Development of Multiplex PCR for Simultaneous Detection of Three Pathogenic Shigella Species.

BACKGROUND: Shigella species are among the common causes of bacterial diarrhoeal diseases. Traditional detection methods are time-consuming resulting in delay in treatment and control of Shigella infections thus there is a need to develop molecular methods for rapid and simultaneous detection of Shigella spp. In this study a rapid multiplex PCR were developed for simultaneous detection of three pathogenic Shigella species.
METHODS: For detection of Shigella spp., a pair of primers was used to replicate a chromosomal sequence. Three other sets of primers were also designed to amplify the target genes of three most common species of Shigella in Iran including S. sonnei, S. flexneri and S. boydii. The multiplex PCR assay was optimized for simultaneous detection and differentiation of three pathogenic Shigella species. The assay specificity was investigated by testing different strains of Shigella and other additional strains belonging to non Shigella species, but responsible for foodborne diseases.
RESULTS: The Shigella genus specific PCR yielded the expected DNA band of 159 bp in all tested strains belonging to four Shigella species. The standard and multiplex PCR assays also produced the expected fragments of 248 bp, 503 bp, and 314 bp, for S. boydii, S. sonnei and S. flexneri, respectively. Each species-specific primer pair did not show any cross-reactivity.
CONCLUSION: Both standard and multiplex PCR protocols had a good specificity. They can provide a valuable tool for the rapid and simultaneous detection and differentiation of three most prevalent Shigella species in Iran.

Introduction

Shigella species annually cause an estimated 164.7 million cases of shigellosis worldwide, resulting in 1.1 million deaths (1). Shigellosis as an endemic disease in Iran is one of the major causes of morbidity in children with diarrhea in this country (2–4).

There are many ways for detection of Shigella species including conventional culture and molecular methods (5). Conventional methods are usually problematic process and require several days to give results (6). Moreover, these methods are relying on the viable organisms to multiply in media. Taken as a whole, conventional methods have less sensitive because there is not enough number of organisms in some specimen and the numbers of organisms decrease during specimen transport (5). In many studies, molecular methods for detection of Shigella spp. and other intestinal pathogens have been developed (7–11). Multiplex PCR is one of molecular methods that have been used frequently in many studies because of rapidity and its capability for simultaneous detection of several microorganisms in a single sample (12).

The genus of Shigella has four species that are able to cause severe disease in humans. S. sonnei is the major cause of shigellosis in industrialized countries. Otherwise S. flexneri is the most prevalent Shigella serotype in developing countries (13–15). S. dysenteriae is usually the cause of epidemics of dysentery is detected mostly in South Asia and sub-Saharian Africa and S. boydii has been less frequently reported worldwide compared to other Shigella serogroups (16). Of four species, three including S. sonnei, S. flexneri and S. boydii are common species in Iran (17–20).

This study aimed to develop a Multiplex-PCR assay for simultaneous detection of three most common Shigella species in Iran.

Materials and Methods

Bacterial species

Clinical Shigella isolates were recovered from patients with Shigella infections admitted to several hospitals including Children Medical Center, Emam Khomeini and Baqiatallah hospitals in Tehran, Iran, during 2008–2010. Bacterial positive controls were also used to check the specificity of the assay (Table 1). Subsequently, identification and confirmation of the reference and clinical strains were carried out by culture, biochemical and serological testing.

Table 1:

Primers used in this study

Primers	Sequence	Locus	Species	Band size (bp)
GFGR	TCCGTCATGCTGGATGAACGATGTACAGTTCAGGATTGCCCGAGACACA	NC_004337: 559294-559452NC_004741: 555187-555345NC_007384: 759977-760135NC_007613: 642360-642518NC_008258: 602392-602550NC_010658: 652993-653151	Shigella spp.	159
BFBR	TCTGATGTCACTCTTTGCGAGTGAATCCGGTACCCGTAAGGT	NC_007613: 1360607-1360854NC_010658: 1782921-1783168	S. boydii	248
SFSR	AATGCCGTAAGGAATGCAAG CTT-GAAGGAGATTCGCTGCT	NC_007384: 1665725-1666227	S. sonnei	503
FFFR	ACCGGTTATGAACCCTCCATTGGTGCTTGTTGAGCAACTC	NC_004337: 1412593-1412906NC_004741: 1898025-1898338NC_008258: 1883992-1884305	S. flexneri	314

Bacterial DNA extraction

Bacterial strains were grown on LB broth and incubated at 37°C for 24 hr. The culture of each Shigella isolate was centrifuged at 6000 RPM for 10 min. Genomic DNA of the Shigella strains was extracted using a DNA extraction Kit (Cat. No. 11 814 770 001, Roche, Germany) according to the manufacturer’s instruction.

