Molecular Prevalence of Acarapis Mite Infestations in Honey Bees in Korea.

Acarapis mites, including Acarapis woodi, Acarapis externus, and Acarapis dorsalis, are parasites of bees which can cause severe damage to the bee industry by destroying colonies and decreasing honey production. All 3 species are prevalent throughout many countries including UK, USA, Iran, Turkey, China, and Japan. Based on previous reports of Acarapis mites occurring in northeast Asia, including China and Japan, we investigated a survey of Acarapis mite infestations in honey bees in Korean apiaries. A total of 99 colonies of Apis mellifera were sampled from 5 provinces. The head and thorax of 20 bees from each colony were removed for DNA extraction. PCR assays were performed with 3 primer sets, including T, A, and K primers. Results indicated that 42.4% (42/99) of samples were Acarapis-positive by PCR assay which were sequenced to identify species. Each sequence showed 92.6-99.3% homology with reference sequences. Based on the homology, the number of colonies infected with A. dorsalis was 32 which showed the highest infection rate among the 3 species, while the number of colonies infected with A. externus and A. woodi was 9 and 1, respectively. However, none of the Acarapis mites were morphologically detected. This result could be explained that all apiaries in the survey used acaricides against bee mites such as Varroa destructor and Tropilaelaps clareae which also affect against Acarapis mites. Based on this study, it is highly probable that Acarapis mites as well as Varroa and Tropilaelaps could be prevalent in Korean apiaries.

INTRODUCTION

Acarapis mites are parasites of bees which can cause severe damage to the bee industry by decreasing honey production, destroying colonies in both managed and feral honey bees and decreasing pollination [1]. Currently there are 3 species of Acarapis mites: A. woodi, A. externus, and A. dorsalis [2]. These mites are known to parasitize specific locations on bees. A. externus is mainly found on the external surface of the head and thorax of bees. A. dorsalis, on the other hand, is mainly found on the thorax especially in a groove between the mesoscutum and mesoscutellum of bees. Unlike these 2 species, A. woodi is an internal parasite that lives in the abdominal and thoracic air sacs of bees [3]. All stages of the mite live within the tracheae, except during a brief period when adult females disperse to search for new hosts [3].

Each Acarapis mite shows different pathogenicity according to its habitat. Although A. externus has been reported to cause wing loss or malfunction, the 2 species of external mites, A. externus and A. dorsalis, generally do little damages [1]. Unlike the other 2 ectoparasitic mites, A. woodi causes blockage of thoracic tracheae, reducing the diffusion of oxygen to the flight muscles and to the brain, and serve as a vector of other pathogens such as bacteria and viruses [3]. Moreover, heavy infestation of the mite causes a shortened lifespan of bees, a diminished brood [4], smaller bee populations, looser winter clusters, increased honey consumption, lower honey yields, and ultimate colony demise [3].

All 3 species of the genus Acarapis are distributed throughout many countries. A. dorsalis has been reported on Apis mellifera from Europe, Canada, USA, New Zealand, Australia, Papua New Guinea, and Hawaii. The world distribution of A. externus is the similar to that of A. dorsalis, but A. externus is collected more frequently and more abundant than A. dorsalis [2]. A. woodi has been reported in many European countries, including Scotland, France, Spain, and Greece, after its first report in 1919. The mite then spread to the American continent, first to Argentina, Colombia, Mexico, and USA. Outside the European and American continents, it was reported in Iran, Turkey, China, and Japan [2,5-7]. Because Korea is located between China and Japan, Acarapis mites are expected to be present in Korea. However, the presence of A. woodi in Korea has not yet been reported.

In Korea, many studies on parasitic bee mites have been reported, including the infestation status and control methods on Varroa jacobsoni and Tropilaelaps clareae [8]. However, there have not yet been studies on their occurrence. If an outbreak of the mites suddenly happened, this present situation could cause bee colony devastation and Acarapis mite-mediated diseases on the Korean apicultural industry. We used a PCR detection method specific to Acarapis mites and surveyed the prevalence of Acarapis mites.

MATERIALS AND METHODS

Sample collection

A total of 99 Apis mellifera colonies were sampled from 72 apiaries in 5 provinces (Gyeonggi, Gangwon, Chungcheong, Gyeongsang, and Jeolla) in Korea (Fig. 1). Fifty to 100 adult bees were collected and pooled from 1-2 colonies in each apiary between August and December 2013. The honey bee samples were collected from brood nests inside the hives for managed colonies and at the hive entrances for feral colonies, respectively [5]. After collecting the bees, the samples were stored at -20˚C for PCR detection.

