Molecular cloning and expression analysis of RrNHX1 and RrVHA-c genes related to salt tolerance in wild Rosa rugosa.

Salt stress is one important factor influencing the growth and development of plants, and salt tolerance of plants is a result of combined action of multiple genes and mechanisms. Rosa rugosa is not only an important ornamental plant, but also the natural aromatic plant of high value. Wild R. rugosa which is naturally distributed on the coast and islands of China has a good salt tolerance due to the special living environment. Here, the vacuolar Na(+)/H(+) reverse transporter gene (NHX1) and the vacuolar H(+)-ATPase subunit C gene (VHA-c) closely related to plant salt tolerance were isolated from wild R. rugosa, and the expression patterns in R. rugosa leaves of the two genes under NaCl stress were determined by real-time quantitative fluorescence PCR. The results showed that the RrNHX1 protein is a constitutive Na(+)/H(+) reverse transporter, the expression of the RrNHX1 gene first increased and then decreased with the increasing salt concentration, and had a time-controlled effect. The RrVHA-c gene is suggestive of the housekeeping feature, its expression pattern showed a similar variation trend with the RrNHX1 gene under the stress of different concentrations of NaCl, and its temporal expression level under 200 mM NaCl stress presented bimodal change. These findings indicated that RrNHX1 and RrVHA-c genes are closely associated with the salt tolerance trait of wild R. rugosa.

Introduction

Soil salinization is a widespread problem throughout the world. At present, about 20% of the farmland and nearly half of irrigated land are affected by high concentration salts. The high-concentration Na+ in soil will disrupt the ion balance in plants and cause metabolic disorder. As a result, the growth and development of the plants will be influenced, which finally leads to the crop yield decline. Salt stress has become one important factor influencing the growth and development of plants and reducing the crop yield (Waditee et al., 2006). Cultivating the plant species that can grow in alkali soil by improving the plant’s salt tolerance is an effective method to utilize and improve the alkali soil.

Salt tolerance of plants is a complex quantitative trait, which is a result of combined action of multiple genes and multiple salt tolerance mechanisms. Under salt stress, the plants will make a series of physiological and biochemical response, including the salt signal sensing and transduction, activation of specific transcriptional factors and expression of relevant genes (Zhang, 2003). Salt tolerance-related genes fall into two types: for one type, the encoded products act as the transferring molecules or regulatory molecules in the signal transduction process; the representatives are a variety of protein kinases and transcriptional factors. For the other type, the encoded products are effectors, such as the genes regulating the synthesis of osmoregulation substances, genes for synthesizing active oxygen-scavenging enzymes, genes for synthesizing osmotin, genes for synthesizing the proteins related to transmembrane transport of ions and the genes encoding transcriptional factors. By transgenic engineering, the salt tolerance-related genes are introduced into recipient plants. This technique for acquiring plants with salt tolerance is the hot spot of research in related field.

Na+/H+ reverse transporter is involved in the regulation of intracytoplasmic pH and Na+ as well as the changes of cell volume. It is an electrically neutral Na+/H+ 1:1 transmembrane transporter, the generation of which depends on the Na+/H+ concentration gradient (Blumwald and Poole, 1985; Yang et al., 2009). Na+/H+ reverse transporter in advanced plants is further divided into vacuole membrane protein and plasma membrane protein. They perform the functions of compartmentalization of Na+ in the vacuole and the transport of Na+ out of the cell. These are the two key processes in osmoregulation and intracytoplasmic Na+ detoxification and also necessary for plants to resist the salt stress (Sun, 2008). It is demonstrated by a large amount of studies that the compartmentalization of Na+ in the vacuole is an important mechanism of salt tolerance. This process is jointly accomplished by Na+/H+ reverse transporter and H+-ATPase on the vacuole membrane.

