Literature DB >> 26161164

Diagnostic single nucleotide polymorphism markers to identify hybridization between dromedary and Bactrian camels.

Emily Ruiz1, Elmira Mohandesan1, Robert R Fitak1, Pamela A Burger1.   

Abstract

The technique to produce hybrid Tulu or Nar camels from crosses between dromedary and Bactrian camels is common throughout Middle Eastern and Central Asian countries. Formerly, these hybrids were highly valued as strong and persistent pack animals but today are bred to improve milk or wool quality in the respective species and for camel wrestling. We developed a diagnostic single nucleotide polymorphism (SNP) panel to identify cryptic ancestry in F1 hybrids and their backcrosses by selecting loci from whole genome data, which were fixed for different alleles in either dromedary or domestic and wild Bactrian camel. With this SNP panel we are able to identify the hybridization patterns in camels with uncertain origins, support hybrid breeding management and to detect potential rare dromedary introgression in the last wild Bactrian camels in Mongolia and China.

Entities:  

Keywords:  Camelus bactrianus; Camelus dromedarius; Hybrid camel; Introgression; Next generation sequencing (NGS); Single nucleotide polymorphisms (SNPs)

Year:  2015        PMID: 26161164      PMCID: PMC4486411          DOI: 10.1007/s12686-015-0420-z

Source DB:  PubMed          Journal:  Conserv Genet Resour            Impact factor:   0.973


Technical note

Anthropogenic hybridization between livestock populations or between domestic species and their wild relatives has been practiced since the early phases of domestication. In Old World camelids, hybridization between Bactrian camels (Camelus bactrianus) and dromedaries (Camelus dromedarius) was associated with the transportation of goods along the multiple routes of the Silk Road. This practice intended to produce animals with the robustness of the Bactrian camel, the endurance of dromedary, and the ability to tolerate sharply contrasting climatic conditions (Wilson 1984). Today, hybridization facilitates improved milk and wool yield in hybrid Tulu or Nar camels from Middle Eastern and Central Asian countries. Commonly, two hybridizing methods are recognized, Kurt-nar (dromedary female × Bactrian male) and Kez-nar (Bactrian female × dromedary male) followed by F1 backcrossing with either dromedary for increased milk productivity or Bactrian camel for wool and cold resistance (Faye and Konuspayeva 2012). F2 hybrids (F1 × F1) in Old World camels are usually not favoured because of a difficult character and weak progeny performance (Faye and Konuspayeva 2012). In western regions of Turkey, a relished sport is camel wrestling, where prized male Tulus compete against each other in heavily regulated fights (Vedat 2010). In this study, we developed diagnostic single nucleotide polymorphisms (SNPs) to identify F1 hybrids between dromedary and Bactrian camels and their backcrosses. These markers will facilitate the validation of non-invasive or historic samples with unclear or otherwise cryptic ancestry. As part of an on-going research project, we sequenced the genomes of 25 Old World camelids [C. dromedarius (n = 9), C. ferus (n = 9), C. bactrianus (n = 7)] and aligned them to the C. ferus CB1 genome assembly (Genbank ID: GCA_000311805.2). To verify their species identity, these source individuals had previously been genotyped at 18 nuclear microsatellite loci and Sanger sequenced for 800 bp of mitochondrial DNA (unpublished data). We identified SNPs according to the guidelines presented by Van der Auwera et al. (2013) and selected polymorphisms that were fixed for different alleles between C. dromedarius and both Bactrian camel species, C. bactrianus and C. ferus (see ‘Supplementary Methods’ in Online Resource 1). We designed PCR primers around each SNP using PRIMER3 (Untergasser et al. 2012) and selected 26 primer pairs (Online Resource 2) for validation. We tested the 26 candidate loci using PCR and Sanger sequencing (see ‘Supplementary Methods’ in Online Resource 1) on a panel of control individuals including three Bactrian camels, three dromedaries, two hybrids (F1 and F1 backcross) and a two-humped individual with uncertain genetic background. All 26 candidate loci produced PCR products of the expected sizes, but we selected for sequencing only those 12 loci which produced single strong bands over consistent conditions (Table 1). Upon sequencing, all 12 loci were diagnostic between dromedaries and Bactrian camels (Table 2). However, in the F1 hybrid (Hyb56) only 10 (83.3 %) of the diagnostic loci were heterozygous and the remaining two loci were homozygous for the Bactrian allele (Table 2). This suggests that at these two loci (HP264 and HP288) the Bactrian allele may be present at low frequency in dromedaries as a result of being a shared ancestral polymorphism (not diagnostic) or from historical hybridization between the two species. The F1 backcross (Hyb55) was heterozygous for two (16.7 %) of the diagnostic loci and homozygous for the Bactrian allele in the remaining loci. In the two-humped individual with uncertain origin (DC575), four (33.3 %) of the diagnostic loci were heterozygous, demonstrating hybrid ancestry in this animal (Table 2).
Table 1

