Nanjing Ji1, Ling Li1, Lingxiao Lin1, Senjie Lin2. 1. State Key Laboratory of Marine Environmental Science, Xiamen University, Xiamen, Fujian 361005, China. 2. State Key Laboratory of Marine Environmental Science, Xiamen University, Xiamen, Fujian 361005, China; Department of Marine Sciences, University of Connecticut, Groton, Connecticut 06340, United States of America.
Abstract
The raphidophyte Heterosigma akashiwo is a globally distributed harmful alga that has been associated with fish kills in coastal waters. To understand the mechanisms of H. akashiwo bloom formation, gene expression analysis is often required. To accurately characterize the expression levels of a gene of interest, proper reference genes are essential. In this study, we assessed ten of the previously reported algal candidate genes (rpL17-2, rpL23, cox2, cal, tua, tub, ef1, 18S, gapdh, and mdh) for their suitability as reference genes in this species. We used qRT-PCR to quantify the expression levels of these genes in H. akashiwo grown under different temperatures, light intensities, nutrient concentrations, and time points over a diel cycle. The expression stability of these genes was evaluated using geNorm and NormFinder algorithms. Although none of these genes exhibited invariable expression levels, cal, tub, rpL17-2 and rpL23 expression levels were the most stable across the different conditions tested. For further validation, these selected genes were used to normalize the expression levels of ribulose-1, 5-bisphosphate carboxylase/oxygenase large unite (HrbcL) over a diel cycle. Results showed that the expression of HrbcL normalized against each of these reference genes was the highest at midday and lowest at midnight, similar to the diel patterns typically documented for this gene in algae. While the validated reference genes will be useful for future gene expression studies on H. akashiwo, we expect that the procedure used in this study may be helpful to future efforts to screen reference genes for other algae.
The raphidophyte Heterosigma akashiwo is a globally distributed harmful alga that has been associated with fish kills in coastal waters. To understand the mechanisms of H. akashiwo bloom formation, gene expression analysis is often required. To accurately characterize the expression levels of a gene of interest, proper reference genes are essential. In this study, we assessed ten of the previously reported algal candidate genes (rpL17-2, rpL23, cox2, cal, tua, tub, ef1, 18S, gapdh, and mdh) for their suitability as reference genes in this species. We used qRT-PCR to quantify the expression levels of these genes in H. akashiwo grown under different temperatures, light intensities, nutrient concentrations, and time points over a diel cycle. The expression stability of these genes was evaluated using geNorm and NormFinder algorithms. Although none of these genes exhibited invariable expression levels, cal, tub, rpL17-2 and rpL23 expression levels were the most stable across the different conditions tested. For further validation, these selected genes were used to normalize the expression levels of ribulose-1, 5-bisphosphate carboxylase/oxygenase large unite (HrbcL) over a diel cycle. Results showed that the expression of HrbcL normalized against each of these reference genes was the highest at midday and lowest at midnight, similar to the diel patterns typically documented for this gene in algae. While the validated reference genes will be useful for future gene expression studies on H. akashiwo, we expect that the procedure used in this study may be helpful to future efforts to screen reference genes for other algae.
