Literature DB >> 26152569

QTL mapping of thrips resistance in pepper.

Awang Maharijaya1,2, Ben Vosman1, Greet Steenhuis-Broers1, Koen Pelgrom1, Agus Purwito2, Richard G F Visser1, Roeland E Voorrips3.   

Abstract

KEY MESSAGE: A QTL for thrips resistance on pepper chromosome 6 was identified and validated. This QTL affects thrips larval development and explains 50% of the variation. Thrips is one of the most damaging pests in pepper (Capsicum). Resistance to thrips was identified in Capsicum annuum. This study was aimed at the elucidation of the genetic background of thrips resistance in Capsicum through QTL mapping. The QTL analysis was carried out for Frankliniella occidentalis resistance in an F2 population consisting of 196 plants derived from an interspecific cross between the highly resistant C. annuum AC 1979 as female parent and the highly susceptible C. chinense 4661 as male parent. Fifty-seven SSR, 109 AFLP, and 5 SNP markers were used to construct a genetic map with a total length of 1636 cM. Damage caused by larvae and the survival of first and second instar larval stages observed in a no-choice test were used as parameters of resistance. Interval mapping detected one QTL for each of these parameters, all co-localizing near the same marker on chromosome 6. Use of this marker as co-factor in a multiple-QTL mapping analysis failed to uncover any additional QTLs. This QTL explained about 50% of the genetic variation, and the resistance allele of this QTL was inherited from the resistant parent. Thrips resistance was not linked to trichome density.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26152569      PMCID: PMC4572063          DOI: 10.1007/s00122-015-2558-1

Source DB:  PubMed          Journal:  Theor Appl Genet        ISSN: 0040-5752            Impact factor:   5.699


Introduction

Pepper (Capsicum) production worldwide is constrained by thrips as one of the most damaging pests (Siemonsma and Piluek 1994). Adult thrips are about 1 mm long, and females are usually a bit larger than males. They belong to the insect order Thysanoptera. There are at least 16 species of thrips that attack Capsicum (Talekar 1991; Capinera 2001). Among these is Frankliniella occidentalis, which is the major species found on pepper in Europe (Tommasini and Maini 1995), and it has recently been found in Asia as well (Zhang et al. 2007). Thrips cause direct damage by feeding on pepper fruits, flowers, and leaves (Welter et al. 1990; Tommasini and Maini 1995; Shipp et al. 1998). Feeding of thrips on leaves may affect leaf size and carbon allocation in the plant (Welter et al. 1990; Shipp et al. 1998), reduce photosynthetic capacity (Tommasini and Maini 1995), and eventually reduce yield (Steiner 1990; Welter et al. 1990). Thrips feeding on pepper fruit causes bronzing and silvering of the fruit skin, thereby reducing market quality (Shipp et al. 1998). Thrips can also transmit several viruses, one of the most important being Tomato Spotted Wilt Virus (TSWV) (Ulman et al. 1992). This virus is acquired during the first and early second larval stage when there is a temporary association between mid-gut, visceral muscles, and salivary glands (Moritz et al. 2004). After that, the virus is transferred into a plant with the saliva of a feeding adult (Jones 2005). Thrips management and control practices include chemical treatments, biological control, and integrated pest management. Unfortunately, they do not completely solve the problems caused by thrips (Reitz et al. 2003; Weintraub 2007). Thrips-resistant varieties would increase the effectiveness of thrips control. Resistance to thrips may also delay and reduce the transmission of viruses as was shown by Maris et al. (2003) for TSWV. Several pepper accessions have been found to carry resistance to thrips which may be exploited further to breed thrips-resistant varieties (Fery and Schalk 1991; Maris et al. 2003; Maharijaya et al. 2011, 2012). Molecular marker linkage maps have been constructed for several Capsicum populations (Minamiyama et al. 2006; Yi et al. 2006; Barchi et al. 2007; Lee et al. 2009; Wu et al. 2009). These have been used to detect quantitative trait loci (QTLs) for plant development and fruit characteristics (Palloix et al. 2009; Borovsky and Paran 2011) and for resistance against pathogens, including anthracnose (Colletotrichum spp.) (Voorrips et al. 2004), Phytophthora capsici (Thabuis et al. 2004), and powdery mildew (Lefebvre et al. 2003). For resistance to thrips in pepper, a QTL has been identified by Syngenta Biotechnology Inc. on chromosome 5 (Linders et al. 2010). In other crops, QTLs for resistance to thrips were detected in cowpea (Muchero et al. 2010), potato (Galvez et al. 2005), common bean (Frei et al. 2005), and cabbage (Loptien 2013). In earlier papers, we described the identification and characterisation of several sources of thrips resistance. We developed test methods to evaluate plant resistance to thrips and showed that these in vitro tests (detached leaf assays) correlate well with greenhouse tests based on damage scores (Maharijaya et al. 2011). The effect of resistance in pepper on thrips reproduction and development was studied using three highly resistant, three medium resistant, and three susceptible accessions. Resistance factors in leaves of resistant pepper accessions were shown to have significant effects, mostly on the larval stages. These factors completely blocked the development of L1 larvae to the L2 stage on the resistant accessions (Maharijaya et al. 2012). Our current study was aimed at elucidating the genetic basis of the resistance to thrips that we identified earlier in Capsicum annuum AC 1979 (Maharijaya et al. 2011, 2012) through a QTL mapping approach. Since the resistant parent of our population was the same as the one used by Linders et al. (2010) we compared the mapping results. The presence of trichomes has been implicated in resistance against the thrips Scirtothrips dorsalis (Yadwad et al. 2008) in pepper, therefore we included this trait in our study as well.

