Ramin Talaei1, Negar Souod2, Hassan Momtaz3, Hossein Dabiri4. 1. Shahid Modaress Hospital, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 2. Young Researchers and Elite Club, Islamic Azad University, Central Tehran Branch, Tehran, Iran. 3. Department of Microbiology, Faculty of Veterinary Medicine, Islamic Azad University, ShahreKord Branch, ShahreKord, Iran. 4. Department of Clinical Microbiology, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.
Abstract
AIM: The current investigation aimed to evaluate ruminant raw milk as a reservoir source of Helicobacter pylori and analyze the diversity of cagA and vacA genotypes as H. pylori virulence factors to find any relationship between these genotypes in human and animal H. pylori strains. BACKGROUND: The way of transmission of Helicobacter pylori as one of the most controversial bacteria in the world, which colonizes the human gastric tissue and is responsible for several gastric diseases is still unknown. The possibility of zoonotic transmission of H. pylori is feasible, but is not proven in ruminant reservoirs. METHODS: Overall 210 cows, sheep, goats, camels and buffalos' raw milk samples and 100 human gastric biopsies were collected in this survey. We applied PCR assays to identify H. pylori, vacA and cagA genes. Statistical tests were applied for data analysis. RESULTS: Totally 12(16%) cow, 8(13.79%) sheep, 2 (4.76%) goat, 2(13.33%), buffalo 4(20%) and 82 (82%) of human specimens were confirmed to be H. pylori positive. Among which s1a/m2 genotype was more frequent in isolated H. pylori strains and statistically significant between strains. Based on statistical analyses the s1b allele of sheep had a significant association with human strains. CONCLUSION: The current survey was prompted by our previous report. According to both results we can conclude that sheep may act as a reservoir for H. pylori and transmit this bacterium to human via its milk. Extended assessments in other geographical regions and other animals are recommended.
AIM: The current investigation aimed to evaluate ruminant raw milk as a reservoir source of Helicobacter pylori and analyze the diversity of cagA and vacA genotypes as H. pylori virulence factors to find any relationship between these genotypes in human and animal H. pylori strains. BACKGROUND: The way of transmission of Helicobacter pylori as one of the most controversial bacteria in the world, which colonizes the human gastric tissue and is responsible for several gastric diseases is still unknown. The possibility of zoonotic transmission of H. pylori is feasible, but is not proven in ruminant reservoirs. METHODS: Overall 210 cows, sheep, goats, camels and buffalos' raw milk samples and 100 human gastric biopsies were collected in this survey. We applied PCR assays to identify H. pylori, vacA and cagA genes. Statistical tests were applied for data analysis. RESULTS: Totally 12(16%) cow, 8(13.79%) sheep, 2 (4.76%) goat, 2(13.33%), buffalo 4(20%) and 82 (82%) of human specimens were confirmed to be H. pylori positive. Among which s1a/m2 genotype was more frequent in isolated H. pylori strains and statistically significant between strains. Based on statistical analyses the s1b allele of sheep had a significant association with human strains. CONCLUSION: The current survey was prompted by our previous report. According to both results we can conclude that sheep may act as a reservoir for H. pylori and transmit this bacterium to human via its milk. Extended assessments in other geographical regions and other animals are recommended.
More than half of the world’s population is infected with Helicobacter pylori, a Gram-negative bacterium etiologically associated with gastrointestinal diseases, gastric adenocarcinoma and gastric B-cell lymphoma (1).There are reports describing significant differences in the prevalence of this bacterium between variant geographical regions and ethnics of each population (2). The exact routes by which humans acquire H. pyloriinfection are unknown (3). The available data suggest that the transmission of this bacterium occurs by person-to-person or by environmental sources such as water and milk to human. Recently zoonotic transmissions are considered as main routs of infection (4). Reported vectors are cows, sheep, cockroaches, houseflies as well as domestic pets (4). Several studies have shown higher levels of antibody in veterinarians, butchers and slaughters suggesting that ruminants might be a source of infection (3).According to previous studies, the variety of clinical manifestations in the patients who suffer from H. pyloriinfections depends on multiple host and bacterial factors including host genetic, host immune response, bacterial load and virulence factors (5). One of the most extensively studied toxins which secreted by H. pylori is vacuolating cytotoxin A (VacA). As we mentioned in previous investigations, specific allelic diversity exists in domains of this gene: signal region (s1a, s1b, s1c and s2), the intermediate (i1, i2 and i3) and mid region (m1a, m1b and m2) (6,7). One other virulence factor is cytotoxin-associated gene A (cagA), which is a gene of pathogenicity island of H. pylori and can be a predictive marker for the bacterium pathogenicity (8). H. pylori strains can be divided into two groups: cag positive and cag negative. According to previous studies, cag positive strains are more prevalent in patients with more severe clinical symptoms (9).Milk is a beneficial drink for the health of the human body, and most of the people include it at least once a day in their food chain. Besides appropriate conditions of milk provides an opportunity for H. pylori transition to human being. This study was prompted by our previous observation, in which we concluded that sheep might act as a reservoir for H. pylori and somehow share the ancestral host of this bacterium with human. In the current study we investigated the prevalence of H. pylori in the milk of cow, sheep, goat, camel and buffalo. In addition, we compared the vacA and cagA genotype status of H. pylori in human and milk samples.
