| Literature DB >> 26156199 |
Zhiqin Xi1, Wanni Deng2, Liang Wang1, Fei Xiao1, Jie Li1, Zhihua Wang1, Xin Wang1, Xiujuan Mi1, Na Wang1, Xuefeng Wang3.
Abstract
Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.Entities:
Keywords: Epilepsy; Intractable; NSF; Synapse
Mesh:
Substances:
Year: 2015 PMID: 26156199 DOI: 10.1007/s12031-015-0596-4
Source DB: PubMed Journal: J Mol Neurosci ISSN: 0895-8696 Impact factor: 3.444