Materials and methods

Plant material

A mapping population consisting of 196 F2 plants was developed from a cross between C. annuum AC 1979 as female parent and C. chinense 4661 as male parent. The parents were chosen based on evaluation results for resistance against two thrips species, F. occidentalis and Thrips parvispinus using several different resistance tests (Maharijaya et al. 2011, 2012). Capsicum annuum AC 1979 was highly resistant while C. chinense 4661 was very susceptible in these tests. Apart from the contrasting resistance levels the parents also differ in leaf characteristics (Wahyuni et al. 2011) including trichome density: C. annuum AC 1979 does not have trichomes while C. chinense 4661 is densely covered with trichomes. Both accessions were obtained from the Centre for Genetic Resources, the Netherlands. An interspecific cross was used to obtain a sufficient level of polymorphism in the F2 population. The F2 population was grown together with two first-generation inbred lines, obtained by self-pollination of the two parental plants, and with cuttings of the F1 in a glasshouse at Wageningen University and Research Centre, the Netherlands. From 4 F2 plants that were heterozygous for marker Isotig18917-234 (close to the QTL maximum) F3 lines were obtained by selfing. A total of 41 F3 plants were used in this study. The plants were maintained in a glasshouse at 25 °C, 16/8 h day/night without pesticide application. Pests were controlled biologically using predator organisms according to standard Dutch pepper cultivation practices. Seeds were sown in rockwool plugs in trays; seedlings were transplanted onto rockwool 5 weeks after germination. The F3 plants were grown under the same conditions but in a later year.

Thrips

A F. occidentalis population was collected from thrips-infested Arabidopsis thaliana plants in a greenhouse of Wageningen UR (Wageningen, the Netherlands). After confirmation of the collected thrips as F. occidentalis a population was developed and maintained by rearing female thrips on small cucumber fruits in a climate chamber at 25 °C, 16/8 h day/night. Thrips larvae (L1 stage) were obtained by allowing thrips to lay eggs in small cucumber fruits for 1 day, after which the adult thrips were brushed off and fruits were kept at 25 °C for 4 days, when the larvae emerged (Mollema et al. 1993). The number of synchronized larvae was sufficient to infest a complete replication of the resistance test in 1 day.

Resistance test

Five newly emerged F. occidentalis L1 larvae were placed on a single fresh fully opened leaf that was placed with the abaxial side downwards in a sterile 50 × 9 mm petri dish with lid (BD Falcon®). We used the third to sixth fully opened leaf counting from the top of the stem, taken from plants between 6 and 9 weeks after transplanting. Leaves and larvae were incubated in a climate chamber at 25 °C, 16 h light, and 70 % RH. Damage caused by larvae was scored after 2 days using a visual scale ranging from 0 (no damage) to 3 (severe damage) as described in Maharijaya et al. (2011). Development of L1 larvae into the L2 stage was assessed by counting the number of L2 larvae and dividing this by the total number of larvae placed on the leaf. The transition from larval stage L1 to L2 was determined by the presence of skin tissue that remained on the leaf disk after molting, which can be seen under a stereo microscope. Development of L2 larvae was assessed by counting the number of pre-pupae divided by the original number of L1 larvae. Pre-pupae can be recognized by the presence of short wing sheaths. Leaves were replaced by fresh ones every 3 days until all larvae had died or reached the pre-pupa stage; this required incubation and observation up to 8 days. These two parameters are referred to as “survival to L2” and “survival to pre-pupa,” respectively. For the F2 population experiment, each replication consisted of one petri dish per F2 plant, three dishes for each parental inbred, and two dishes of the F1. The complete F2 test consisted of five replications. The F3 lines experiment consisted of four replications, each with one dish per F3 plant. In both tests, each replication was started on a single day with approximately 1 week intervals.

Trichome density

Trichome density was scored according to a visual scale: 0 (<50 cm−2), 1 (50–100 cm−2), 2 (100–200 cm−2), and 3 (>200 cm−2) at the region near the veins and midrib on the abaxial side of a fully developed leaf. Observations of trichome density were done at three different plant stages: early vegetative stage (3 weeks after transplanting), vegetative stage (6 weeks after transplanting), and reproductive stage (9 weeks after transplanting). Observations were performed on the third to sixth fully expanded leaf, counting from the top of the stem.

Statistical analysis

F2 population experiment

Means for each F2 plant, the parental inbreds and the F1 were obtained by ANOVA analysis with the five replications of the resistance test as blocks, after transforming the fraction survival to L2 and pre-pupa stages as y = arcsine (sqrt(x)) in order to stabilize variances. Pearson correlation coefficients were calculated for the three parameters observed in the resistance test and leaf trichome densities, based on the means of F2 individuals. Broad-sense heritability was estimated for all parameters according to Allard (1999) using the formula: Heritability (h2) = (σ2F2 − (σ2F1 + σ2PR + σ2PS)/3)/(σ2F2), where σ2F2, σ2F1, σ2PR, and σ2PS are the variances of the F2, F1, resistant, and susceptible parent, respectively.

F3 lines experiment

Like in the F2 experiment, means for each F3 plant were obtained by ANOVA analysis with the four replications of the resistance test as blocks, after transforming the fraction survival to L2 and pre-pupa stages as y = arcsine (sqrt(x)) in order to stabilize variances. The means per plant were treated as response variable in a linear regression model with F3 line and marker score (0 = homozygous annuum allele, 1 = heterozygous, and 2 = homozygous chinense allele) as regressors.