Methods
Sampling210 animal raw milk and 100 human gastric biopsy with gastrointestinal disorders were enrolled in the current study. Animal samples were collected from following species from west of Iran: cow (n=75), sheep (n=58), goat (n=42), buffalo (n=20) and camel (n=15). The samples were obtained from farm bulk tanks and milk collection centers over a year from May 2014 to March 2015 considering their Seasonality of lactating period. Sampling was performed according to the International Dairy Federation guidelines (10). Considering sterile conditions, 100 ML of each sample was collected in the sterile glass containers and transported to the laboratory at 4°C within a maximum of 3 hours after collection.Gastric human specimens were collected from governmental general hospital Endoscopy center in the west of Iran. The biopsy specimens were collected from antrum and corpus of each patient. Informed consent was obtained from all patients at the beginning of endoscopy. All specimens were placed in 0.1 ml of sterile saline solution, transported to the laboratory immediately and stored at -70°C until further investigation.DNA AnalysesWe did not apply bacterial culture methods in this investigation. We used 16S rRNA PCR analysis for the confirmation of H. pylori directly on all the samples. For human samples first, a rapid urease test was performed with a Gastro urease kit (Baharafshan, Iran). Then, the DNA was isolated from each biopsy, using a DNA extraction kit (CinnaGen, Iran) according to the manufacturer’s instructions and immediately used for the molecular analysis.To extract DNA, 25 ml of milk samples was centrifuged at 2200 g at room temperature. Supernatant, including the hardened fat layer, was aspirated and discarded, except for the bottom 5 ml. The bottom of the remaining supernatant (including the casein pellet) was transferred by pipette into a 1±5-ml tube. To dissolve casein, 300 µl 0±5 m-disodium ethylene diamine-tetraacetate (EDTA), pH 8±0 and 200 µl 10mm-Tris-HCl±1 mm-EDTA, pH 7±6 (TE) were added to the supernatant. Somatic cells and casein micelles re-suspended by vortexing(11). Phenol-chloroform extraction and ethanol precipitation were performed, as described by Sambrook et al. (12).Detection of H. pylori was carried out in 25 μl reaction mixtures containing 2 μl ( 300 ngr) of genomic DNA, 1.5 mM MgCl2, 200 mM concentrations of dNTPs, 1 U of smar Taq polymerase (CinnaGen, Iran) and 0.2 mM concentrations of primers HP-1 and HP-2 under previously reported conditions. The Primers sequences were HP-1 (CTGGAGAGACTAAGCCCTCC) and HP-2 (ATTACTGACGCTGATTGTGC) (12). The applied Primers for vacA allels and cagA gene have been described previously(11). DNA samples from H pylori (D0008; Genekam, Germany) were used as a positive control, and sterile distilled water was used as a negative control. The PCR was performed in a DNA Thermal Cycler (Eppendrof Mastercycler 5330; Eppendorf-Nethel-Hinz GmbH, Hamburg, Germany), with 40 cycles for HP primer and 35 cycles for vacA and cagA primers. Each cycle consisted of denaturation at 95°C/45 seconds, annealing at 59°C/30 seconds for HP, 52°C/45 seconds for vacA and 58°C/45 seconds for cagA as well as extension at 72°C/45 seconds. There was another longer extension of 6 minutes at 72°C. The PCR products were visualized after electrophoresis on a 1.5% agarose gel stained with EtBr.Statistical analysisComparisons of differences and similarities were conducted by the chi-square test using the SPSS for Windows statistical software (version 17; SPSS, Inc., Chicago, IL, USA). P-values less than 0.05 were considered as statistically significant.
Results
A total of 210 raw animal milk specimens and 100 human gastric biopsies were collected, among which 28 (13.33%) samples were confirmed to be H. pylori positive based on PCR assays. The frequencies were as follows: cow 12(16%), sheep 8(13.79%), goat 2 (4.76%), camel 2(13.33%), and buffalo 4(20%) (Table1).