Along with the progress in molecular biology and the research into the biological mechanism of salt tolerance of plants, Na+/H+ reverse transporter genes have been cloned from a variety of plants, including OsNHX1 from Oryza sativa (Fukuda et al. 1999), AgNHX1 from Atriplex gmelini (Hamada et al., 2001), ThNHX1 from Thellungiella halophila (Wu et al., 2009), LeNHX1 from Lycopersicon esculentum (Venema et al., 2003), and LmNHX1 from Lobularia maritima (Popova and Golldack, 2007). It is shown by recent studies that the over-expression of exogenous vacuole membrane and plasma membrane Na+/H+ reverse transporter genes can significantly increase the salt tolerance of recipient plants. For example, Apse et al. (1999) introduced the AtNHX1 gene from Arabidopsis thaliana into L. esculentum and Brassica napus, with the effect of increasing their salt tolerance. Rajagopal et al. (2007) isolated the vacuole membrane Na+/H+ reverse transporter gene PgNHX1 from Pennisetum glaucum and transferred it into Brassica juncea to induce its over-expression. The result showed that the salt tolerance level of B. juncea was improved. The transgenic B. juncea carrying the over-expressed PgNHX1 which could survive under 300 mM NaCl, bloomed and grew normal seeds. This indicates that Na+/H+ reverse transporter is an important component in the complex salt tolerance mechanism of plants. It has the value of further research and utilization.

H+-ATPase is widely present in the plasma membrane and various endomembrane systems of animals and plants, playing an important role in the metabolic pathways. Three major types of membrane H+-ATPase have been known: plasma membrane P–H+-ATPase, mitochondrial F–H+-ATPase and vacuolar V–H+-ATPase. V–H+-ATPase (or V-ATPase) mainly exists on the endomembrane system of eukaryotes. Under the stress of salt, drought, cold and heavy metals, the viability of plant cells greatly depends on the activity of V-ATPase. The regulation of V-ATPase gene expression and activity is the basis for plants to adapt to the adverse environment (Zhang and An, 2013). Studies show that under salt stress, the activity of V-ATPase in most salt-resistant plants and the gene expression of subunits presented correlation with salt stress. As a halophyte, Suaeda salsa can enhance the V-ATPase activity to propel ion storage in the vacuole to induce salt adaptability (Wang et al., 2001; Dong, 2012). The study on the response of V-ATPase to salt stress indicated that subunit C was more sensitive and the transcription level was increased significantly (Tsiantis et al., 1996). Under salt stress, the expression of V-ATPase subunit C in Tortula ruralis (Chen et al., 2002), Mesembryanthemum crystallinum (Low et al., 1996) and Limonium bicolor (Jiang et al., 2009) was significantly upregulated. Five homologous genes encoding the V-ATPase subunit C in A. thaliana presented obvious upregulation under salt stress. It is thus indicated that subunit C plays an important role in resisting salt stress for plants.

Rosa rugosa is a deciduous shrub belonging to genus Rosa, Rosaceae family. It is not only an ideal plant material for landscape greening, but also a natural aromatic plant of high value. The native range of R. rugosa includes Northeastern China, Northern Japan, the Korean Peninsula, and the Russian Far East (Fu, 1992; Feng et al., 2010). In China, wild R. rugosa is naturally distributed on the coast and islands of Southern Liaoning Province, Eastern Shandong Province, and Tumen River estuary in Jilin Province, and is classified as an endangered species (Fu, 1992; Bruun, 2005). Wild R. rugosa has a good salt tolerance due to the special living environment. It is usually used as the parental material for breeding new salt-resistant varieties of genus Rosa. In this study, the vacuolar Na+/H+ reverse transporter gene (NHX1) and vacuolar H+-ATPase subunit C gene (VHA-c) closely related to salt tolerance were isolated from wild R. rugosa produced in China. The expression patterns under salt stress were quantified. The result is of theoretical importance and application value for understanding the functions of the two genes and the salt-resistant mechanism of wild R. rugosa and for employing genetic engineering to breeding new salt-resistant varieties of genus Rosa.

Materials and methods

Plant materials and treatments

The experiment materials were wild R. rugosa from the seaside of Weihai, Shandong Province. The plants were cultivated in plastic pots of the same specification (33 cm × 19 cm × 22 cm) with one plant per pot. The salt stress treatment was performed depending on the research objective. In order to prevent the influence of precipitation, the experiment was carried out in a smart greenhouse.