Molecular markers and linkage map

The KingFisher® (www.thermo.com) device was used with the AGOWA mag® Maxi DNA Isolation Kit (www.agowa.de) for isolating genomic DNA of the F2 and F3 individuals, F1, and parents. AFLP (Amplified Fragment Length Polymorphism) markers as described by Vos et al. (1995) were detected using combinations of EcoRI and MseI or PstI and MseI primers with two selective nucleotides for PstI and three selective nucleotides for EcoRI. The pre-amplification primers were E01, P00, and M02. Fifteen primers combination were used: P17-M39, P17-M32, P14-M50, P14-M49, P14-M48, P14-M41, P11-M61, P11-M48, E38-M49, E36-M48, E35-M58, E35-M49, E35-M48, E34-M48, and E32-M49 [primer sequences as in Keygene (2004)]. The PstI and EcoRI primers were labeled with fluorescent dyes IRD700 and IRD 800 (Li-Cor, Lincoln, USA). The AFLP products were separated and visualized on a 6 % denaturing polyacrylamide gel using a Li-Cor® sequencer. AFLP data were scored using Quantar software (Keygene®). Polymorphic bands were scored co-dominantly when there was a distinct difference in intensities between putatively homozygous and heterozygous bands. Fifty-seven primer pairs were used to amplify simple sequence repeat (SSR) markers, which were used to assign the linkage groups obtained to pepper chromosomes based on published maps (Yi et al. 2006; Lee et al. 2009; Wu et al. 2009) and an unpublished map from INRA (Institut National de La Recherche Agronomique, France; personal communication, Dr. A. Palloix) (Table 1). The PCR mix for SSR markers contained 5 µl of 50 ng genomic DNA, 0.25 µl 1 M each of forward and reverse primer, 0.4 µl dNTP, 1 µl LC Green® (Idaho Technology), 0.1 µL Phire™ Hot Start DNA Polymerase (Finnzymes®), 2 µL buffer, and 5 µl MQ. The solution was overlaid with 20 µL of mineral oil. The thermal cycling condition were set as follows: incubation at 94 °C for 2 min, 40 cycles of 94 °C for 60 s, 60 °C for 60 s, 72 °C for 60 s, followed by 5 min 72 °C extension, and hold at 4 °C. The PCR products were analyzed with the LightScanner® system (Idaho Technology) using melting temperature from 60 to 95 °C at the default melting rate (0.1 °C s−1). LightScanner® analysis software was used to normalize the curves and to score them as heterozygote or one of the two homozygotes. In cases where the heterozygote patterns could not be well discriminated from one of the homozygotes the marker was scored dominantly. Four SNP markers [LM_2001, LM_2002, LM_2004, LM_2006, developed by Linders et al. (2010)] were used as reference for the position of the QTL for thrips resistance identified chromosome 5 by this group. One SNP marker (Isotig18917-234, personal communication, Dr. A. Palloix) close to the maximum of the thrips resistance QTL on chromosome 6 identified in the present study was used as reference for this QTL. The PCR protocol, visualization, and scoring methods for these markers were the same as those for SSR primers. PCR primers for the 57 SSR and 5 SNP markers are listed in Table 1.
Table 1

List of chromosome assignments and primers for SSR and SNP markers

MarkersChr.a Forward primer (5′–3′)Reverse primer (5′–3′)
1Epms 7251TTGAATCGTTGAAGCCCATTATCTGAAGCTGGGCTCCTTT
2Hpms 1-411GGGTATCATCCGTTGAAAGTTAGGCAAGAGGTATCACAACATGAGAGG
3Hpms 1-2811TGAGGCAGTGGTATGGTCTGCCCCGAGTTCGTCTGCCAATAG
4Gpms 1692TCGAACAAATGGGTCATGTGGATGAGGGTCCTGTGCTACC
5Gpms 372ATTTGTATATTATTTCTTGGCCTTGTGAACTACCCAATTCCAGCC
6Hpms E0733TTATTCAGGCCCACTTATCGAACAGCAGCCAAATTCTTGATTTC
7Hpms E0083CCCCTTAACTTTTAATTCTAGATCTGCTCGTTGTTCCTCCATCACCTCA
8Gpms 1983AGCTTTAGACAGTGTCTGCGTGTGATGATAAATTGCCTTCCG
9Epms 3863ACGCCAAGAAAATCATCTCCCCATTGCTGAAGAAAATGGG
10Hpms E1223GCAATGGCTCAGGTCTCCATCTTGTCGCCCTTTAATGCAAAACC
11Gpms 933ATCCTTGGCGTATTTTGCACTTCACTTTGCACACAGGCTT
12HpmsAT2 144TTTAGGGTTTCCAACTCTTCTTCCCTAACCCCACCAAGCAAAACAC
13Hpms 1-1654GGCTATTTCCGACAAACCCTCAGCCATTGGTGTTTTCACTGTTGTG
14Hpms E0994CAATCATTGCCACCTTATTTTTGCTCACAAGGGGTTGATGGAAATG
15Hpms E0554GGCCGCTTAAAGTTGTTCAAGGTGTGGCTAGCGGTGTTATGCAC
16Hpms E0494CACTCCAACAGCAGCAGCAAACCCTTGCCGATGTTGAAGCTTTT
17Hpms E0854TGCCCAAATATCAGTCAAGCTCATGGTTGTTGTTCTCATGGTGGTG
18Hpms E1114CCATCATTTCTCCCCAATTCCAGAGAGCAGAAGAAGGGGTGGTG
19Hpms E1165CATCTCTCCGTTGAATCTATTTCCACGGTCATCCATTAGAACCGTA
20Hpms 2-455CGAAAGGTAGTTTTGGGCCTTTGTGGGCCCAATATGCTTAAGAGC
21Gpms 1655TGAACAATAATAATTGACAGGACAGAGCCTCGCAGTTTGTTCTTAC
22Hpms 2-235CCCTCGGCTCAGGATAAATACCCCCAGACTCCCACTTTGTG
23Hpms E0155TTGTGAGGGTTTGACACTGGGACCGAGCTCGATGAGGATGAACT
24Hpms E0146CTTTGGAACATTTCTTTGGGGGGCGGACGTAGCAGTAGGTTTGG
25Hpms E0886GCAAATGGTTCCCTAAACTGCTTGCTCTCCGTTTCCGATGTGATT
26Hpms E0786TTTGTGAAGAAGCAACCGGTGATGTGAGGAAGAAAGTGCGAAGG
27Hpms 1-56CCAAACGAACCGATGAACACTCGACAATGTTGAAAAAGGTGGAAGAC
28HpmsAT2-206TGCACTGTCTTGTGTTAAAATGACGAAAATTGCACAAATATGGCTGCTG
29HpmsE1136CCCTAAAGCTCGAGAAATTGAAGCGAATGCTGTTGCTGGGGTTGTT
30Epms 3766ACCCACCTTCATCAACAACCATTTGTGGCTTTTCGAAACG
31Hpms E0687TGTTCCTTTTGTTGTTACCTTTTGCGTCTAGGAATGGAAGAAGAGC
32Hpms E0577ACCCACTCCCTCTCCTCTTTGGGCAGTGGAAAAACAGTCCTGTGG
33Hpms 1-2277CGTGGCTTCAAGTATGGACTGCGGGGCGGAACTTTTCTTATCC
34Epms 3428CTGGTAGTTGCAAGAGTAGATCGATGATCTTTGACGACGAGGG
35Hpms E1151/8TCATCTCATAGCCTGCCCCCTACCACTTGAAGAAGCCATGACCA
36Hpms 1-1481/8GGCGGAGAAGAACTAGACGATTAGCCCACCCATTCCACATAGACG
37Hpms E0041/8TGGGAAGAGAAATTGTGAAAGCACAATGCCAACAATGGCATCCTA
38Epms 3108TGGGAAGAGAAATTGTGAAAGCAGGAAACATGGTTCAATGCC
39Gpms 1949AGGTGGCAGTTGAGGCTAAGGTTCTAGGTCTTTGCCCTGG
40Hpms 1-39TGGGAAATAGGATGCGCTAAACCAACTTTAAGACTCAAAATCCATAACC
41Hpms E0519TGGCCAGCTTCACACAGAGGTATGTCACAATATTGGAGGCCAGAA
42Epms 4199TTCAGGTGCAGGTATCATCGGGGTACTTGTCCATTTATCCAG
43Hpms E1439CCATTCAGCTAGGGTTCAGTCCACGACCAAATCGAATCTTCGTGA
44Hpms E01310GCGCCAAGTGAGTTGAATTGATCACCAATCCGCTTGCTGTTGTA
45Hpms E05910GCAAGGACGCAGTCGTTAGACACCGCCTGTGCTGAATTGTTTAG
46Hpms 2-2110TTTTTCAATTGATGCATGACCGATACATGTCATTTTGTCATTGATTTGG
47Hpms E06510TGAAATAGGCCAATCCCTTTGCATTCCCTGGGATTCCTGCATTA
48Hpms E03110CCCTAAATCAACCCCAAATTCAACCCCCATTACCTGACTGCAAAA
49Hpms E09610CGGGTCAAACAAAAACCGAAGTGCTTGTGGTTGAGCTCGCTCTT
50Gpms 15910AAGAACATGAGGAACTTTAACCATGTTCACCCTTCTCCGACTCC
51Epms 56111ATTGGACTTCAAATTTGGCCAAACCAAAATCAGCATTAAAATATAAAC
52Epms 41011GGAAACTAAACACACTTTCTCTCTCACTGGACGCCAGTTTGATTC
53Epms 39111TTTCTTCTCTGGCCCTTTTGACGCCTATTGCGAATTTCAG
54Hpms 2-211GCAAGGATGCTTAGTTGGGTGTCTCCCAAAATTACCTTGCAGCAC
55Hpms E09412CCAGTTGAGAGCTGCTGCAAAACACCAACAAAACAAAGGCCACA
56Hpms E12812TGGATCCCAAAAGACTCAGAACATATTTCCCTCAGTCGAGGTCGT
57Hpms E06412CCCTCCTTTTACCTCGTCAAAAAATGCCAAGGAGCAATGAGAACC
58LM_20015CTTTGGAGGTAGCGGTATGCAACAAACGAACCACAATG
59LM_20025CCCGTTTACAAGCAAAGAGGACCCCTGAAGAACCTCTC
60LM_20045TGTAGGATTACAAGAACATTATCGGCGAGCTATTACACCGAAG
61LM_20065TCGGCCTGACTAGTATTGACCGGGTACCAGATGTAGGG
62Isotig18917-2346ACTAGTAAGAGCAGGGGTGTCAATAGATCCAAATGCAGATTGAAC