Table 1
The frequency of H. pylori in ruminant raw milk samples
Species
Sample
H. pylori Pos.
Cow
Raw milk (n=75)
12 (16.00%)
Sheep
Raw milk (n=58)
8 (13.79%)
Goat
Raw milk (n=42)
2 (4.76%)
Camel
Raw milk (n=15)
2 (13.33%)
Buffalo
Raw milk (n=20)
4 (20.00%)
Total
Raw milk (n=210)
28 (13.33%)
The frequency of H. pylori in ruminant raw milk samplesFrom the physical point of view all the ruminants seemed healthy and their milk was transported for daily consumption. Based on RUT and PCR assays, out of 100 patients, 82 (82%) patients were infected with H. pylori, 49 individuals (49%) were men and 51 (51%) were women with an average age of 47 years (range, 17 to 87 years). Moreover, 8 (8%) of patients had gastric ulcers, 11 (11%) had duodenal ulcers, 2 (2%) had gastric cancer, 80 (80%) had gastritis, 3(3%) had duodenitis, 17(17%) had gastric nodularity and 26(26%) had gastric erosions. It should be noted that some patients had several diseases together.The vacA allele types were indicated in animal samples. Among which vacA s1a/m1a, s1a/m2, s1a/m1a-m2, s1a/m1b-m2, s1a/m1b-m2 were the most predominant strains prospectively in sheep, cows, goats, camels and buffalos respectively. While the frequency of this gene in human were as follows: 55 (67.07%) samples s1 and 27 (32.92%) s2. Out of 67 s1 strains, 32 (39.02%) samples were s1a, 10 (12.19%) were s1b and 13(15.85%) were s1c positive. For m region, 28 (34.14%) were classified as m1 and 54 (65.85%) were classified as m2. In the case of m1 sub-typing, the distribution of m1a and m1b was 22(26.82%) and 7(7.31%) respectively. Based on table 2, the frequency of the cagA-positive samples were 83.33%, 50%, 100%, 50% and 75% in cows, sheep, goat, camel and buffaloes respectively however 92.68% of humanH. pylori-positive samples harbored this gene. From the statistical point of view there was not significant relationship between cagA status in mentioned animals’ milk and human being (p=0.9). However, there was a considerable correlation between vacA s1a/m2 strains both in cows and sheep (p=0.04). Furthermore, there was a notable association between s1b allele in sheep and human being (p=0). We were not able to find any meaningful similarity in camel and buffalo with the others.
Table 2
The frequency of cagA and vacA genotypes in human gastric biopsies and ruminant raw milk samples
Species
Sample positive
cagA positive(%)
vacAs1a(%)
vacAs1b(%)
vacAs1c(%)
vacAs2(%)
vacAm1a(%)
vacAm1b(%)
vacAm2(%)
Human being
Gastric biopsy (82)
76(92.7)
32(39)
10(12.2)
13(15.8)
33(32.9)
22(26.8)
6(7.3)
54(65.8)
Cow
Raw milk (12)
10(83.3)
9(75)
2(16.7)
1(8.3)
-
5(41.7)
-
7(58.3)
Sheep
Raw milk (8)
4(50)
4(75)
3(37.5)
-
1(12.5)
-
2(25)
6(75)
Goat
Raw milk (2)
2(100)
1(50)
1(50)
-
1(50)
-
-
2(100)
Camel
Raw milk (2)
1(50)
1(50)
-
1(50)
-
-
1(50)
1(50)
Buffalo
Raw milk (4)
3(75)
-
2(50)
-
2(50)
3(75)
-
1(25)
The frequency of cagA and vacA genotypes in human gastric biopsies and ruminant raw milk samples
Discussion
About 3 decades after the first identification and culture of Helicobacter pylori, the route of transmission of it to human is still controversial (4, 13, 14). In the previous study, we confirmed the presence of H. pylori in some animal’s gastric tissue, thus rising further hypothesizes that foodstuff contamination may play a role in spreading of the H. pyloriinfection to humans (1). According to few studies, foodstuffs, particularly milk, have been assumed as a probable source of humaninfection for H. pylori (22). Therefore, we aimed to study the prevalence of H. pylori in cow, sheep, goat, camel and Buffalo milk and evaluate those strains virulence factors with human beings to find whether milk is a source of transmission or not.The prevalence of H. pylori varies all over the world. According to previous studies, the prevalence is high in most Asian countries such as China and Japan (70-50%), Eastern European, South American and Middle Eastern countries. For example, infection rate of H. pylori in Chile Bulgaria, Egypt, and Saudi Arabia is 73%, 61.7%, 90%, and 80% respectively. Lower prevalence belongs to the United Kingdom (13.4%), Australia (5-20%) and Switzerland (11-26%) (15, 16, 17). Iran is clustered as a risky region in the world for H. pylori incidence; therefore, the study of this bacterium including its prevalence, the mode of transmission, treatment and control is crucial.The prevalence of H. pylori in our survey in the west of Iran was 82% in human specimens, which was higher than the other reports from Shiraz, Yazd, Ardebil and Uremia-the other cities of Iran- where the prevalence was reported 54.5%, 30.6%, 47.5% and 75.3% respectively (18, 19,20). Variation in prevalence of H. pylori may contribute to the geographical factors, which are under the influence of host, microbe