| Literature DB >> 26161164 |
Emily Ruiz1, Elmira Mohandesan1, Robert R Fitak1, Pamela A Burger1.
Abstract
The technique to produce hybrid Tulu or Nar camels from crosses between dromedary and Bactrian camels is common throughout Middle Eastern and Central Asian countries. Formerly, these hybrids were highly valued as strong and persistent pack animals but today are bred to improve milk or wool quality in the respective species and for camel wrestling. We developed a diagnostic single nucleotide polymorphism (SNP) panel to identify cryptic ancestry in F1 hybrids and their backcrosses by selecting loci from whole genome data, which were fixed for different alleles in either dromedary or domestic and wild Bactrian camel. With this SNP panel we are able to identify the hybridization patterns in camels with uncertain origins, support hybrid breeding management and to detect potential rare dromedary introgression in the last wild Bactrian camels in Mongolia and China.Entities:
Keywords: Camelus bactrianus; Camelus dromedarius; Hybrid camel; Introgression; Next generation sequencing (NGS); Single nucleotide polymorphisms (SNPs)
Year: 2015 PMID: 26161164 PMCID: PMC4486411 DOI: 10.1007/s12686-015-0420-z
Source DB: PubMed Journal: Conserv Genet Resour Impact factor: 0.973
Primer sequences and information for the 12 diagnostic loci
| Locus | Primer sequence (5′–3′)a | Scaffoldb | Positionb | Alleles | Tm | Length |
|---|---|---|---|---|---|---|
| HP206 | TGTCAGACTGTTAGGCATTGC CATCCAAGTCTCCATCTAACCC | NW_006210212.1 | 501206 | C/G | 57 | 125 |
| HP379 | AGGATGCCATCATGTCAGG GAGGGAGCTCTCATGAATAGG | NW_006210464.1 | 1151379 | G/A | 58 | 150 |
| HP405 | CCAGGAGCTTTTCGAGTAGC CAGCACAGAGAACTCACTGC | NW_006211106.1 | 5030405 | G/C | 59 | 125 |
| HP429 | GCAGGCATACAAACTAACCC GCTTTTCTTTCTGGCTCAGG | NW_006210666.1 | 2288429 | A/C | 57 | 125 |
| HP458 | TGTGACCAGACAGACCAAGG TGTGGCTTAGGGTCTTTATGG | NW_006210457.1 | 11458 | T/C | 58 | 140 |
| HP501 | GAATAGATTGGGGAGCAAGC CTCTTCTCCATCCCTATGGC | NW_006211169.1 | 218501 | A/T | 59 | 125 |
| HP597 | ATGAACAGTTTGGGTTTGGG CGCGATGTCACCTTTATAGG | NW_006211126.1 | 6065597 | A/C | 59 | 125 |
| HP633 | GCATGTAGAAGGTTTGCATAGG CAGCCTTTCTTGCATCTGG | NW_006210489.1 | 4279633 | G/C | 57 | 125 |
| HP900 | CCACATGCTCAGGTATCTGG GGGATTCCTTGTGCTACAGC | NW_006211075.1 | 294900 | G/C | 59 | 125 |
| HP930 | CTCCCAGGAAACAAAAGTCC TTTGGGAGTGTTCTGTCTGC | NW_006210745.1 | 3459930 | C/A | 59 | 125 |
| HP264 | TGGACAGAAACTTTGTGTCTCC TTTGGTAAGGGCATGAATCC | NW_006211022.1 | 519264 | T/C | 59 | 125 |
| HP288 | GTCTATGAGGGCGTTTCTGC CAGCCTTCTTGTTCTGTTCG | NW_006211252.1 | 214288 | T/A | 59 | 125 |
See Online Resource 2 for additional details on these and the remaining 14 primers examined
Tm: primer annealing temperature
Length: PCR product length
aLeft (forward) primer given above the right (reverse) primer
bAccession number from GenBank and position of the SNP in the scaffold
Sanger genotypes for the 12 loci sequenced
| Sample ID | Species | Location | HP206 (G|C) | HP379 (A|G) | HP405 (C|G) | HP429 (C|A) | HP458 (C|T) | HP501 (T|A) | HP597 (C|A) | HP633 (C|G) | HP900 (C|G) | HP930 (A|C) | HP264a (C|T) | HP288a (A|T) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Drom155 |
| Australia | GG | AA | CC | CC | CC | TT | CC | CC | CC | AA | CC | AA |
| Drom214 |
| Syria | GG | AA | CC | CC | CC | TT | CC | CC | CC | AA | CC | AA |
| Drom814 |
| Sudan | GG | AA | CC | CC | CC | TT | CC | CC | CC | AA | CC | AA |
| DC69 |
| Mongolia | CC | GG | GG | AA | TT | AA | AA | GG | GG | CC | TT | TT |
| DC158 |
| Austria | CC | GG | GG | AA | TT | AA | AA | GG | GG | CC | TT | TT |
| DC352 |
| Iran | CC | GG | GG | AA | TT | AA | AA | GG | GG | CC | TT | TT |
| Hyb56 | F1 hybridb | Kazakhstan | GC | GA | GC | AC | CT | TA | AC | GC | GC | AC | TT | TT |
| Hyb55 | F1 backcrossb | Kazakhstan | CC | GA | GG | AA | CT | AA | AA | GG | GG | CC | TT | TT |
| DC575 | uncertain origin | Kazakhstan | CC | GA | GG | AC | TT | AA | AA | GC | GG | CC | CT | TT |
The parentheses indicate the reference alleles (dromedary allele | Bactrian allele) identified from the whole-genome sequencing
Location: sample’s country of origin
HP206 ff.: SNP locus names
aThese loci show patterns inconsistent with a diagnostic SNP in the F1 hybrid
bF1 (dromedary female × Bactrian male); F1 backcross (F1 female × Bactrian male)