Putative chromosome positions and primer sequences of the Hpms markers are based on Lee et al. (2009) and Yi et al. (2006); of the Gpms and Epms markers on an unpublished Institut National de La Recherche Agronomique (INRA, France) map (personal communication, Dr. A. Palloix) and Wu et al. (2009); of the LM markers on Linders et al. (2010); of SNP marker Isotig18917-234 were communicated by Dr A. Palloix

aPutative chromosome position

List of chromosome assignments and primers for SSR and SNP markers Putative chromosome positions and primer sequences of the Hpms markers are based on Lee et al. (2009) and Yi et al. (2006); of the Gpms and Epms markers on an unpublished Institut National de La Recherche Agronomique (INRA, France) map (personal communication, Dr. A. Palloix) and Wu et al. (2009); of the LM markers on Linders et al. (2010); of SNP marker Isotig18917-234 were communicated by Dr A. Palloix aPutative chromosome position A linkage map was constructed using JoinMap 4.1 software (Van Ooijen 2006). Markers with more than about 40 missing values were discarded. Groups of markers of a more or less constant composition over a range of LOD values were used as a starting point to create linkage groups. Where multiple linkage groups were found with SSR markers known to reside on the same pepper chromosome an attempt was made to combine the markers into one linkage group. Mapping within linkage groups was carried out with the regression algorithm and a maximum jump level of 5. The final result was obtained by deleting markers that did not fit well as judged by the nearest neighbor stress or the mean Chi square contribution.

QTL mapping

Potential QTLs for damage, larval survival, and trichome density were identified using the MapQTL 6.0 package (Van Ooijen 2009). First, interval mapping analysis was performed to find regions with potential QTL effects. Second, co-dominant markers in these regions were used as co-factors in multiple-QTL mapping (MQM). Significance thresholds of log of odds (LOD) corresponding to a genome-wide confidence level of P < 0.05 were determined for each trait using the permutation test of MapQTL 6.0 with 1000 iterations. The QTL graphs were prepared with MapChart 2.3 (Voorrips 2002).

