Transcription Analysis of the Beta-Glucosidase Precursor in Wild-Type and l-4i Mutant Bombyx mori (Lepidoptera: Bombycidae).

Lethal fourth-instar larvae (l-4i) mutant of Bombyx mori, a recently discovered novel mutant, die from energy depletion due to genetic mutation. Beta-glucosidase is a common digestive enzyme that hydrolyzes cellulose in the diet to provide energy. In this study, the mRNA expression profiles of B. mori beta-glucosidase precursor (BmpreBG) were characterized by reverse transcription polymerase chain reaction and quantitative real-time polymerase chain reaction. The transcription level of BmpreBG varied in different tissues and developmental stages, except in the pupa and moth, which are the no-diet period. Remarkably, the mRNA expression level of BmpreBG was sharply reduced in l-4i but not in the wild type, which suggested that the digestive function of the mutant was severely damaged. This was consistent with the l-4i phenotypic traits of not eating mulberries, lack of energy, and ultimate death. 5'-rapid amplification of cDNA ends showed, for the first time, that BmpreBG has a 160-bp 5'-untranslated region. These findings suggested that B. mori β-glucosidase precursor was involved in the death process of l-4i mutant larvae.

Glycoside hydrolases selectively catalyze the hydrolysis of glycosidic bonds in oligosaccharides, polysaccharides, and their conjugates ( Liu et al. 2005 ). Among them, beta-glucosidase (BG, EC 3.2.1.21) is a common cellulose hydrolase in bacteria, fungi, protists, plants, and animals, which catalyzes the hydrolysis of β-glucosidic linkages of various oligosaccharides and glycosides to form glucose and shorter/debranched oligosaccharides ( Zhang et al. 2009 , Singhania et al. 2013 ). In insects, digestive β-glucosidases are vital for hydrolysis of di- and oligo-β-saccharides derived from hemicelluloses and cellulose in the diet. In addition, β-glucosidases play an important role in the interaction between insects and plants ( Mattiacci et al. 1995 , Marana et al. 2000 ).

Lethal mutant in the fourth-instar larva ( l- 4 i ) is a novel lethal mutant that is discovered during rearing of silkworm ( Bombyx mori ) strain P 33 . Compared with the normal larva, the mutant grows and develops slowly, resulting in a smaller body shape and poor vitality after day 2 of third instar as well as the duration of the third instar is extended by about 2 d. The fourth newly exuviated larva barely take mulberry leaves and almost stop growth and development and begin to die on the 3rd to 4th day of the fourth instar ( Fig. 1 ) ( Kang et al. 2015 ).

Fig. 1.

Body size comparison of lethal mutation in the fourth-instar larva ( l- 4 i ) (right) and normal larva (left) of the normal variety at day 3 of the fourth instar of silkworm.

The l- 4 i mutant that dies from energy depletion is attributed to the genetic mutation, so the B. mori β-glucosidase precursor ( BmpreBG ) which is associated with sugar metabolism aroused our interest. To verify the relationship between the BmpreBG and the phenotype of the l- 4 i mutant, the transcription profiles of BmpreBG were investigated by reverse transcription polymerase chain reaction (RT-PCR) and quantitative real-time PCR (qPCR) in this study. Interestingly, qPCR analysis revealed that the mRNA expression level of BmpreBG decreased significantly in the midgut of l- 4 i mutant at three successive developmental stages, while such decreases were not observed in the wild type. Our results contribute to the comprehensive understanding of the underlying mechanism of l- 4 i mutation.

Materials and Methods

Materials

B. mori strain C108 (standard silkworm strain), the wild-type P 33, and l- 4 i mutant strain were supplied by the Sericultural Research Institute (Zhenjiang, China). The larvae were reared on fresh mulberry leaves at 25 ± 2°C under a photoperiod of 12:12 (L:D) h and 65 ± 5% relative humidity.