Fig. 1.

Distribution of apiaries visited during the survey. aC indicates the number of collected colonies and bA is the number of visited apiaries in each province.

PCR detection and sequencing

The head and thorax of 20 adult bees randomly chosen from each hive were used for DNA extraction using DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Total DNA was eluted in 30 µl of elution buffer and used for PCR with LeGene Hot Start PCR Mix w/Sky Blue Dye (LeGene Biosciences, San Diego, California, USA). Two primer sets, including Acarapis (A) primer and Kojima (K) primer set, were used to identify Acarapis mite (Table 1) which were capable of amplifying mitochondrial cytochrome c oxidase subunit I (COI) DNA fragments of Acarapis mites [5,9,10]. These primers do not amplify honey bee COI DNA fragments; thus, total DNA isolated from bees was used as a template for PCR. As a positive control for PCR to verify the quality of DNA extraction, a honey bee genomic DNA fragment encoding a part of a honey bee Hymenoptera-specific transient receptor potential A channel (AmHsTRPA) was amplified by AmHsTRPA (T) primer set [10]. The thermal cycling conditions were as follows: 1 cycle of initial denaturation at 94˚C for 2 min, 35 cycles of denaturation at 94˚C for 30 sec, annealing at 55˚C for 30 sec, and extension at 72˚C for 30 sec. The PCR product was analyzed by 2% agarose gel electrophoresis. A negative control lacking template DNA was performed for each PCR reaction. Since A and K primer sets equally amplify COI genes of 3 species of Acarapis mites (A. woodi, A. dorsalis, and A. externus), the amplified products with T and A primer sets or T and K primer sets were sequenced and aligned with the sequences deposited in GenBank to determine the parasitized mite species. The nucleotide sequences were identified by the Basic Local Alignment Search Tool (BLAST) at the National Center for Biotechnology Information (NCBI). Multiple nucleotide alignment was carried out using the published SBV sequences as references by BioEdit version 7.0.9.0 (Table 2). The phylogenetic tree was constructed by Mega 6.06.1 software [11] using the neighbor-joining (NJ) method [6].

Table 1.

Primer sets for Acarapis mite detection

Name for primer sets	Sequence (5’ to 3’)[a]	Length (bp)	References
Kojima (K)[b]	F- CAGTAGGGCTAGATATCGATACCCGAGCTT	247	Kojima et al. [5]
	R- TGAGCTACAACATAATATCTGTCATGAAGA
Acarapis (A)[c]	F- CGGGCCCGAGCTTATTTTACTGCTG	162	Garrido-Bailón et al. [9]
	R- GCGCCTGTCAATCCACCTACAGAAA
AmHsTRPA (T)[d]	F– CACGACATTCAAGGTTTAAGAAATCACG	426	Kojima et al. [5]
	R- TCAGTTATTCTTTTCCTTTGCCAGATTT

F: forward primer; R: reverse primer.

Kojima (K); the primer set which amplifies mitochondrial cytochrome c oxidase subunit I (COI) DNA fragments of Acarapis mites.

Acarapis (A); the primer set which amplifies COI DNA fragments of Acarapis mites.

AmHsTRPA (T); the primer set which amplifies a honey bee genomic DNA fragment encoding a part of AmHsTRPA.

Table 2.

PCR assay result for the bee colonies

Province	No. of tested colonies	Number of positive colonies (%)[a]
		A primer set	K primer set	A and K primer sets	Total
Gangwon	12	3 (25.0)	0 (0)	0 (0)	3 (25.0)
Gyeonggi	21	1 (4.8)	1 (4.8)	0 (0)	2 (9.5)
Chungcheong	24	5 (20.8)	0 (0)	1 (4.2)	6 (25.0)
Gyeongsang	22	19 (86.4)	1 (4.5)	1 (4.5)	21 (95.5)
Jeonla	20	8 (40.0)	0 (0)	2 (10.0)	10 (50.0)
Total	99	36 (36.4)	2 (2.0)	4 (4.0)	42 (42.4)

(%)=(no. of positive colonies / no. of tested colonies with PCR assay)×100.