Results

Thrips resistance in the F2 population

The F2 population showed a continuous variation for damage caused by larvae, for survival from L1 to L2, and for survival to pre-pupa (Fig. 1). Frequency distributions of damage and survival to pre-pupa were skewed toward the resistant parent, while for survival to L2 it was skewed toward the susceptible parent. In all replicates of the resistant parent, the damage was 0 and the survival to L2 and survival to pre-pupa was very low, while all replicates of the susceptible parent exhibited significant feeding damage and very high rates of survival to L2 and to pre-pupa. The broad-sense heritability of all parameters scored in the laboratory tests with F. occidentalis was high (Table 2).
Fig. 1

Frequency distributions for overall damage caused by first instar larva, survival to L2 (second larval stage), and survival to pre-pupa in F2 population from a cross between resistant and susceptible accessions of pepper. Arrows indicate the approximate means of the resistant parent (R), susceptible parent (S), F1 and F2 population

Table 2

Values of resistance-related traits for parents, F1 and F2 plants after infestation with newly emerged L1 larvae of Frankliniella occidentalis

Damageb Survival to L2c Survival to pre-pupad
Resistant parent0.00 ± 0.00a 0.20 ± 0.120.20 ± 0.12
Susceptible parent2.73 ± 0.041.57 ± 0.001.36 ± 0.20
F1 0.40 ± 0.280.60 ± 0.060.55 ± 0.12
F2 1.16 ± 0.690.88 ± 0.380.66 ± 0.38
Heritabilitye 0.940.960.93

aMean ± standard deviation

bScore of relative damage caused by L1 larvae of F. occidentalis at 2 days after infestation: 0 (no damage) to 3 (severe damage)

carcsine(sqrt(x)) transformation of fraction of L1 larvae that survived to L2 stage

darcsine(sqrt(x)) transformation of fraction of L1 larvae that survived to pre-pupa stage

eBroad sense heritability

Frequency distributions for overall damage caused by first instar larva, survival to L2 (second larval stage), and survival to pre-pupa in F2 population from a cross between resistant and susceptible accessions of pepper. Arrows indicate the approximate means of the resistant parent (R), susceptible parent (S), F1 and F2 population Values of resistance-related traits for parents, F1 and F2 plants after infestation with newly emerged L1 larvae of Frankliniella occidentalis aMean ± standard deviation bScore of relative damage caused by L1 larvae of F. occidentalis at 2 days after infestation: 0 (no damage) to 3 (severe damage) carcsine(sqrt(x)) transformation of fraction of L1 larvae that survived to L2 stage darcsine(sqrt(x)) transformation of fraction of L1 larvae that survived to pre-pupa stage eBroad sense heritability Damage caused by larvae, survival of L1 to L2 and survival to pre-pupa were highly correlated with coefficients 0.68–0.78 (P < 0.001). None of the parameters scored in the resistance tests were significantly correlated with trichome density (Table 3).
Table 3

Spearman rank correlation coefficients and significance between all parameters scored in the F2 population

Survival to L2a Survival to pre-pupab Leaf trichome density
Early vegetativeLate vegetativeReproductive
Damage caused by larva0.68*0.72*0.130.110.12
Survival to L2a 0.78*0.100.090.09
Survival to pre-pupab 0.080.090.09
Leaf trichome density
 Early vegetative0.86*0.71*
 Late vegetative0.83*

Leaf trichome density was measured in three life stages of the plant

* Indicates significance P < 0.001

aarcsine(sqrt(x)) of fraction of L1 larvae that survived to L2 stage

barcsine(sqrt(x)) of fraction of L1 larvae that survived to pre-pupa stage

Spearman rank correlation coefficients and significance between all parameters scored in the F2 population Leaf trichome density was measured in three life stages of the plant * Indicates significance P < 0.001 aarcsine(sqrt(x)) of fraction of L1 larvae that survived to L2 stage barcsine(sqrt(x)) of fraction of L1 larvae that survived to pre-pupa stage

Linkage map

A linkage map was constructed consisting of 22 linkage groups. The linkage groups varied in length between 16.5 and 197.8 cM, with a total length of 1636.2 cM. The total map included 171 markers (57 SSR, 109 AFLP, and 5 SNP), of which 88 (51.5 %) were scored co-dominantly. Linkage groups were assigned to pepper chromosomes based on SSR anchor markers. Seven chromosomes (1, 2, 6, 7, 8, 9, and 11) had only one linkage group assigned, while the other five had two or in one case (chromosome 3) three linkage groups assigned. Four linkage groups consisting of a total of 20 AFLPs and spanning 205.1 cM could not be assigned to chromosomes. Four markers (LM_2001, LM_2002, LM_2004, and LM_2006) described by Linders et al. (2010) as mapping to chromosome 5 were confirmed to map on that chromosome. Interval mapping of damage, survival to L2, and survival to pre-pupa all resulted in the detection of the same, highly significant QTL on chromosome 6 (P06, Fig. 2). MQM mapping using the marker nearest to the top of the three LOD profiles (Hpms078) as co-factor failed to reveal any additional QTLs. In particular, no QTL signal was found on chromosome 5 at the four markers mentioned by Linders et al. (2010) to target a QTL for thrips resistance (Fig. 2). The LOD scores at marker Hpms078 were 20.6, 24.3, and 18.8, with an explained phenotypic variance of 43.9, 49.4, and 41.1 % for damage, survival of L1 to L2, and survival to pre-pupa, respectively (Table 4); a LOD threshold of 3.6 corresponding to a genome-wide P = 0.05 was estimated by a 1000-fold permutation test for all three traits. Since the heritabilities of damage, survival to L2 and survival to pre-pupa were 0.94, 0.96, and 0.93 (Table 2), the QTL explained 46.7, 51.5, and 44.2 %, respectively, of the genetic variance in the F2 for the three traits. The resistance allele of this QTL was inherited from the resistant parent. The dominance effect of the QTL was small in comparison with the additive effect, with susceptibility being partially dominant over resistance (Table 4).
Fig. 2

LOD profiles and 1-LOD and 2-LOD support intervals for resistance QTLs on chromosomes 5 and 6. Solid, dashed, and dot-dashed lines represent the profiles for damage, survival to L2, and survival to pre-pupae, respectively, after inoculation with newly emerged L1 larvae of F. occidentalis. The dotted line at LOD 3.6 represents the LOD threshold. On chromosome 5 no QTLs were detected for these traits