RNA Extraction and cDNA Synthesis

Larvae at different developmental stages as well as the egg, pupa, and moth, and various tissues (trachea, midgut, ovary, hemocytes, testis, fat body, malpighian tubule, epidermis, and silk gland) from day 3 in the fifth-instar larvae of silkworm strain C108, as well as the midguts of the wild-type and l- 4 i mutant larvae on day 2, molting of third instar and the fourth newly exuviated larva were dissected, frozen in liquid nitrogen immediately, and stored in RNA-free Eppendorf tubes at −80°C for later use. Total RNA was extracted from frozen samples using an RNeasy mini kit (Qiagen, Germany), treated with RNase-free DNaseI (Takara, China) for 20 min at 37°C, purified with phenol–chloroform, precipitated with ethanol, and finally dissolved in DEPC-treated ddH 2 O. The cDNAs were synthesized using M-MLV RTase (Promega, USA) and an oligo-dT primer, according to the manufacturer’s instructions.

Transcriptional Analysis of BmpreBG by RT-PCR

To determine the tissue and development specificity of BmpreBG , mRNA expression in the larvae, trachea, midgut, ovary, hemocytes, testis, fat body, malpighian tubule, epidermis, and silk gland of the day 3 in the fifth-instar larvae, as well as the egg, larvae from first to fifth instar, pupa, and moth of strain C108 were analyzed by RT-PCR, which was performed using the following primers: BmpreBG -F: 5′ATGCGCTTGA TGCC GGA ATT 3′; BmpreBG -R: 5′GCGGATTTTCTTGGAGTACG 3′. A 284-bp fragment of B. mori cytoplasmic actin gene A3 , corresponding to nucleotides 680–963 (GenBank accession no: X04507), was amplified in parallel with each RNA sample as an internal control for adjustment of template RNA quantity. Intensities of the bands were quantified with Gel-Pro Analyzer (version 4.5).

Quantitative Real-Time PCR

To compare the BmpreBG transcription levels in the midguts of the wild-type and l- 4 i mutant at the three developmental stages mentioned above, qPCR was carried out using an ABI PRISM 7300 Sequence Detection System (Applied Biosystems, USA). BmpreBG mRNA and Bm-actin A3 mRNA were quantified using 2 μl of the reverse transcription reaction (equivalent to 100 ng single-stranded cDNA) as a template in the qPCR. A 151-bp product for BmpreBG cDNA corresponding to nucleotides 1240–1391 was amplified using the following primers: forward 5′-ATGCGCTTG ATGC CG G AATT-3′ and reverse 5′-GCGGATTTTCTTGGAGTACG-3′. qPCR was carried out in a 20-μl reaction mix using SYBR Green Supermix (Takara), according to the manufacturer’s instructions. The thermal cycling profile consisted of initial denaturation at 94°C for 5 min; and 40 cycles at 94°C for 30 s, 58°C for 25 s, and 72°C for 35 s. All reactions were performed in triplicate, and the relative expression level was analyzed using the 2 −ΔΔCt method, where ΔΔCt = ΔCt sample − ΔCt reference , and CT refers to the cycle threshold ( Livak and Schmittgen 2001 ).

Cloning of the Open Reading Frame and Putative Promoter, and 5′-Rapid Amplification of cDNA Ends in the Wild-Type and l -4 i mutant

To compare the gene sequence between the wild-type and the mutant, we tried to get the open reading frame (ORF), putative promoter, and untranslated region (UTR) sequences. The BmpreBG specific primers, forward primer (5′-GGCTGATAGCTCGTCTGTTT-3′) and reverse primer (5′-TTCACGAGTCGTTGATGGTC-3′) were designed to amplify the ORF of the putative BmpreBG gene (SilkDB accession no. BGIBMGA005602-TA). The PCR reaction was carried out with 30 amplification cycles (94°C for 30 s, 58°C for 25 s and 72°C for 90 s) in an ABI2720 96-well thermocycler (Applied Biosystems). To obtain the 5′-UTR ( d'Alencon et al. 2010 ) of the BmpreBG cDNA, a gene-specific primer for 5′-rapid amplification of cDNA ends (RACE, 5′-GGGGCTTTAGCCGTACTTCCATATCC-3′) was designed, following the SMART RACE cDNA Amplification Kit (Biosciences Clontech, USA). Specific PCR was performed using the following conditions: 94°C for 5 min; followed by 30 cycles of 94°C for 30 s, 60°C for 25 s and extension at 72°C for 1 min. The promoter sequence was predicted by the 5′-UTR and the BDGP tool ( http://tools.genome.duke.edu/generegulation/McPromoter/ ). About 1 kb of sequence containing the predicted promoter was extracted using specific primers based on the genome sequence: forward primer: 5′-CAATCTGCT AACGCATT TATCTG-3′ and reverse primer: 5′-CCAGGCACC TTCAATTT GATA AG-3′. All PCR products were cloned into vector pMD18-T (Takara), transformed into Escherichia coli strain Top10 and sequenced.