Harmful algal blooms (HABs) cause significant damages to marine ecosystems, local economies and human health [1-3]. Heterosigma akashiwo (Hada) Hada ex Y. Hara et Chihara is a HAB species within the class Raphidophyceae. This species is distributed worldwide, and is an eurythermal and euryhaline organism [4, 5]. H. akashiwo is notorious because its blooms have caused massive mortality of cultured finfish, but the mechanisms for ichthyotoxicity are not well resolved and remain controversial [6-9]. To understand how H. akashiwo forms blooms [10-13] and how the bloom kill fish, information on the molecular machinery or biochemical processes regulating growth and metabolism in this species is of great importance. Determining gene expression patterns under different environmental conditions is essential toward gaining such understanding.Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) is one of the most frequently-used technologies to study the expression patterns of genes, because it offers high sensitivity, specificity, reproducibility and accuracy [14, 15]. However, several variables associated with RNA samples may influence the accuracy of gene expression analysis, such as variations in RNA quantity and quality, enzymatic efficiency of reverse transcription and PCR amplification [16]. One common way to correct the biases caused by these factors is to normalize gene expression data against some properly established reference genes (housekeeping genes) [17-19]. Generally, an ideal reference gene should be expressed at stable levels in different tissues, under different treatments, or under different environmental conditions. Many genes have been used as reference genes, such as 18S ribosomal RNA (18S), glyceraldehyde-3-phosphate dehydrogenase (gapdh) and elongation factor 1α (ef1), simply because they have been shown to be appropriate in some model organisms. But, they have subsequently been found not to be always expressed at stable levels under different conditions in different species [20, 21]. Therefore, it is necessary to establish the suitability of the reference gene(s) for different species or specific types of conditions before use in gene expression studies. Until now, many studies have been carried out using or selecting reference genes in animals and plants [22-24] as well as algae (S1 Table). Yet no comprehensive screening for reference genes for H. akashiwo has been reported.In this study, the stabilities in expression of ten candidate genes (Table 1), α-tubulin (tua), β-tubulin (tub), cytochrome c oxidase subunit II (cox2), 60S ribosomal protein L17-2 (rpL17-2), 60S ribosomal protein L23 (rpL23), calmodulin (cal), malate dehydrogenase (mdh), 18S, gapdh and ef1 in H. akashiwo were analyzed under four different experimental conditions. As a way to further validate the suitability of the most promising candidate genes identified, the two top-ranked reference genes for diel cycle studies were used to normalize rubisco large subunit (HrbcL) expression levels throughout a diel cycle. A set of four genes was found to be the most suitable as reference genes for all the four conditions we tested, while each condition had its own specific set of top-ranked reference genes.
Table 1
Candidate reference genes and HrbcL examined and their primers used in this study.
Gene symbol
Primer sequences (5'→3') Forward/Reverse
Amplicon length (bp)
rpL17-2
TACAGCATCAAGGACGAACCC
93
GTTGTGGGCCACCTCTCTCA
rpL23
GGTTTTCCCTGCTGTTGTCA
118
GCCCTTCATTTCACCCTTGT
cox2
CGATGTTTGGCTCTTTACGAC
130
CGAATGAAGGAACTGCGATA
cal
GCACCATTGACTTCCCTGAGT
113
ACCGTTGCCATCCTTGTC
tua
GCACCTTCTGCCTGGATAAC
174
TGGTCTGGAACTCGGTCATA
tub
CTTCAGACCCGACAACTTCG
123
TCAGCCTCCTTTCTCACGAC
ef1
AGTATGCCTGGGTGCTTGAC
105
TGACGGTGTAGTGGAACTTGG
18S
TGGTGGAGTGATTTGTCTGG
133
CCCAACTTCCTTCGGTTAGTC
gapdh
TACTGCGATGAGCCTTGTGTG
96
GAACTTGGGGTTGAGGGAGA
mdh
CCTCGTGATGTGAAGGTTGA
115
GCGTGAGTTCCTCGATGTCT
HrbcL
ACCACAACCTGGAGTAGACCC
182
CGTATGCGATGTATGCGAAG
Materials and Methods
Heterosigma akashiwo culture and treatment
Heterosigma akashiwo were maintained in a glass bottle with f/2 medium (without added silicate) prepared with 0.22 μm-filtered and autoclaved seawater (salinity 30 PSU). Stock cultures were kept at 20°C under a 14: 10 h light: dark cycle with an average photon flux of 100 ± 10 μE.m-2.s-2. For all experiments, cell concentrations were determined using a Sedgwick-Rafter chamber under the microscope.For experiments, each treatment group was set up in triplicate. Control group was cultured in normal f/2 medium under the temperature and light conditions as described above. Temperature treatment included exposure to 10°C, 20°C and 30°C, respectively for 24 h. Light treatment consisted of exposure to 200 (high light), 100 (normal light) and 50 μE.m-2.s-2 (low light), respectively for 96 h. For nitrogen (N) and phosphorus (P) stress treatment, the cultures were treated as previously described [25] with minor modification. Briefly, the pre-treatment stock culture in f/2 medium was inoculated to low nutrient media that were either stoichiometrically low in N (181.5 μM NaNO3 and 36.3 μM NaH2PO4.H2O, with 5: 1 of N: P) or low in P (883 μM NaNO3 and 7.06 μM NaH2PO4.H2O, with 125: 1 of N: P) conditions. When these cultures were growing in the exponential phase, they were re-inoculated into fresh batches of their corresponding media. Cell concentration was monitored daily as described above, and when cultures were exhibiting exponential growth again, samples were collected. In addition, to examine the diel patterns of gene expression, the control group cultures were sampled, in which sampling started at 6 h (T6) after the onset of light period (T0), and 12 (T12), 18 (T18), 24 (T24), and 30 (T30) h after T0, throughout a 24-h diel cycle. Samples were collected by centrifugation at 3000 × rpm for 5 min at 4°C. The cell pellets were suspended in 1 mL TRIzol reagent (Invitrogen), and stored at -80°C until RNA extraction within a month.