Table 4

QTL effects for resistance-related traits after inoculation with F. occidentalis and for leaf trichome density

TraitsMarker at QTL peakChromosomePositiona LODb Additive effectc Dominance effect% Expl.d
DamageHpmsE078P06108.420.6−0.660.1043.9
Survival to L2e HpmsE078P06108.424.3−0.370.0949.4
Survival to pre-pupaf HpmsE078P06108.418.8−0.340.1041.1
Trichome density early vegetativeg HpmsE031P10b40.515.4−0.630.1430.4
Trichome density late vegetativeg HpmsE031P10b40.521.7−0.690.2639.9
Trichome density reproductiveg HpmsE031P10b40.527.5−0.740.3047.5

aPosition of the QTL, in cM, referred to the linkage group

bLogarithm of the odds (LOD); for all six traits a threshold of 3.6, corresponding to a genome-wide confidence level of 0.05, was estimated from permutation tests

cNegative values indicate that C. annuum alleles result in lower genotypic values than C. chinense alleles

dPercentage of phenotypic variance explained by each QTL

earcsine(sqrt(x)) of fraction of L1 larvae that survived to L2 stage

farcsine(sqrt(x)) of fraction of L1 larvae that survived to pre-pupa stage

gbased on a visual scale: 0 (<50 cm−2), 1 (50–100/cm−2), 2 (100–200 cm−2), and 3 (>200 cm−2) at the region near to the veins and midrib on the abaxial leaf surface of fully developed leaves at three different plant stages: early vegetative stage (3 weeks after planting), vegetative stage (6 weeks after planting), and reproduction stage (9 weeks after planting)

LOD profiles and 1-LOD and 2-LOD support intervals for resistance QTLs on chromosomes 5 and 6. Solid, dashed, and dot-dashed lines represent the profiles for damage, survival to L2, and survival to pre-pupae, respectively, after inoculation with newly emerged L1 larvae of F. occidentalis. The dotted line at LOD 3.6 represents the LOD threshold. On chromosome 5 no QTLs were detected for these traits QTL effects for resistance-related traits after inoculation with F. occidentalis and for leaf trichome density aPosition of the QTL, in cM, referred to the linkage group bLogarithm of the odds (LOD); for all six traits a threshold of 3.6, corresponding to a genome-wide confidence level of 0.05, was estimated from permutation tests cNegative values indicate that C. annuum alleles result in lower genotypic values than C. chinense alleles dPercentage of phenotypic variance explained by each QTL earcsine(sqrt(x)) of fraction of L1 larvae that survived to L2 stage farcsine(sqrt(x)) of fraction of L1 larvae that survived to pre-pupa stage gbased on a visual scale: 0 (<50 cm−2), 1 (50–100/cm−2), 2 (100–200 cm−2), and 3 (>200 cm−2) at the region near to the veins and midrib on the abaxial leaf surface of fully developed leaves at three different plant stages: early vegetative stage (3 weeks after planting), vegetative stage (6 weeks after planting), and reproduction stage (9 weeks after planting) For each of the three leaf ages in which observations were made for leaf trichome density a highly significant QTL was detected on chromosome 10 (Fig. 3). The LOD scores for the detected QTL at all leaf ages were above the LOD score corresponding to a genome-wide confidence level of 95 %, which was 3.6 as determined by permutation test with 1000 iterations. The peak of the LOD profile for leaves at early vegetative, vegetative, and reproductive stage was near marker HpmsE031; at this marker, 30.4, 39.9, and 47.5 % of the variance of the F2 plant means were explained by the QTL, respectively. Use of HpmsE031 as co-factor in MQM analysis failed to uncover any additional QTLs.
Fig. 3

LOD profiles and 1-LOD and 2-LOD support intervals for QTL for trichome density on chromosome 10. Solid, dashes, and dot-dashed lines represent the trichome density at early vegetative, late vegetative, and reproductive stage, respectively. The dotted line at LOD 3.6 represents the LOD threshold

LOD profiles and 1-LOD and 2-LOD support intervals for QTL for trichome density on chromosome 10. Solid, dashes, and dot-dashed lines represent the trichome density at early vegetative, late vegetative, and reproductive stage, respectively. The dotted line at LOD 3.6 represents the LOD threshold

Confirmation of the resistance QTL on chromosome 6 in F3 lines

The effect of the QTL was validated in a set of four F3 lines, each originating from an F2 plant heterozygous at the SNP marker Isotig18917-234, close to the QTL maximum (Table 5). Overall regression analysis showed significant effects of the marker on all three parameters: damage score (P = 0.013), survival to L2 stage (P = 0.011), and survival to pre-pupa stage (P = 0.012). The effects of the individual F3 lines were not significantly different from each other at P = 0.05, except marginally between lines 40 and 43 for survival to L2 stage (P = 0.043).
Table 5

Mean scores for three resistance-related traits in the F3-line experiment, averaged per line and per genotype for marker Isotig18917-234

TraitDamageSurvival to L2a Survival to pre-pupaa
Genotypeb RRRSSSTotalRRRSSSTotalRRRSSSTotal
F3-line
 400.99 (7)c 0.75 (5)2.05 (5)1.23 (17)0.26 (7)0.09 (5)0.85 (5)0.37 (17)0.17 (7)0.07 (5)0.71 (5)0.27 (17)
 432.00 (1)2.00 (7)2.03 (3)2.01 (11)0.67 (1)0.80 (7)0.80 (3)0.79 (11)0.50 (1)0.60 (7)0.67 (3)0.61 (11)
 1340.50 (1)2.07 (5)(0)1.81 (6)0.12 (1)0.59 (5)(0)0.50 (6)0.01 (1)0.39 (5)(0)0.30 (6)
 2111.06 (4)1.30 (2)3.00 (1)1.41 (7)0.30 (4)0.31 (2)0.97 (1)0.42 (7)0.16 (4)0.11 (2)0.89 (1)0.24 (7)
 Total1.05 (13)1.61 (19)2.15 (9)1.55 (41)0.29 (13)0.50 (19)0.85 (9)0.52 (41)0.17 (13)0.33 (19)0.72 (9)0.36 (41)