The following experiment was carried out to determine the influence of salt stress treatment of different concentrations on salt tolerance-related genes: Four treatments were performed with four pots per treatment, 100, 200 and 300 mM NaCl solutions were used to slowly irrigate the potted R. rugosa (water collection plate at the bottom to prevent the loss of effluent), and the control plants were irrigated with water without NaCl. After preliminary experiment, the dose was determined as 1 L. The young leaves of each plant were randomly collected after salt stress treatments for 6 h. The specimens were immediately stored in liquid nitrogen to take back to laboratory and preserved in −80 °C ultralow temperature freezer for RNA extraction.

The experiment was carried out to detect the influence of treatment duration on the expression of salt tolerance-related genes: 1 L of 200 mM NaCl solution was used to irrigate the potted wild R. rugosa in a total of 16 pots. The first sampling (0 h) was done before the salt stress treatment, then the young leaves were collected after treatment for 6 h, 12 h, 24 h and 48 h, respectively. Four pots were randomly selected for sampling, and the young leaves were randomly collected from each plant. To maintain the stability of salt concentration in the treatment period and to prevent the influence of water evaporation on salt concentration, 1 L of 200 mM NaCl solution was irrigated every 6 h.

RNA extraction and purification

Total RNA was isolated from wild R. rugosa leaves according to a modified CTAB method (Zhao et al., 2011). RNA samples were performed with DNase using DNase I kit (TaKaRa, Japan) according to the manufacturer’s guidelines before reverse-transcription, and then quantified by a spectrophotometer (Eppendorf, Germany) at 230 nm, 260 nm and 280 nm.

Isolation of salt tolerance genes

The two key genes related to salt tolerance in wild R. rugosa, RrNHX and RrVHA-c, were isolated according to the experimental system established in our laboratory (Feng et al., 2014).

3′RACE

Total RNA of leaf tissue (1 mg) was used to synthesize the first strand cDNA according to the manufacturer’s instructions of the 3′ full RACE Core Set Ver. 2.0 (TaKaRa, Japan). The 3′ ends of genes were amplified in two rounds of PCR with the gene-specific primers (Table 1) designed according to the reported NHX1 and VHA-c genes of other plants from GenBank. The first PCR was performed by denaturing the cDNA at 94 °C for 3 min followed by 20 cycles of amplification (94 °C for 30 s, 53 °C for 30 s, 72 °C for 120 s (for RrNHX1)) and extension at 72 °C for 10 min. The product of the first round PCR was used as template in the nested PCR amplification and 30 cycles were run under other PCR conditions like in the case of first PCR.

Table 1

Primers used for cloning of the RrNHX1 and RrVHA-c genes related to salt tolerance in wild R. rugosa.

Primer	Oligonucleotide sequence(5′–3′)	Application	Annealing condition
			Temperature (°C)	Time (S)
RrNHX1-1	GGAGGCGGATACAATGGC	1st of 3′RACE	53	120
RrNHX1-2	GGTATGGATGCCTTGGAC	2nd of 3′RACE	53	120
RrNHX1-3	GCTCGGGAGGAAAGAATGATGCCAAC	5′RACE	65	120
RrVHA-c1	GCGAAGAGTGGAGTAGGAGT	1st of 3′RACE	51	60
RrVHA-c2	TGGTTATGCTCATCTCTCG	2nd of 3′RACE	52	60
RrVHA-c3	ACCATATTACCACTTGCTGCTGGAGGCT	5′RACE	66	60

5′RACE

Total RNA of leaf tissue (1 mg) was used to synthesize the first strand cDNA according to the manufacturer’s instructions of the SMARTer™ RACE cDNA Amplification Kit User Manual (Clontech Laboratories, Inc., TAKARA). The gene-specific primers were designed and synthesized according to the above sequenced 3′ ends (Table 1). Then touchdown PCR was performed using the following program: 5 cycles of 30 s at 94 °C and 90 s at 72 °C, 5 cycles of 30 s at 94 °C, 30 s at 70 °C and 1 min at 72 °C, 30 cycles of 30 s at 94 °C, 30 s at 65 °C and 120 s at 72 °C (for RrNHX1). Conditions of the other gene amplification are also listed in Table 1.