Total RNA extraction and cDNA synthesis
Total RNA was extracted as recently reported [26] and potential genomic DNA contamination was eliminated by incubating the RNA samples with RQ1 DNase (Promega). RNA was further purified by RNeasy Mini kit (Qiagen). RNA purity and concentration were measured by NanoDrop spectrophotometer (Theromo, Germany), and RNA integrity was evaluated by agarose gel electrophoresis.The first-strand cDNA was synthesized from 300 ng of total RNA in a total volume of 20 μL using the ImProm-II reverse transcriptase (Promega) with random hexamer primer. The RNA template was first incubated with 0.5 μg of the primer at 70°C for 5 minutes, and then at 4°C for 5 minutes. Next, 4 μL ImProm-II 5 × reaction buffer, 4 μL MgCl2 (25 mM), 1 μL dNTP mix (10 mM each dNTP) and 1 μL ImProm-II reverse transcriptase were added and the mixture was incubated at 25°C for 5 minutes and then 42°C for 1 h. The reaction was terminated by incubating it at 70°C for 15 minutes. The cDNAs were diluted 1: 50 with nuclease-free water before use in subsequent experiments.
Selection of candidate reference genes for study
A group of genes that have been used as reference genes in various algae were summarized in S1 Table. Based on the availability of the sequences from H. akashiwo, we selected eight (tua, tub, 18S, gapdh, rpL23, cal, ef1, and mdh) from this list and added two others (cox2 and rpL17-2) that are functionally related to cox1 and rpL19 in the list to achieve a set of ten candidate genes. The nucleotide sequences of tua (AY729829), tub (AY729817), 18S (JX026930), cox2 (GQ222228), and gapdh (AF319449), were available from GenBank database, and the others were identified from transcriptome data of H. akashiwo [27].
Primer design and evaluation
The primers for qRT-PCR were designed using the Primer Premier 5.0 software and had estimated melt temperature of 57–60°C and amplicon lengths of 80–180 bp (Table 1). To check the specificity of the primers, regular PCR were run and all PCR products were examined on agarose gel for size, and then purified, cloned, and sequenced. For each primer, the PCR amplification efficiency (E) was calculated following E = [10(-1/slope)] × 100%, in which the slope were obtained from the standard curve generated from a serial dilutions of pooled cDNAs [28]. From the same dilution series correlation coefficient (R2) was also calculated.
qRT-PCR
Using the cDNAs as the templates, qRT-PCR was conducted using the CFX96 Real-Time System (Bio-Rad, USA). Each PCR reaction was carried out in a total volume of 12 μL containing 6 μL of 2 × iQ SYBR Green supermix (Bio-Rad, USA), 375 nM of each primer, and 5 μL of 1: 50 diluted cDNA. The PCR program was composed of a denaturation step of 3 min at 95°C, followed by 40 cycles of 95°C for 10 s and 60°C for 32 s. In each run, negative controls were set up with ddH2O and RNA as templates, respectively. Each reaction had three technical replicates. At the end, to confirm primer specificity, all the PCR products were subjected to melting curve analysis.
Gene stability analysis using geNorm and NormFinder
The geNorm [29] and NormFinder [30] software packages were employed to assess the stability of the expression levels of the candidate reference genes under the different experimental conditions. geNorm produces a stability measure (M) and by stepwise exclusion of the genes with the lowest stability creates a ranking of the tested genes (the lower the M value, the more stable the expression of the gene). The number of genes required for normalization of target gene expression also was estimated, and the normalization factor was calculated. NormFinder is a another program used to evaluate the candidate reference genes in given experimental design; it takes into consideration the intra- and inter-group variations and combines these results to estimate a reference gene stability value for each gene, avoiding influence caused by co-regulated candidate genes.