Microscopic examination of Acarapis mite

To confirm the presence of Acarapis mites, a total of 20 bees per each colony were examined with a modified dissection method developed by Lorenzen and Gary [12]. The external surface, including the head, thorax and a groove between the mesoscutum and mesoscutellum of each bee, was examined to find out A. externus and A. dorsalis. To examine A. woodi, each bee was pinned through the thorax into bee wax culture dish and placed under a dissecting microscope. The head and the first pair of legs were removed off using a scalpel or razor blade. The ring of prothoracic sclerite (collar) was also removed using fine forceps to fully expose both left and right sides of the trachea. The exposed trachea of 2 right and left sides was examined with 20× magnification to find out tracheal color change, the body of A. woodi and foreign substance. If the presence of A. woodi or foreign substance was confirmed, the trachea was detached and placed on a glass slide and examined under an optical microscope to diagnosis A. woodi.

RESULTS

Prevalence of Acarapis mite infestations

A total of 99 colonies from 72 apiaries in 5 provinces (Gyeonggi, Gangwon, Chungcheong, Gyeongsang, and Jeolla) were examined (Fig. 1). All of the 99 colonies were T primer set positive. Among these, 36, 2, and 4 colonies were positive for A, K, and both A and K primer sets, respectively (Table 2). The infection rate of Acarapis mites in Gangwon, Gyeonggi, Chungcheong, Gyeongsang, and Jeolla were 25.0%, 9.5%, 25.0%, 95.5%, and 50.0%, respectively (Table 2). Gyeongsang had the highest infection rate, followed by Jeolla, Chungcheong, and Gyeonggi. Gangwon had the lowest infection rate among the 5 provinces. Between the primer sets, the A primer set was more sensitive than the K primer set (Table 2).

Molecular characterization of Korean Acarapis mites

To confirm the above PCR assay results, all 42 Acarapis-positive colonies were sequenced and aligned. Each sequence showed 92.6-99.3% homology with reference sequences available in GenBank (Table 3). Species identification of each colony was determined if the sequence between the unknown sample and the reference showed 98-100% homology. Based on these criteria, the number of colonies infected with A. dorsalis was 32 samples which showed the highest infection rate among the 3 species, while the number of colonies infected with A. externus and A. woodi was 9 and 1, respectively. The DNA sequences of PCR-amplified CO1 fragments infested by A. dorsalis A. externus, and A. woodi were deposited to a DDBJ database as the no. LC006085, LC006083, and LC006084, respectively. Although A. externus and A. dorsalis were distributed throughout all 5 provinces, A. woodi was only detected from an apiary in Mungyung City, Gyeongsang (Gyeongsangbuk-do Province) (Table 4). The phylogenetic analysis between Korean isolates in this study and other references was performed (Fig. 2). Each Korean isolate Acarapis species was placed on a separate branch and closely related to the same Acarapis species.

Table 3.

Sequence relationships of the nucleotide of mitochondrial cytochrome c oxidase subunit I (COI) DNA fragments from Korean isolates of Acarapis mites

Species			Nucleotide sequence identity (%)
	Country		A. dorsalis	A. dorsalis	A. dorsalis	A. externus	A. externus	A.externus	A. woodi	A. woodi	A. woodi	A. woodi	A. dorsalis	A. externus
		Accession#	New Zealand	Canada	New Zealand	New Zealand	New Zealand	United Kingdom	Canada	United Kingdom	USA	Korea	Korea	Korea
			HQ243439	GQ916567	HQ243434	HQ243441	HQ243440	FJ603293	GQ916565	FJ603296	EU190886	LC006084	LC006085	LC006083
A. dorsalis	New Zealand	HQ243439	100
A. dorsalis	Canada	GQ916567	99.3	100
A. dorsalis	New Zealand	HQ243434	100	99.3	100
A. externus	New Zealand	HQ243441	93.2	93.8	93.2	100
A. externus	New Zealand	HQ243440	93.2	93.8	93.2	100	100
A. externus	United Kingdom	FJ603293	93.2	93.8	93.2	100	100	100
A. woodi	Canada	GQ916565	96.3	95.7	96.3	94.4	94.4	94.4	100
A. woodi	United Kingdom	FJ603296	96.3	95.7	96.3	94.4	94.4	94.4	100	100
A. woodi	USA	EU190886	96.3	95.7	96.3	94.4	94.4	94.4	100	100	100
A. woodi	Korea	LC006084	96.9	96.3	96.9	93.8	93.8	93.8	99.3	99.3	99.3	100
A. dorsalis	Korea	LC006085	99.3	98.7	99.3	92.6	92.6	92.6	96.9	96.9	96.9	97.5	100
A. externus	Korea	LC006083	92.6	93.2	92.6	99.3	99.3	99.3	95	95	95	94.4	93.2	100

Table 4.