Purifying, cloning and sequencing

The isolated PCR products were recovered from the 1% agarose gel, purified using the TaKaRa Agarose Gel DNA Purification Kit Ver. 2.0 (TaKaRa, Japan), cloned into the PMD18-T vector (TaKaRa, Japan) and transformed into competent Escherichia coli DH5a cells (Trans, China). The recombinant plasmids were identified with the restriction enzymes BamHI and HindIII (TaKaRa, Japan) and the positive clones were sequenced in Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China).

Sequence analysis

The full-length cDNA sequences were analyzed using the DNAMAN 5.0 software. Homology search was carried out online at the nucleotide level with BLASTn and at the amino acid level with BLASTp ().

Gene expression analysis

mRNA relative expression of RrNHX1 and RrVHA-c was analyzed by the method of real-time quantitative RT-PCR with a BIO-RAD CFX96™ Real-Time System (C1000™ Thermal Cycler) (Bio-Rad, USA). cDNA was synthesized from 1 μg RNA using PrimeScript® RT reagent Kit with gDNA Eraser (TaKaRa, Japan). Rosa hybrid α-tubulin subunit actin gene (GenBank Accession No. AF394915.1) was used as an internal constitutively expressed control in the real-time quantitative RT-PCR analysis. PCR was performed using the primers shown in Table 2. Quantitative real-time PCR experiments were performed according to the instructions of the SYBR® Premix Ex Taq™ (Perfect Real Time) (TaKaRa, Japan) and contained 2× SYBR Premix Ex Taq™ 12.5 μl, 50× ROX Reference Dye II 0.5 μl, 2 μl cDNA solution as a template, 1 μl mix solution of target gene primers and 9 μl ddH2O in a total volume of 25 μl. The amplification was performed by an initial incubation at 50 °C for 2 min and at 95 °C for 5 min, then followed by 40 cycles of 15 s at 95 °C, 15 s at 51 °C, and 40 s at 72 °C. Expression levels for each gene were calculated by the 2−△△Ct comparative threshold cycle (Ct) method (Schmittgen and Livak, 2008). The Ct values were generated from the Bio-Rad CFX Manager V1.6.541.1028 software. All samples were repeated three times.

Table 2

Gene-specific primer sequences for detection by real-time quantitative fluorescence PCR.

Gene	Forward primer (5′–3′)	Reverse primer (5′–3′)
Actin	TGAGGCCATTTACGACAT	AGATCACAGGAGCATAGGAG
RrNHX1	TTCGCTGGACATAGGGGA	TGGTGCTTGCAAAAAACA
RrVHA-c	GCCCTCGTCTTCTCCTGTA	CTAACACCAGCATCACCA

Statistical analysis

All data were average values of four replicates with standard deviations (SD). Statistical analyses were carried out by the SAS/STAT statistical analysis package (version 6.12, SAS Institute, Cary, NC, USA).

Results

Isolation and sequence analysis of salt tolerance gene from wild R. rugosa

RNA extracted from the leaves of wild R. rugosa was taken as template, the full-length cDNA sequences were obtained for genes RrNHX1 and RrVHA-c related to the salt tolerance by means of RACE, and the GenBank accession numbers were KC188664 and KF677023. The full-length cDNA sequence of the gene RrNHX1 was 2358 bp. It contained start codon, complete open reading frame (1629 bp), stop codon, 5′ noncoding region (462 bp), 3′ noncoding region (267 bp) and poly (A) tail (12 bp), encoding 543 amino acids in total. The analysis of BLAST indicated that the amino acid sequences of the gene NHX1 in plants such as Rosa hybrida, Malus zumi, Glycine max and Populus trichocarpa had 81–99% identity and 90–99% similarity with the gene RrNHX1 (Table 4). The full-length cDNA sequence of the gene RrVHA-c was 795 bp, containing start codon, complete open reading frame (498 bp), stop codon, 5′ noncoding region (63 bp), 3′ noncoding region (334 bp) and poly (A) tail (12 bp) and encoding 166 amino acids in total. The analysis of BLAST indicated that amino acid sequences of the gene VHA-c in plants such as A. thaliana, Cucumis sativus, Gossypium hirsutum and Populus trichocarpa had 99% identity and 99–100% similarity with the gene RrVHA-c (Tables 3 and 4), this suggested that VHA-c is a highly conserved membrane protein.