Primer sequences and information for the 12 diagnostic loci

LocusPrimer sequence (5′–3′)a Scaffoldb Positionb AllelesTm Length
HP206TGTCAGACTGTTAGGCATTGC CATCCAAGTCTCCATCTAACCCNW_006210212.1501206C/G57125
HP379AGGATGCCATCATGTCAGG GAGGGAGCTCTCATGAATAGGNW_006210464.11151379G/A58150
HP405CCAGGAGCTTTTCGAGTAGC CAGCACAGAGAACTCACTGCNW_006211106.15030405G/C59125
HP429GCAGGCATACAAACTAACCC GCTTTTCTTTCTGGCTCAGGNW_006210666.12288429A/C57125
HP458TGTGACCAGACAGACCAAGG TGTGGCTTAGGGTCTTTATGGNW_006210457.111458T/C58140
HP501GAATAGATTGGGGAGCAAGC CTCTTCTCCATCCCTATGGCNW_006211169.1218501A/T59125
HP597ATGAACAGTTTGGGTTTGGG CGCGATGTCACCTTTATAGGNW_006211126.16065597A/C59125
HP633GCATGTAGAAGGTTTGCATAGG CAGCCTTTCTTGCATCTGGNW_006210489.14279633G/C57125
HP900CCACATGCTCAGGTATCTGG GGGATTCCTTGTGCTACAGCNW_006211075.1294900G/C59125
HP930CTCCCAGGAAACAAAAGTCC TTTGGGAGTGTTCTGTCTGCNW_006210745.13459930C/A59125
HP264TGGACAGAAACTTTGTGTCTCC TTTGGTAAGGGCATGAATCCNW_006211022.1519264T/C59125
HP288GTCTATGAGGGCGTTTCTGC CAGCCTTCTTGTTCTGTTCGNW_006211252.1214288T/A59125

See Online Resource 2 for additional details on these and the remaining 14 primers examined

Tm: primer annealing temperature

Length: PCR product length

aLeft (forward) primer given above the right (reverse) primer

bAccession number from GenBank and position of the SNP in the scaffold

Table 2

Sanger genotypes for the 12 loci sequenced

Sample IDSpeciesLocationHP206 (G|C)HP379 (A|G)HP405 (C|G)HP429 (C|A)HP458 (C|T)HP501 (T|A)HP597 (C|A)HP633 (C|G)HP900 (C|G)HP930 (A|C)HP264a (C|T)HP288a (A|T)
Drom155 C. dromedarius AustraliaGGAACCCCCCTTCCCCCCAACCAA
Drom214 C. dromedarius SyriaGGAACCCCCCTTCCCCCCAACCAA
Drom814 C. dromedarius SudanGGAACCCCCCTTCCCCCCAACCAA
DC69 C. bactrianus MongoliaCCGGGGAATTAAAAGGGGCCTTTT
DC158 C. bactrianus AustriaCCGGGGAATTAAAAGGGGCCTTTT
DC352 C. bactrianus IranCCGGGGAATTAAAAGGGGCCTTTT
Hyb56F1 hybridb KazakhstanGCGAGCACCTTAACGCGCACTTTT
Hyb55F1 backcrossb KazakhstanCCGAGGAACTAAAAGGGGCCTTTT
DC575uncertain originKazakhstanCCGAGGACTTAAAAGCGGCCCTTT