Regional occurrence of Acarapis spp. in Apis mellifera from Korea

Province	No. of tested colonies	No. of positive colonies (%[a])
		A. dorsalis	A. externus	A. woodi	Total
Gangwon	12	2 (16.7)	1 (8.4)	0 (0)	3 (25.0)
Gyeonggi	21	2 (9.5)	0 (0)	0 (0)	2 (9.5)
Chungcheong	24	6 (25.0)	0 (0)	0 (0)	6 (25.0)
Gyeongsang	22	14 (63.6)	6 (27.3)	1 (4.5)	21 (86.3)
Jeonla	20	8 (40.0)	2 (10.0)	0 (0)	10 (50.0)
Total	99	32 (32.3)	9 (9.1)	1 (1.0)	42 (42.4)

(%)=(no. of positive colonies / no. of tested colonies with PCR assay)×100.

Fig. 2.

Phylogenetic tree of the nucleotide of mitochondrial cytochrome c oxidase subunit I (COI) DNA fragments from Korean isolates of Acarapis mites and other refer ences of Acarapis mites.

Morphological diagnosis of Acarapis mites

In microscopic examinations, a total of 20 bees per each colony were dissected, but no diagnosable mite body was detected. However, foreign bodies which assumed the mite and some debris were discovered from the A. woodi-positive bee colony (Fig. 3).

Fig. 3.

Light microscopic view of a bee trachea. (A) Clean trachea from healthy bee. (B) Trachea from Acarapis woodi positive bee by sequence analysis. Foreign bodies which assumed the mite and some debris were discovered (arrow).

DISCUSSION

In this study, the prevalence of Acarapis mites was surveyed by PCR and subsequent sequencing. Molecular analysis of bee DNA extracts using PCR and alignment indicate that all 3 species of Acarapis mites are present in Korea and 32.3% (32/99) colonies were infected with A. dorsalis, 9.1% (9/99) with A. externus, and 1.0% (1/99) with A. woodi from 99 colonies in Korea. Although we molecularly identified Acarapis mites, the Acarapis mites were not found in microscopic examinations. This result could be explained by the fact that all apiaries in the survey used in-house type acaricides against bee mites such as Varroa destructor and Tropilaelaps clareae which also affected against Acarapis spp. Reports also indicate that most apiaries of Korea regularly use insecticides for acarine control [13,14]. Therefore, only dead bodies of the mites or debris might have remained and been detected by PCR assay (Fig. 3).

While A. dorsalis and A. externus were detected in all 5 provinces, A. woodi was found only in 1 apiary farm, and the infection rate was very low. Species-specific seasonal fluctuation could explain this phenomenon. In A. dorsalis and A. externus, the incidence of these mites decreased in fall, increases in spring, and is highest during May and September in temperate regions [15,16]. On the other hand, the prevalence of A. woodi Table 3. increased greatly from November to February and declined in late spring [17]. We collected most of the bee samples during August and October. Consequently, the population of A. woodi might be too low for detection. In future studies, the bee samples should be collected during fall and winter seasons and examined to confirm the seasonal fluctuation of Acarapis mites in Korea.

In general, the most common diagnostic method for Acarapis mite infestation is morphological identification. Further, the molecular prevalence of Acarapis mites has been conducted only in a few countries [14]. However, the morphological identification is generally time-consuming and requires detailed and sustained attention by the screener. On the other hand, molecular methods facilitate rapid and sensitive detection of Acarapis spp. in many honey bee samples for epidemiologic surveys [10]. Therefore, we adopted 2 different genusspecific primers, including K and A primer sets. Our results indicated that the A primer set was more sensitive than the K primer set. However, both A and K primer sets require sequencing of amplicons to identify the species of the mite. Therefore, there is a need to design a primer which can amplify species-specific COI DNA fragments in future studies.