aThe means for survival to L2 and pre-pupa stages were calculated on the transformed scale and back-transformed to the original scale

bThe genotypes for marker Isotig18917-234 are coded as RR: homozygous for the resistant (C. annuum) parent allele, RS: heterozygous, SS: homozygous for the susceptible (C. chinense) parent allele

cNumbers in brackets are the numbers of plants per category

Mean scores for three resistance-related traits in the F3-line experiment, averaged per line and per genotype for marker Isotig18917-234 aThe means for survival to L2 and pre-pupa stages were calculated on the transformed scale and back-transformed to the original scale bThe genotypes for marker Isotig18917-234 are coded as RR: homozygous for the resistant (C. annuum) parent allele, RS: heterozygous, SS: homozygous for the susceptible (C. chinense) parent allele cNumbers in brackets are the numbers of plants per category

Discussion

The high heritabilities found for thrips resistance as measured by damage, survival to L2, and survival to pre-pupa indicate that variation due to environmental factors was minor relative to genetic effects. This was achieved using a climate room with controlled environmental conditions and a thrips rearing that supplied us with large quantities of uniform and synchronized larvae. This is an important advantage for genetic studies in comparison with greenhouse or field tests. In previous work (Maharijaya et al. 2011), we have shown that the resistance estimated from the laboratory test corresponds well with that estimated from greenhouse and field tests. The high correlations between damage caused by larvae, survival to L2, and survival to pre-pupa indicate that differences in tolerance (i.e., the ability of the plant to restrict symptom development in spite of the presence and activities of the pest) do not play an important role in this case. The low number of larvae that survived on resistant plants shows that the mechanism of pepper defense against thrips larvae is based on antibiosis (Horber 1980). It has been reported before that resistance in pepper blocks larval development of F. occidentalis in pepper (Maris et al. 2004; Maharijaya et al. 2012).

Trichome density is not related to thrips resistance in pepper

No correlation was found between trichome density and any of the resistance parameters in our study with F. occidentalis. Also the resistant parent of our mapping population was glabrous, while the susceptible parent carried trichomes. This contrasts with an earlier finding that trichomes are associated with resistance to a different thrips species (S. dorsalis) in pepper (Yadwad et al. 2008). This difference might be caused by the difference in thrips species, but also by the fact that Yadwad et al. (2008) rated the resistance based on damage caused by adult thrips in a preference test, whereas we used a no-choice test with larvae. Further, the significant correlations of thrips resistance and trichome density found by Yadwad et al. (2008) were F2 population specific. For only four out of seven F2 populations, each consisting of 60 plants, they found a significant correlation of resistance against thrips with trichome density at the mature pepper stage (R = 0.27–0.48), and no correlation was found for any of those seven populations at flowering stage. Twenty-two linkage groups were constructed, for twelve chromosomes in the haploid pepper genome. The mapping of SSR markers in our linkage map was consistent with that in previous populations (Minamiyama et al. 2006; Yi et al. 2006; Barchi et al. 2007; Wu et al. 2009). The total length of our linkage map was 1630 cM which is comparable to the maps published by these authors. Although in several cases we still have more than one linkage group per chromosome, it is likely that our map covers most of the pepper genome.

One major QTL for thrips resistance on chromosome 6 of pepper

Since the three parameters of resistance in our test: damage, survival to L2, and survival to pre-pupa were highly correlated (Table 3), it is not surprising that the QTLs found for those three parameters co-localize near the same markers on chromosome 6. Only one QTL was detected for all three parameters, even when using a MQM approach. This QTL explained about 50 % of the genetic variation for the three parameters, leaving the other half unexplained. Since most of the genome is covered by our linkage map the missing genetic effect cannot be caused by other major QTLs, as these would have been detected by the MQM mapping. Therefore it is likely that several QTLs with small effects are segregating in this population as well. In principle the presence of other QTL might be deduced from differences in the average level of resistance of the four F3 lines. We did not detect any significant F3-line effects, but this may be due to the limited size of each line and the fact that each segregated for the major QTL. While the major QTL has a small dominance effect with susceptibility partially dominant over resistance, the mean of the F2 population is near to the midparent value and the F1 is more resistant than the midparent, which suggests that the residual genetic effects are (partially) dominant for resistance. The major QTL described by Linders et al. (2010) on chromosome 5 was not detected in our study, in spite of the fact that we included several markers linked to it. Likewise they gave no hint of a possible resistance QTL on chromosome 6. As they used the same resistant parent as we did (C. annuum AC 1979), but a different susceptible parent, this suggests that at least two major factors are involved in the resistance present in the shared parent, but that in both mapping populations only one of these segregated. If this is true, our susceptible parent contains the resistant allele of the QTL on chromosome 5. As this parent is indeed highly susceptible (Maharijaya et al. 2011, 2012), the chromosome 5 QTL then does not provide any resistance in absence of the resistance allele on chromosome 6 QTL, and the reverse is also likely to be the case. It is less likely that the two QTL are specific to certain subpopulations of F. occidentalis since the resistance donor was even resistant to two different thrips species (F. occidentalis and T. parvispinus). An alternative hypothesis is that the different QTL are due to different test methods, as the assay of Linders et al. (2010) involved a period of 3–4 weeks of population development in a choice situation, whereas we studied survival and development of individual larvae in a no-choice situation. However, in earlier experiments (Maharijaya et al. 2011), we observed no antixenosis, so the choice vs non-choice contrast is unlikely to be an explanation for the discrepancy; and if the QTL on chromosome 6 was segregating in their population it would have had a large impact on population development and most likely have been detected. A highly significant QTL for trichome density was detected on chromosome 10. As expected from the absence of correlation between trichome density and resistance parameters, this QTL was not linked with the QTL for resistance. Our QTL for trichome density was found at the same position as the QTL found by Kim et al. (2010). The QTL on chromosome 6 is an important factor affecting thrips resistance in pepper, which implies that pepper breeders can benefit from the introgression of this QTL. As the source of resistance is an accession of C. annuum, which is the dominant pepper crop species, it may be assumed that the introgression of this region to other C. annuum will be straightforward.