and environmental effects (21).There are several reports regarding the prevalence of H. pylori in household animal’s milk. For example, Quaglia et al. from Italy has been reported the prevalence of this bacterium 33%, 50% and 25.6% in sheep, cow and goat raw milk samples respectively (23). Mousavi et al. announced that 16.66% of bovines, 35% of ovine, 28% of caprin, 15% of buffalo and 13.3% of camelmilk samples were infected with H. pylori (27). Rahimi et al. noted that this rate was 1.41%, 12.2%, 8.7%, 23.4% and 3.6% in raw bovine, ovine, caprine, buffalo and camel milks (24). We were able to detect this bacterium in 12(16%) cows, 8(13.79%) sheep, 2 (4.76%) goats, 2(13.33%) camels, and 4(20%) buffaloes, which is somehow similar to other reports. As a result of our findings, the cow and sheepmilk has a higher rate of contamination compare to goat’s milk. In our previous research we did not find H. pylori in goats while a considerable number of cows and sheep carried H. pylori in their gastric tissues (1). This finding would be more important when we notice that the main source of milk consumed in Iran is from cow and sheep, thereby these finding all together may are explanation for high rate of H. pyloriinfection in a region where sheep, cow, and buffalo serve as a main source of milk for human consumption.Detection of low numbers of H. pylori in goats may contribute to the following possible reasons: goat has particular natural mechanisms of resistance to this bacterium, and inhibits the systematic circulation of this bacterium throughout the body. Another reason is that some other microorganisms like Candidatus H. bovis may colonize the goat’s stomach and establish the extent of the resistance of goats to the super infection with H. pylori (1, 25). Based on our previous study, no H. pylori was detected in gastric samples of goats. However, detection of this bacterium in very few goatmilk samples may relate to contamination or immune deficiency in selected goats. Another possibility is that some strains of H.pylori can infect goats.In the next step, we analyzed two main virulence factors; cagA and vacA status in detected H. pylori strains. Considering positive samples for H. pylori, the cagA gene was positive in 92% of humans, 83.33% of cow, 50% of sheep, 100% of goat, 50% of camel and 75% of buffalo. In all samples the rate of the cagA was high, and no meaningful differences in the prevalence of cagA gene among any animal and human samples was found. The cagA was considered as a non-useful epidemiological factor at least at the current structure.If we substitute the cagA with the EPIYA motifs or the cag pathogenicity island, we would probably find a better discriminatory measurement among different strains.In the case of vacA genotypes, except to buffalo samples, s1a/m2 was the predominant strain in studied samples. This shows that similar strains of H. pylori are circulating among studied animals particularly sheep and cows. The s1a/m2 was also predominant genotype among humanH. pylori; supporting the idea in which human and livestock share same H. pylori strains and sheep and cow play important role in H. pylori epidemiology. Human being H. pylori was more diverse in vacA genotype in comparison with other samples, shows that human are infected with more varied strains of H. pylori representing that human is a better host for this microorganisms. Some researchers believe that sheep might be infected with ‘‘human strains’’ indicating that contact with human may put sheep at risk for developing H. pyloriinfection (26). Therefore, sheep may transmit the infection to humans through the contaminated environment by feces containing H. pylori. However, it is not well known whether H. pylori is transmitted from animals to human or vice versa or both of them are in cycle.In conclusion, although human play the main role in H. pylori circulation among population but more likely animals and foodstuffs has an impact on H. pylori epidemiology. In our previous study, we showed that sheep might be a possible reservoir for H. pylori. In the current study, in constant with prior findings we conclude that H. pylori could be transmitted via milk of livestock particularly sheep, cow and buffalo. Goat has a minimum role in H. pylori epidemiology. However, extended studies and complementary researches in other geographical regions and animals are needed to establish a precise conclusion.
Authors: M P Dore; A R Sepulveda; H El-Zimaity; Y Yamaoka; M S Osato; K Mototsugu; A M Nieddu; G Realdi; D Y Graham Journal: Am J Gastroenterol Date: 2001-05 Impact factor: 10.864
Authors: N C Quaglia; A Dambrosio; G Normanno; A Parisi; R Patrono; G Ranieri; A Rella; G V Celano Journal: Int J Food Microbiol Date: 2008-02-21 Impact factor: 5.277