Genomic PCR targets and primers

We designed four sets of primers to amplify the target genes of Shigella spp. (Putative Integrase) and of three Shigella species including S. sonnei (Putative Restriction Endonuclease), S. flexneri (Putative Bacteriophage Protein) and S. boydii (Conserved Hypothetical Protein). The list of the primers and their sequences are presented in Table 2.

Table 2:

Shigella species and non- Shigella microorganisms included in this stud

Bacterial strains	Shigella spp. PCR results	S. flexneri specific-PCR results	S. boydii specific-PCR results	S. sonnei specific-PCR results	Reference
Shigella spp.
S. flexneri	+	+	−	−	ATTC9290
S. boydii	+	−	+	−	ATTC 9207
S. sonnei	+	−	−	+	ATTC12022
S. sonnei	+	−	−	+	17 clinical isolates
S. dysenteriae	+	−	−	−	3 clinical isolates
S. flexneri	+	+	−	−	6 clinical isolates
S. boydii	+	−	+	−	4 clinical isolates
Non- Shigella organisms
Salmonella enteritidis	−	−	−	−	ATCC 4931
Salmonella typhimurium	−	−	−	−	ATCC 14028
Campylobacter jejuni	−	−	−	−	ATCC 33560
Escherichia coli	−	−	−	−	ATCC 25922
Vibrio cholerae	−	−	−	−	PTCC 1611
Escherichia coli	−	−	−	−	ATCC 35150

To avoid cross-reactivity with Shigella related bacteria and within each other Shigella species, genus and species-specific regions of the Shigella genome were considered to design the primers, respectively.

PCR assay

First, a standard PCR assay was performed using standard (Shigella and non Shigella strains) and 30 clinical strains (17 S. sonnei, 6 S. flexneri, 4 S. boydii and 3 S. dysenteriae). The PCR was carried out using a total volume of 25 μL containing 1× PCR buffer, 1 mM MgCl2, 1 U Taq DNA polymerase, 200 μM dNTP, 0.5 μM of each primers and 2.5 μL of DNA template. The PCR condition consisted of 5 min at 95 °C, followed by 30 cycles of 60 s at 95 °C of denaturing temperature, 60s at 60 °C of annealing temperature, and 1 min at 72 °C of extension temperature. At the end of the 30 cycles, a final extension of 10 minutes at 72 °C was used.

Each multiplex PCR mixture in was prepared using a total volume of 25 μL containing 0.5 μM of each primer (four pairs), 2, 5 μL PCR buffer 10X, 2 U Taq DNA polymerase, 1 mM MgCl2, 200 μM dNTPs and 1 μL DNA template. The multiplex PCR was carried out through 30 cycles following a pre-heat step at 95 °C for 5min. Each cycle consisted of denaturation at 95 °C for 60 s, annealing at 60 °C for 1min, and extension at 72 °C for 1min. After the 30 cycles, samples were maintained at 72°C for 10 min. Sterile distilled water was included in each PCR assay as a negative control. The amplified DNA was separated by 1% agarose gel electrophoresis, stained with ethidium bromide, and visualized by UV transillumination.

Results

The Shigella genus specific PCR produced the expected amplified DNA band in all Shigella species strains tested. Figure 1 shows the specific band of 159 bp obtained from standard and clinical isolates belonging to four Shigella species. Any positive reaction with non Shigella strains including Salmonella and Escherichia coli was detected. Standard PCR assays also produced the expected fragments of 248 bp, 503 bp, and 314 bp, for S. boydii, S. sonnei and S. flexneri, respectively. While S. dysenteriae was used as negative control for detection assay of three pathogenic Shigella species, any DNA band was not amplified using specific Shigella species primers (Fig. 1).