Table 4

Comparison of deduced protein of RrNHX1 and RrVHA-c genes from wild R. rugosa with other plants.

Gene	Species	GenBank Accession No.	Identity (%)	Similarity (%)
RrNHX1	Rosa hybrida	BAD93487	99	99
	Malus zumi	ADB80440	87	92
	Glycine max	AAY43006	82	90
	Populus trichocarpa	XP_002328385	81	91
RrVHA-c	Arabidopsis thaliana	NP_177693	99	99
	Cucumis sativus	XP004152663	99	99
	Gossypium hirsutum	AAA82977	99	100
	Populus trichocarpa	XP002307699	99	100

Expression analysis of RrNHX1 and RrVHA-c genes under salt stress

According to the results of fluorescence quantitative PCR (Fig. 1), the expressions of RrNHX1 and RrVHA-c genes could be detected in the leaves without salt stress. However, the salt stress treatment caused the upregulation of RrNHX1 and RrVHA-c genes.

Figure 1

Expression analysis of RrNHX1 and RrVHA-c genes under the stress of different concentrations of NaCl for 6 h. Bars represent mean ± SD. ∗∗∗P < 0.005 (t test).

It is seen from Fig. 1 that the RrNHX1 gene was obviously upregulated after 6 h of 100, 200 and 300 mM NaCl treatment. The expression levels were 2.46, 4.66 and 1.57 times that of the control samples without salt stress. Under 200 mM NaCl stress, the expression level of RrNHX1 in leaves increased continuously within 24 h. At 6 and 12 h, the expression level was 3.57 and 4.96 times that of the control group. The highest expression level was achieved at 24 h, which was 12.16 times that of the control group. At 48 h, the expression level decreased to 2.27 times that of the control (Fig. 2).

Figure 2

Expression analysis of RrNHX1 and RrVHA-c genes under the stress of 200 mM NaCl at different times. Bars represent mean ± SD. ∗∗∗P < 0.005 (t test).

The expression patterns of the RrVHA-c gene and the RrNHX1 gene showed a similar variation trend under the stress of different concentrations of NaCl, but the variation of the expression level was milder. After 6 h of 100, 200 and 300 mM NaCl stress, the expression level of the RrVHA-c gene was 1.64, 2.35 and 0.42 times that of the control (Fig. 1). Under 200 mM NaCl stress, the expression level of RrVHA-c in leaves was 2.62, 2.11, 3.68 and 1.09 times that of the control at 6, 12, 24 and 48 h, respectively. That is, within 24 h, the general increasing trend was presented, with a slight reduction at 12 h. The highest expression level was detected at 24 h. And the expression decreased to the level comparable to the control at 48 h (Fig. 2).

Discussion

Vacuolar Na+/H+ reverse transporter compartmentalizes Na+ in the vacuole as an effective mechanism to adapt to salt stress. V-ATPase is responsible for maintaining the ion homeostasis in cytoplasm and a normal cellular metabolism to make the plant more adaptable to the salt environment. In this article, the full-length cDNA sequence of the vacuolar Na+/H+ reverse transporter gene RrNHX1 and the vacuolar H+-ATPase subunit C gene RrVHA-c from wild R. rugosa was obtained by using RT-PCR and RACE technique. The result showed that gene copy number of the vacuolar Na+/H+ reverse transporter differed from one plant species to another. Blast analysis was performed for cDNA sequence of RrVHA-c. It was found that although most genes had similarity of over 80% with RrVHA-c, the identity was only about 60%. Blast analysis was also performed to the predicted amino acid sequences. Among 100 amino acid sequences that were matched in GenBank, most had an identity and similarity of over 95% with the amino acid sequences of RrVHA-c. This indicates that vacuolar H+-ATPase subunit C is a highly conserved membrane protein.