The parentheses indicate the reference alleles (dromedary allele | Bactrian allele) identified from the whole-genome sequencing

Location: sample’s country of origin

HP206 ff.: SNP locus names

aThese loci show patterns inconsistent with a diagnostic SNP in the F1 hybrid

bF1 (dromedary female × Bactrian male); F1 backcross (F1 female × Bactrian male)

Primer sequences and information for the 12 diagnostic loci See Online Resource 2 for additional details on these and the remaining 14 primers examined Tm: primer annealing temperature Length: PCR product length aLeft (forward) primer given above the right (reverse) primer bAccession number from GenBank and position of the SNP in the scaffold Sanger genotypes for the 12 loci sequenced The parentheses indicate the reference alleles (dromedary allele | Bactrian allele) identified from the whole-genome sequencing Location: sample’s country of origin HP206 ff.: SNP locus names aThese loci show patterns inconsistent with a diagnostic SNP in the F1 hybrid bF1 (dromedary female × Bactrian male); F1 backcross (F1 female × Bactrian male) With this panel of diagnostic SNPs it is possible to identify F1 hybrids between dromedary and Bactrian camels and to differentiate F1 backcrosses to either parental species. Thus, we can validate the status of individuals with unclear parental origins in regions where the two species are extensively crossbred (e.g. Kazakhstan, Turkey). Because we selected short PCR fragments (≤150 bp) the panel can be applied in non-invasive, historical and archaeological (ancient) samples, where the morphology of the preserved materials cannot retrieve unambiguous classification (Gallik et al. 2015). Moreover, with this marker set we will be able to detect potential, rare dromedary introgression in Bactrian camel populations in Mongolia and China. As hybridization between domestic Bactrian camels and their wild relatives has been demonstrated (Silbermayr and Burger 2012; Silbermayr 2009), the threat for dromedary introgression into the last wild two-humped camels (C. ferus) in the Mongolian Gobi (Yadamsuren et al. 2012) and Chinese Taklimakan and Lop Nor deserts (Lei et al. 2012) is small but existing. Therefore, this primer set is an important contribution to the conservation of the genetic integrity of this critically endangered species. Below is the link to the electronic supplementary material. Supplementary material 1 (PDF 112 kb) Supplementary material 2 (PDF 32 kb) Supplementary material 3 (PDF 61 kb)
  3 in total

1.  From FastQ data to high confidence variant calls: the Genome Analysis Toolkit best practices pipeline.

Authors:  Geraldine A Van der Auwera; Mauricio O Carneiro; Christopher Hartl; Ryan Poplin; Guillermo Del Angel; Ami Levy-Moonshine; Tadeusz Jordan; Khalid Shakir; David Roazen; Joel Thibault; Eric Banks; Kiran V Garimella; David Altshuler; Stacey Gabriel; Mark A DePristo
Journal:  Curr Protoc Bioinformatics       Date:  2013

2.  Primer3--new capabilities and interfaces.

Authors:  Andreas Untergasser; Ioana Cutcutache; Triinu Koressaar; Jian Ye; Brant C Faircloth; Maido Remm; Steven G Rozen
Journal:  Nucleic Acids Res       Date:  2012-06-22       Impact factor: 16.971

3.  A sunken ship of the desert at the river Danube in Tulln, Austria.

Authors:  Alfred Galik; Elmira Mohandesan; Gerhard Forstenpointner; Ute Maria Scholz; Emily Ruiz; Martin Krenn; Pamela Burger
Journal:  PLoS One       Date:  2015-04-01       Impact factor: 3.240

  3 in total
  2 in total

1.  A sunken ship of the desert at the river Danube in Tulln, Austria.

Authors:  Alfred Galik; Elmira Mohandesan; Gerhard Forstenpointner; Ute Maria Scholz; Emily Ruiz; Martin Krenn; Pamela Burger
Journal:  PLoS One       Date:  2015-04-01       Impact factor: 3.240

2.  The history of Old World camelids in the light of molecular genetics.

Authors:  Pamela Anna Burger
Journal:  Trop Anim Health Prod       Date:  2016-04-05       Impact factor: 1.559

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.