCTTCAAGCTTGAGCTCGCCTCAACGGGCAAAATTGCTGCCGC |
| MtrD_Stop_Forw | AAGTTGCTGCAGAGATAAGGCGAGCTCAAGCTTGA |
| MtrD_Stop_Rev | TCAAGCTTGAGCTCGCCTTATCTCTGCAGCAACTT |
| OTR_Stop_Forw | CACCTAAGAAGGAGATATACATCCCATGAA |
| OTR_Stop_Rev | TTATTGCTTATGTTTAGGGCCTTGTTTGTT |
Pairwise interactions tested for cytochromes found in the periplasm of SOMR-1.
| Cytochrome Complex | Kd (μM) | Docking Site |
|---|---|---|
| FccA and MtrA | 35 (14) | Heme II |
| FccA and DmsE | – | |
| FccA and MtrD | – | |
| FccA and OTR | – | |
| FccA and ccNiR | – | |
| STC and MtrA | 572 (5) | Heme IV |
| STC and DmsE | 783 (227) | Hemes II,III, and IV |
| STC and MtrD | – | |
| STC and OTR | 1600 (400) | Heme IV |
| STC and ccNiR | – | |
Sequence identity matrix for the periplasmic decaheme cytochromes from SOMR-1.
| MtrA | MtrD | DmsE | SO4360 | |
|---|---|---|---|---|
| MtrA | 100 | 72 | 69 | 54 |
| MtrD | ++ | 100 | 60 | 49 |
| DmsE | + | 100 | 51 | |
| SO4360 | - | 100 | ||