Relative quantification of HrbcL gene expression
Ribulose 1, 5-bisphosphate carboxylase/oxygenase (rbc) is the key enzyme catalyzing CO2 fixation and is thus essential for photosynthetic organism [31]. Diel regulation of rbc transcription has been well documented in many photosynthetic organisms from cyanobacteria, algae, to higher plants [32]. Therefore, we attempted to characterize the diel expression patterns of H. akashiwo rbc large subunit (HrbcL) using the best reference genes (rpL23 and rpL17-2) identified under diel cycle in the present study, as a way to further validate the selected reference genes. The sequence of HrbcL (EU168191) was obtained from GenBank, and primers were designed (Table 1). Relative expression levels of HrbcL were calculated by dividing the raw expression value of HrbcL for each sample by the normalization factor generated by geNorm.
Statistical analyses
All statistical analyses were performed with SPSS (version 16.0). Variations in the Ct values between and within treatments as well as in the relative expression of HrbcL in H. akashiwo were analyzed using one-way ANOVA, and the level of significance was defined at P < 0.05.
Results
RNA quality, primer specificity and amplification efficiencies
RNA samples prepared from H. akashiwo all displayed good quality, with A260/A280 ratios ranging from 1.9 to 2.2, and A260/A230 ranging from 1.9 to 2.1. RNA integrity was confirmed on agarose gel electrophoresis, which showed two discrete bands, one (more abundant) 28S rRNA and another 18S rRNA. Specificities of primers were confirmed by the presence of a single band with the expected size on agarose gel electrophoresis (S1 Fig), the presence of a single peak in melting curve analysis after qRT-PCR (S2 Fig), and sequencing results (S1 File). No product was detected in negative control (ddH2O or RNA as template), indicating that there was no gDNA contamination in the RNA extracts, and the qRT-PCR results were thus reliable. The PCR efficiency (E) of the ten candidate reference genes and Hrbc ranged from 90.1%-101%, and the correlation coefficient (R2) ranged from 0.991 to 0.999, which were within the commonly reported range of qRT-PCR.
Expression profiling of candidate reference genes
In order to investigate the relative expression levels of the ten candidate reference genes in H. akashiwo, the Ct values of these genes were calculated (S2 Table). The Ct median value of reference genes varied from 10.51 to 29.91, and most of the values were between 25.08 and 26.87 across all the samples (Fig 1). The 18S gene showed the highest expression level with Ct value ranging from 8.33 to 13.32 in different samples, while mdh exhibiting the lowest expression level with Ct value ranging from 27.47 to 32.72. Based on the comparative ranges of Ct values, the smallest gene expression variation seemed to occur in tua, while gapdh seemed to be the most variable. However, a simple comparison of the raw Ct value is not sufficient to determine expression stability of the candidate reference genes; therefore, further analyses using geNorm and NormFinder software were conducted to provide more accurate results.
Fig 1
Ct values of candidate reference genes across conditions tested.
Boxes show the median values (central lines), Q1 (lower outline) and Q3 (upper outline), and whiskers. The whiskers are set at 1.5 times IQR (interquartile range) above Q3 and 1.5 times IQR below the Q1. If the Maximun or Minimum values are outside this range, they are shown as outliers (*).
Ct values of candidate reference genes across conditions tested.
Boxes show the median values (central lines), Q1 (lower outline) and Q3 (upper outline), and whiskers. The whiskers are set at 1.5 times IQR (interquartile range) above Q3 and 1.5 times IQR below the Q1. If the Maximun or Minimum values are outside this range, they are shown as outliers (*).
Expression stability of candidate reference genes
Average expression stability values (M) were obtained using geNorm, and all candidate genes were ranked based on the M values (Fig 2). All ten genes investigated in this study showed M values below the threshold value 1.5, indicating that the expression levels of these genes were relatively stable under all the conditions we examined. By comparison, as shown in Fig 2, the most stable genes were cal and tub under temperature treatment, 18S and tub under light treatment, rpL17-2 and rpL23 in the diel cycle samples, cal and rpL17-2 under nutrient treatment and all treatments combined (M = 0.488) (Total). We found that gapdh was the least stably expressed under temperature treatment, light treatment, time points over the diel cycle, and total (M = 1.219), and ef1 was the least stably expressed gene under nutrient treatment. In addition, our ANONA analysis showed that the variations in the gapdh and ef1 Ct values were attributable to experimental treatments rather than inconsistencies between replicates, because the between group variance was much higher than the within group variance (S3 Table).