Author contribution statement

AM, BV, and REV conceived the project. AM performed most of the practical work and was the main author of the manuscript. BV and REV supervised the work on a daily basis and contributed extensively to the manuscript. REV also produced the linkage map and performed the QTL analyses. RGFV and AP contributed to the writing of the manuscript. GSB assisted with the insect rearing and KP assisted with the marker assays.
  17 in total

1.  Metabolite biodiversity in pepper (Capsicum) fruits of thirty-two diverse accessions: variation in health-related compounds and implications for breeding.

Authors:  Yuni Wahyuni; Ana-Rosa Ballester; Enny Sudarmonowati; Raoul J Bino; Arnaud G Bovy
Journal:  Phytochemistry       Date:  2011-04-21       Impact factor: 4.072

2.  Tospovirus transmission depends on thrips ontogeny.

Authors:  Gerald Moritz; Sandra Kumm; Laurence Mound
Journal:  Virus Res       Date:  2004-03       Impact factor: 3.303

3.  A COSII genetic map of the pepper genome provides a detailed picture of synteny with tomato and new insights into recent chromosome evolution in the genus Capsicum.

Authors:  Feinan Wu; Nancy T Eannetta; Yimin Xu; Richard Durrett; Michael Mazourek; Molly M Jahn; Steven D Tanksley
Journal:  Theor Appl Genet       Date:  2009-02-20       Impact factor: 5.699

4.  AFLP: a new technique for DNA fingerprinting.

Authors:  P Vos; R Hogers; M Bleeker; M Reijans; T van de Lee; M Hornes; A Frijters; J Pot; J Peleman; M Kuiper
Journal:  Nucleic Acids Res       Date:  1995-11-11       Impact factor: 16.971

5.  Exploitation of pepper EST-SSRs and an SSR-based linkage map.

Authors:  Gibum Yi; Je Min Lee; Sanghyeob Lee; Doil Choi; Byung-Dong Kim
Journal:  Theor Appl Genet       Date:  2006-10-18       Impact factor: 5.699

6.  Characterization of fs10.1, a major QTL controlling fruit elongation in Capsicum.

Authors:  Yelena Borovsky; Ilan Paran
Journal:  Theor Appl Genet       Date:  2011-05-21       Impact factor: 5.699

7.  Construction of an integrated pepper map using RFLP, SSR, CAPS, AFLP, WRKY, rRAMP, and BAC end sequences.

Authors:  Heung-Ryul Lee; Ik-Hyun Bae; Soung-Woo Park; Hyoun-Joung Kim; Woong-Ki Min; Jung-Heon Han; Ki-Taek Kim; Byung-Dong Kim
Journal:  Mol Cells       Date:  2008-10-13       Impact factor: 5.034

8.  QTL analysis for resistance to foliar damage caused by Thrips tabaci and Frankliniella schultzei (Thysanoptera: Thripidae) feeding in cowpea [Vigna unguiculata (L.) Walp.].

Authors:  Wellington Muchero; Jeffrey D Ehlers; Philip A Roberts
Journal:  Mol Breed       Date:  2009-07-07       Impact factor: 2.589

9.  Integrated management tactics for Frankliniella thrips (Thysanoptera: Thripidae) in field-grown pepper.

Authors:  Stuart R Reitz; Erika L Yearby; Joseph E Funderburk; Julianne Stavisky; M Timur Momol; Steve M Olson
Journal:  J Econ Entomol       Date:  2003-08       Impact factor: 2.381

10.  Fine mapping of pepper trichome locus 1 controlling trichome formation in Capsicum annuum L. CM334.

Authors:  Hyun Jung Kim; Jung-Heon Han; Jin-Kyung Kwon; Minkyu Park; Byung-Dong Kim; Doil Choi
Journal:  Theor Appl Genet       Date:  2009-12-24       Impact factor: 5.699

View more
  6 in total

Review 1.  Integrated pest management in western flower thrips: past, present and future.

Authors:  Sanae Mouden; Kryss Facun Sarmiento; Peter Gl Klinkhamer; Kirsten A Leiss
Journal:  Pest Manag Sci       Date:  2017-02-28       Impact factor: 4.845

2.  Trichome Independent Resistance against Western Flower Thrips in Tomato.

Authors:  Johanna A Bac-Molenaar; Selena Mol; Maarten G Verlaan; Joke van Elven; Hye Kyong Kim; Peter G L Klinkhamer; Kirsten A Leiss; Klaas Vrieling
Journal:  Plant Cell Physiol       Date:  2019-05-01       Impact factor: 4.927

Review 3.  Overview of Biotic Stresses in Pepper (Capsicum spp.): Sources of Genetic Resistance, Molecular Breeding and Genomics.

Authors:  Mario Parisi; Daniela Alioto; Pasquale Tripodi
Journal:  Int J Mol Sci       Date:  2020-04-08       Impact factor: 5.923

Review 4.  Resistance to Thrips in Peanut and Implications for Management of Thrips and Thrips-Transmitted Orthotospoviruses in Peanut.

Authors:  Rajagopalbabu Srinivasan; Mark R Abney; Pin-Chu Lai; Albert K Culbreath; Shyam Tallury; Soraya C M Leal-Bertioli
Journal:  Front Plant Sci       Date:  2018-11-06       Impact factor: 5.753

5.  Conditioning the soil microbiome through plant-soil feedbacks suppresses an aboveground insect pest.

Authors:  Ana Pineda; Ian Kaplan; S Emilia Hannula; Wadih Ghanem; T Martijn Bezemer
Journal:  New Phytol       Date:  2020-02-03       Impact factor: 10.151

6.  Constitutive and Inducible Resistance to Thrips Do Not Correlate With Differences in Trichome Density or Enzymatic-Related Defenses in Chrysanthemum.

Authors:  Gang Chen; Peter G L Klinkhamer; Rocío Escobar-Bravo
Journal:  J Chem Ecol       Date:  2020-10-22       Impact factor: 2.626

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.