By analyzing the expression pattern of the RrNHX1 gene in wild R. rugosa, it was found that the expression of the RrNHX1 gene was detected in the control group without salt stress treatment. This indicates that the RrNHX1 protein is a constitutive Na+/H+ reverse transporter. And for wild R. rugosa, the RrNHX1 gene was upregulated under salt stress within a certain range. This indicated that the RrNHX1 gene was associated with the salt tolerance of wild R. rugosa. The RrNHX1 gene was obviously upregulated after 6 h of 100 and 200 mM NaCl stress. However, the variation of expression under 300 mM NaCl stress was not obvious. The same variation trend was observed in the leaves of plantlets of Malus zumi: the expression level of the MzNHX1 gene first increased and then decreased with the increasing salt concentration, and the expression level of the MzNHX1 gene was lower than that of the control under high salt stress (200 mM) (Meng, 2010). Another study also found that Na+ began to be transported from the root of rice to the aboveground part and accumulated in leaves after 2 h of salt stress (Liu, 2006; Matushita and Matosh, 1991). Thus, after 6 h of 100 and 200 mM NaCl stress, the increase of RrNHX1 on the transcription level may be caused by the accumulation of Na+ in leaves. Under 300 mM NaCl stress, the gene expression level was not high. This is probably because an excess salt concentration injures the leaves to some extent, and the expression of the RrNHX1 gene was inhibited. Another possible reason is that the transport of Na+ from the root of wild R. rugosa to the aboveground part is inhibited by high salt concentration, and the efflux of Na+ from root took effect (Shi et al., 2002; Shi et al., 2003).

The RrNHX1 gene showed a continuously increasing expression within 24 h under 200 mM NaCl stress. However, the expression amount dropped to the original level at 48 h. It was indicated that the expression of the RrNHX1 gene had a time-controlled effect. This variation trend is similar to that of vacuolar Na+/H+ reverse transporter Osant1 in the leaves of rice under 200 mM NaCl stress (Liu, 2006). The RrNHX1 gene was still expressed continuously under high salt stress (200 mM NaCl), which indicates the strong salt tolerance of wild R. rugosa.

V-ATPase is a biologically active holoenzyme assembled by subunits at a certain proportion. Subunit C is the core structure of V-ATPase V0- sector in the form of hexamer, and participates in the formation of proton channel. Therefore, the activity of subunit C directly influences the amount and activity of V-ATPase. A high expression of subunit C will cause the increase of the amount and activity of V-ATPase (Xu, 2005). This study shows that under normal conditions, RrVHA-c is expressed to some degree, which is suggestive of the housekeeping feature, RrVHA-c expression is necessary for maintaining the normal physiological action and life activities of plants. Under salt stress, RrVHA-c was upregulated, which was consistent with the upregulation of the V-ATPase subunit C in T. ruralis (Chen et al., 2002), M. crystallinum (Low et al., 1996) and L. bicolor (Jiang et al., 2009). In addition, the RrVHA-c gene was obviously upregulated after 6 h of 100 and 200 mM NaCl stress. However, the expression level was lower than the control under 300 mM NaCl stress. The upregulation of the RrVHA-c gene may be explained by the fact that the cells need the energy provided by V-ATPase to support the metabolism under salt stress (Fu et al., 2009). The expression level of the RrVHA-c gene was lower than that of the control under 300 mM NaCl stress, which also may be related to the inhibited transport of Na+ to the aboveground part due to leaf damage and high salt concentration.

Author contribution statement

L.S. and L.F. designed the study. L.F. and H.D. drafted the manuscript. H.D. carried out gene isolation, sequence analysis, and gene expression analysis. J.W. and M.W. participated in complementation tests. W.X. and S.Z. helped to draft the manuscript. All authors read and approved the manuscript.

Conflict of interest

The authors declare that they have no conflict of interest.

Table 3

Sequence analysis of RrNHX1 and RrVHA-c genes related to salt tolerance from wild R. rugosa.

Gene	Full length (bp)	ORF (bp)	3′-UTR (bp)	5′-UTR (bp)	Poly A (bp)	Amino acid
RrNHX1	2358	1629	267	462	12	543
RrVHA-c	795	498	334	63	12	166