Fig 2
Gene expression stability and ranking of the candidate reference genes as calculated by geNorm.
Average expression stability value (M) was calculated by stepwise exclusion of the least stable gene compared across different temperatures (Temperature), different light intensities (Light), different nutrient (N: P) ratios (Nutrient), different time points in the diel cycle (Diel), and the combination of all the samples (Total). In each plot, the least stable gene is on the left, and the most stable gene on the right.
Gene expression stability and ranking of the candidate reference genes as calculated by geNorm.
Average expression stability value (M) was calculated by stepwise exclusion of the least stable gene compared across different temperatures (Temperature), different light intensities (Light), different nutrient (N: P) ratios (Nutrient), different time points in the diel cycle (Diel), and the combination of all the samples (Total). In each plot, the least stable gene is on the left, and the most stable gene on the right.The geNorm software was also used to determine the optimal number of references genes required for accurate normalization, according to the pairwise variation (Vn/Vn+1) value. Vandesompele et al. (2002) proposed 0.15 as a Vn/Vn+1 threshold value, below which the inclusion of an additional control gene is not required [29]. For individual experimental treatment, V2/V3 value was 0.056, 0.117, 0.086 and 0.119 in nutrient, light, temperature and diel time point treatments, respectively (Fig 3). These results indicated that the inclusion of a third gene would not have significant effect for any of the four treatments, so the two most stable reference genes were sufficient for accurate normalization of gene expression under these conditions. When all the samples were considered together, V2/V3, V3/V4 and V4/V5 value were 0.201, 0.167 and 0.145, respectively. Combined with the result of stability ranking, the results showed that the four most stable reference genes, cal, rpL17-2, tub and rpL23, would be sufficient for accurate gene expression normalization for H. akashiwo under any combination of the four conditions.
Fig 3
Determination of the optimal number of reference genes for normalizing gene expression (qRT-PCR) data.
Pair-wise variation (Vn/Vn+1, where n represents number of genes) was analyzed between the normalization factors (NFn and NFn+1) by geNorm software against all different conditions examined (nutrient, temperature, light, timing in the diel cycle and all these factors combined).
Determination of the optimal number of reference genes for normalizing gene expression (qRT-PCR) data.
Pair-wise variation (Vn/Vn+1, where n represents number of genes) was analyzed between the normalization factors (NFn and NFn+1) by geNorm software against all different conditions examined (nutrient, temperature, light, timing in the diel cycle and all these factors combined).For an independent assessment, the expression stabilities of reference genes were also ranked by NormFinder (Table 2). The most stable genes were cal for light and nutrient treatments, rpL17-2 for temperature treatment, and rpL17-2 and rpL23 for diel cycle. When all the conditions were considered together, the same five most stable genes (cal, rpL17-2, tub, rpL23, and cox2) were identified by NormFinder as by geNorm, although cox2 was ranked first by NormFinder and fifth by geNorm. NormFinder identified gapdh and ef1 as the most unstable gene across all the conditions, which was consistent with the result from the geNorm.
Table 2
Expression stability values of the candidate reference genes calculated by NormFinder.
Temperature
Light
Nutrient
Diel
Total
Rankinga
SVb
Ranking
SV
Ranking
SV
Ranking
SV
Ranking
SV
rpL17-2
0.247
cal
0.130
cal
0.096
rpL23
0.207
cox2
0.353
cox2
0.266
rpL23
0.176
rpL23
0.103
rpL17-2
0.230
tub
0.360
mdh
0.292
18S
0.226
tub
0.111
cox2
0.274
cal
0.361
cal
0.300
tub
0.234
mdh
0.142
cal
0.316
rpL17-2
0.370
ef1
0.319
ef1
0.285
gapdh
0.145
tua
0.405
rpL23
0.473
18S
0.374
tua
0.289
rpL17-2
0.149
ef1
0.570
18S
0.481
tub
0.375
mdh
0.302
18S
0.167
tub
0.576
mdh
0.489
rpL23
0.386
cox2
0.335
cox2
0.209
18S
0.588
tua
0.580
tua
0.390
rpL17-2
0.340
tua
0.234
mdh
0.848
ef1
0.689
gapdh
0.553
gapdh
0.367
ef1
0.408
gapdh
1.741
gapdh
1.020
aRanking indicates the genes stability from the most stable to the least stable.
bSV represents stability value.
aRanking indicates the genes stability from the most stable to the least stable.bSV represents stability value.