Fig. 1:

Detection of specific Shigella species genes by PCR : lane 1, S. flexneri ATTC9290 (314bp); lane 2, clinical isolate of S. flexneri(314bp); lane 3, clinical isolate of S. boydii (248bp); lane 4, S. sonnei ATTC12022 (503bp); lane 5 clinical Shigella spp. (S. dysenteriae) (159bp); lane 6 100bp ladder; lanes 7 and 8, non Shigella isolates including Salmonella enteritidis and E. coli respectively

As shown in Table 2, the standard PCR showed the same results on 30 clinical Shigella isolates. These isolates were recently recovered from pediatric patients in Tehran, Iran.

Multiplex PCR was successfully optimized for rapid and simultaneous detection of three pathogenic Shigella species.

Multiplex PCR was able produced the expected DNA bands for standard and clinical isolates of S. boydii, S. sonnei and S. flexneri in a single reaction. No non specific amplification products were observed with S. dysenteriae (as negative control) and non Shigella strains. Figure 2 shows the specific amplified bands obtained by multiplex PCR on the three pathogenic Shigella species.

Fig. 2:

Multiplex PCR : lane 1 clinical species, lane 2 standard species and lane 3 100bp ladder. Shigella spp; 159bp, S. sonnei; 503bp, S. flexneri; 314bp, and S. boydii; 247bp

Discussion

A specific PCR using Putative Integrase locus was evaluated for the rapid and specific detection of Shigella species. The results showed that this locus is an appropriate target for this purpose. This locus is conserved in all Shigella species and has not been studied previously.

A new multiplex PCR was also designed using four sets of primers to identify common Shigella species in our country. Accordingly, the designed method was successfully able to detect S. boydii, S. flexneri and S. sonnei. No nonspecific amplification was observed, confirming that this assay is specific for detection of these three most common pathogenic Shigella species in Iran.

Several previous studies have used standard PCR for rapid detection of bacterial pathogens such as Shigella species. However, multiplex PCR deserves special interest because of the possibility to rapid and simultaneous detection and identification of several target genes in a single reaction (21–26). Optimization of annealing temperature is very important in this technique. The annealing temperature of 60°C proved to be optimal for detection and differentiation of the three Shigella species under study. Analysis of quality assessment results of standard strains in combination with clinical samples indicated that the multiplex PCR was reliable and suitable method for the simultaneous detection of different Shigella strains. PCR results obtained from the clinical samples were consistent with results from the standard strains.

Previously some researchers have applied the multiplex PCR for rapid detection and differentiation of prevalent Shigella species. The primers used in many studies have been designed for detection of plasmid genes encoding virulence factors (27). Vantarakis et al. designed a multiplex PCR using two sets of primers which targeted invA and virA genes for simultaneous detection of Salmonella s and Shigella specie, respectively (28). Aranda et al. evaluated two multiplex PCR assays for simultaneous detection of typical and atypical E. coli pathovars and Shigella species. (29). Their results showed that the multiplex PCR was a potentially valuable tool for rapid diagnosis of Shigella species and E. coli pathovars.

Thong et al. designed a multiplex PCR assay for simultaneous detection of chromosomal-and plasmid-encoded virulence genes (set1A, set1B, ial and ipaH) in Shigella species. Unlike our study, the limitation of their Multiplex PCR assay was its inability to differentiate Shigella species (30). This problem may be resulted from losing of virulence genes in some strains owing to plasmid-curing or hot spot regions for deletion (31).

The described assay showed to be specific for detection and differentiation of the three Shigella species tested. No false positive and negative results occurred during the assay indicating that target loci used in the study were specific for Shigella species. One of Shigella Multiplex PCR limitations is its inability to discriminate Shigella isolates from EIEC (32). However, this problem was resolved by using specific primers so we found any cross reaction with EIEC, bioinformatically.

Our results also showed that the multiplex PCR using four primers sets was able to detect Shigella species and to differentiate three species of Shigella simultaneously in a single reaction by the combinations of the different-size amplicons without any cross-reactivity.

Conclusion

The method presented here showed a good specificity and proved to be able to offer an important diagnostic tool for the rapid and simultaneous detection of the three most prevalent species of Shigella in Iran.

Ethical Considerations

All ethical issues including plagiarism, Informed Consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc. have been completely observed by the author.