Diel expression pattern of HrbcL and validation of the reference genes
To evaluate the usefulness of the selected reference genes, we compared the expression pattern of rbcL in H. akashiwo (HrbcL) under diel cycle (sampled every six hours) using the most stable (rpL17-2 and rpL23) and the least stable genes (gapdh and mdh) in the diel cycle among our ten candidate reference genes. When the most stable genes (rpL17-2 and rpL23) were used in combination for normalization, the expression levels of HrbcL decreased rapidly between six hours after the onset of light (T6) and two hours before the end of the light period (T12), reaching the lowest value at four hours after the onset of the dark period (T18), and increased thereafter (Fig 4). A similar expression pattern was observed when either rpL17-1 or rpL23 was used alone for normalization. When the least stable genes (gapdh and mdh) were employed together, the normalized expression levels of HrbcL were not significantly different between time points T12 and T18, and entirely different expression patterns were obtained when either one of these two least stable genes was used for normalization (Fig 4).
Fig 4
Diel pattern of HrbcL expression normalized against different reference genes.
Relative expression values shown are mean fold changes compared to T18 samples, with error bars representing standard deviation (data were derived from triplicated biological (culture) samples, each with triple technical (qPCR) replicates). Different alphabets above the bars indicate significant differences at different time points at P < 0.05, while same letters within each plot indicate lack of significant difference. The black horizontal black bars indicate the dark period.
Diel pattern of HrbcL expression normalized against different reference genes.
Relative expression values shown are mean fold changes compared to T18 samples, with error bars representing standard deviation (data were derived from triplicated biological (culture) samples, each with triple technical (qPCR) replicates). Different alphabets above the bars indicate significant differences at different time points at P < 0.05, while same letters within each plot indicate lack of significant difference. The black horizontal black bars indicate the dark period.
Discussion
Research on H. akashiwo has uncovered its life cycle and ecological characteristics, such as diel vertical migration [33], benthic stage [11], and strong ability to tolerate sudden salinity decrease [12], which may be linked to its ecological success. However, molecular mechanisms underlying these features [34] are poorly understood and need to be investigated. The qRT-PCR technology has been extensively used in the study of marine phytoplankton to understand transcriptional responses to physical stressors [35, 36], nutrient starvation [37], and diel cycle [26, 38, 39], and to detect the activity and modulation of many metabolic processes [39, 40]. As the accuracy of gene expression data is highly dependent on the selection of suitable reference genes for normalizing gene expression against experimental variations, most of those studies used reference genes for the normalization. However, only a small faction of those reference genes has been systematically evaluated to ensure they are suitable for the species under investigation.In this paper, we conducted careful evaluation on expression stability of ten candidate reference genes, eight of which have been used in previous studies on various organisms. We chose to investigate the effects of temperature, light, and nutrient conditions because they are the most common environmental variable influencing marine phytoplankton. Diel cycle was also examined because sampling for molecular analysis, particularly on research cruises, often occurs at different times of the day. Two widely used analysis programs, geNorm and NormFinder, were used to ensure reliability of gene expression stability assessment. Due to their distinct algorithms, slight differences were observed when the rankings of the candidate reference genes from these two programs were compared. For example, under temperature variations, rpL17-2 was ranked to be the most stable by NormFinder, whereas cal and tub were ranked as the most suitable candidate reference genes by geNorm (Fig 2, Table 2). Corresponding different results have also been reported and discussed in many previous studies [22, 23, 41]. However, both analysis programs produced the same top five most stable genes: cal, rpL17-2, tub, rpL23, and cox2. Therefore, these five can be considered the “short list” of reference genes for common transcriptional studies in H. akashiwo. Based on the below-threshold pairwise variation, V4/V5 value (0.145) and the high frequencies at which these genes were ranked favorable across the four separated sets of conditions, cal, rpL17-2, tub and rpL23 are particularly preferable for use under different environmental stress conditions or diel cycle of H. akashiwo. Picking common top-ranked genes from multiple analysis programs should give high confidence about the selection of the reference genes.Even for specific environmental conditions or treatments, the picking common-gene approach can be also helpful for identifying best reference genes available. For temperature treatment, for instance, geNorm identified cal and tub as the most stable genes, followed by mdh, 18S, and others (Fig 2), whereas NormFinder ranked rpL17-2 as the best reference gene, followed by cox2, mdh, cal, and others (Table 2). Based on the ranking orders, cal and mdh would be the best choices among the ten examined presently for temperature effect studies. This result agrees with the previous studies on cal and mdh genes in algae. The calmodulin gene has been identified as a stable reference gene in the dinoflagellate Symbiodinium sp. under temperature stress [35], while mdh was shown to be relatively stable in the dinoflagellate Prorocentrum minimum across many experimental conditions (heat shock, toxic chemical exposures and different life stages) [42].By the same way, we found cal and tub were sufficiently stable to be used for normalizing gene expression under light and nutrient treatments. The beta-tubulin gene has also been selected as reference gene in studies of gene expression in the chlorophyte macroalga Ulva linza [43] and the diatom Pseudo-nitzschia multistriata [44].For diel cycle samples, both geNorm and NormFinder identified rpL23 and rpL17-2 as the ideal reference genes, and the pairwise variation V2/V3 of 0.119 indicated that these two ribosomal protein genes could be used in combination for normalization (Fig 3). Recently, various ribosomal proteins genes have frequently been identified as suitable reference genes in algae and other organisms. rpS30 (ribosomal protein small subunit 30S) gene has been selected as the most stable gene among twelve candidate reference genes compared throughout a diel cycle [38]. rpL19 (60S ribosomal protein L19) and rpL23 were validated as reference genes in the chlorophytes Chlamydomonas sp. (for freezing condition) [45] and Volvox carteri (for different cell types) [46], respectively.The GAPDH gene (gapdh) has been considered to be a suitable reference gene for quantifying gene expression in many algal species under different conditions, such as Prorocentrum donghaiense under diel cycle [26], Alexandrium catenella in P-limited conditions [47] and Chlamydomonas sp. under different light treatment [48]. However, in our study, gapdh was ranked as one of the least stable genes under different treatments and in all samples combined, indicating that it is not suitable as a reference gene for H. akashiwo under our experimental conditions. In agreement of our result, the mRNA and protein levels of gapdh have been reported to be regulated by light in other algae [38, 49]. The variability of gapdh expression level also has been increasingly recognized for other types of organisms [29, 50, 51].Like gapdh, 18S is commonly used as a reference gene [52], and it has been used to design probes for quantifying the abundance of H. akshiwo in field samples [53]. In the present study we found that 18S was a moderately stable gene across all conditions we examined, although it appeared to be a suitable reference gene under light treatment (Fig 2). Compared with other genes (mRNA transcripts) the Ct median value of 18S was much lower (Fig 1), indicating that the abundance of 18S transcript was much higher (~1000 folds that of cox2 and ~700,000 folds that of mdh). The high abundance of 18S compared to mRNA transcripts (target genes) makes it difficult to reliably subtract the background baseline value in qRT-PCR data analysis [29, 54]. In addition, 18S rRNA content may be affected by nutrient stress and vary over the diel cycle [25, 55]. Therefore, we recommend that 18S not be selected as a reference gene for qRT-PCR in H. akashiwo.Applying the candidate reference genes to normalizing a well-characterized target gene would provide further validation for the reference genes. We chose to assess the expression profile of rbcL in H. akahsiwo (HrbcL) under a diel cycle because rbcL mRNA abundance is known to exhibit strong diel rhythm in many algal species [32]. We observed a similar diel rhythm in HrbcL expression whether the most stable genes reference genes (rpL23 and rpL17-2) for diel cycle were used individually or in combination (Fig 4) to the diel pattern reported for many algae [32, 56], i.e. expression level being the highest around the middle of the light period and lowest in the middle of the dark period. Many previous reports also have shown that the expression patterns of target genes showed similar trends when either single or combined most stable reference genes were used [28, 57]. This further verifies that rpL23 and rpL17-2 are suitable reference genes for H. akashiwo gene expression studies under diel (light dark) cycle. When the expression levels of HrbcL were normalized with the least stable genes (gapdh, mdh) for diel cycle, either singly or in combination, different diel patterns of HrbcL expression were observed, either by comparison to each other, to previously reported patterns, or to patterns when rpL23 and rpL17-2 were used for normalization (Fig 4). Clearly, gapdh and mdh are not suitable reference genes for gene expression studies in H. akashiwo under diel cycle. These results demonstrate that the use of reference genes without validation risks misinterpretation of results.
Conclusion
To our knowledge, this work is the first study to evaluate candidate reference genes for gene expression analysis in H. akashiwo under different environmental conditions (temperature, nutrient and light) and different time points over the diel cycle. After careful assessment using qRT-PCR combined with statistical analysis based on geNorm and NormFinder, our results show that cal and tub are good reference genes for gene expression studies under different light and nutrient conditions, rpL17-2 and rpL23 for diel cycle studies, cal and mdh for varying temperature conditions. Our results also lead us to conclude that if used in combination cal, tub, rpL17-2 and rpL23 are suitable reference genes for gene expression analysis under all the four different experimental conditions we examined, and because these conditions represent the most common environmental or sampling factors, they may be applicable to most field studies. The identification of the suitable reference genes in this study will facilitate future studies on gene expression in H. akashiwo to improve our understanding on the molecular mechanisms of bloom formation.
Summary of reference genes that had been tested or used in algal research.
(DOC)Click here for additional data file.
Ct values of candidate reference genes examined in this study.
(XLS)Click here for additional data file.
Effects of different treatments on the Ct value of two least stable genes (gapdh and ef1).
(DOC)Click here for additional data file.
Agarose gel electrophoresis results of ten candidate reference genes and HrbcL PCR products.
(TIF)Click here for additional data file.
Melting curves of ten candidate reference genes and HrbcL.
(TIF)Click here for additional data file.
Sequence results of ten candidate reference genes and HrbcL.
Authors: Patrick J Keeling; Fabien Burki; Heather M Wilcox; Bassem Allam; Eric E Allen; Linda A Amaral-Zettler; E Virginia Armbrust; John M Archibald; Arvind K Bharti; Callum J Bell; Bank Beszteri; Kay D Bidle; Connor T Cameron; Lisa Campbell; David A Caron; Rose Ann Cattolico; Jackie L Collier; Kathryn Coyne; Simon K Davy; Phillipe Deschamps; Sonya T Dyhrman; Bente Edvardsen; Ruth D Gates; Christopher J Gobler; Spencer J Greenwood; Stephanie M Guida; Jennifer L Jacobi; Kjetill S Jakobsen; Erick R James; Bethany Jenkins; Uwe John; Matthew D Johnson; Andrew R Juhl; Anja Kamp; Laura A Katz; Ronald Kiene; Alexander Kudryavtsev; Brian S Leander; Senjie Lin; Connie Lovejoy; Denis Lynn; Adrian Marchetti; George McManus; Aurora M Nedelcu; Susanne Menden-Deuer; Cristina Miceli; Thomas Mock; Marina Montresor; Mary Ann Moran; Shauna Murray; Govind Nadathur; Satoshi Nagai; Peter B Ngam; Brian Palenik; Jan Pawlowski; Giulio Petroni; Gwenael Piganeau; Matthew C Posewitz; Karin Rengefors; Giovanna Romano; Mary E Rumpho; Tatiana Rynearson; Kelly B Schilling; Declan C Schroeder; Alastair G B Simpson; Claudio H Slamovits; David R Smith; G Jason Smith; Sarah R Smith; Heidi M Sosik; Peter Stief; Edward Theriot; Scott N Twary; Pooja E Umale; Daniel Vaulot; Boris Wawrik; Glen L Wheeler; William H Wilson; Yan Xu; Adriana Zingone; Alexandra Z Worden Journal: PLoS Biol Date: 2014-06-24 Impact factor: 8.029
Authors: Jo Vandesompele; Katleen De Preter; Filip Pattyn; Bruce Poppe; Nadine Van Roy; Anne De Paepe; Frank Speleman Journal: Genome Biol Date: 2002-06-18 Impact factor: 13.583