Results

Developmental and Tissue-Specific Transcription Pattern of BmpreBG

The BmpreBG transcription levels at various developmental stages were examined by RT-PCR. The results indicated that mRNA was detectable from the egg to the fifth-instar larvae, except in the pupa and moth ( Fig. 2 ). To confirm the expression of BmpreBG gene at transcriptional level, RT-PCR was performed using mRNA prepared from trachea, midgut, ovary, hemocytes, testis, fat body, malpighian tubule, epidermis, and silk gland, respectively. The results showed that the mRNA of BmpreBG gene could be detected in the most of tissues: the midgut had the highest level, whereas the epidermis had the lowest ( Fig. 3 ).

Fig. 2.

RT-PCR analysis of BmpreBG at different developmental stages. The graph shown in (A) was obtained from the image in (B) by quantification using Gel-Pro Analyzer. (B) Lines 1–8 represent the egg, the first-, second-, third-, fourth-, and fifth-instar larvae, the pupa, and the moth, respectively. Bm-actin A3 was used as the internal control to normalize the amount of template in the PCR reaction.

Fig. 3.

Expression profile of BmpreBG in different tissues of B. mori. The graph shown in (A) was obtained from the image in (B) by quantification using Gel-Pro Analyzer. (B) Lines 1–9 represent trachea, midgut, ovary, hemocytes, testis, fat body, malpighian tubule, epidermis, and silk gland. Bm-actin A3 was used as the internal control.

Transcription Analysis of BmpreBG in the Midgut of the Wild-Type and the l -4 i at Various Developmental Stages

The mutant larvae have smaller body sizes and slower growth rates after day 2 of the third instar; therefore, qPCR was conducted to analyze the mRNA expression pattern of the BmpreBG in the midgut of the wild-type and l- 4 i on day 2 and the molting of third instar and the fourth newly exuviated larva. The results showed that BmpreBG transcription was downregulated significantly in all the examined developmental stages of l- 4 i , while this trend was not observed in the wild type. Besides, the expression level of BmpreBG in the wild-type midgut at different stages was gluttonous stages > newly molted silkworm > newlymolting silkworm ( Fig. 4 ).

Fig. 4.

Relative expression levels of BmpreBG , as determined by quantitative real-time PCR. Each real-time PCR analysis was repeated at least three times for each set of RNA samples. Each point represents the mean value ± SD. The relative amounts of BmpreBG were determined using the Bm-actin A3 as a standard. *Significant difference ( P  < 0.05) compared with the mutant.

Cloning and 5′-RACE

The BmpreBG cDNA contains a 1,482 bp ORF encoding a protein of 493 amino acids with a calculated molecular mass of 56.28 kDa. The ORF begins with the initiation codon ATG at 161 bp, ends with TGA at 1,640 bp; therefore, the 5′-UTR is 160 bp ( Fig. 5 ). Amplification from genomic DNA produced a PCR product containing the putative promoter that was about 1 kb upstream the initiation codon ( Fig. 6 ). By comparing these sequences between the wild-type and l- 4 i mutant, there was no sequence variation among the putative promoter, 5′-UTR and ORF.

Fig. 5.

ORF, 5′-UTR sequences, and deduced amino acid sequence of BmpreBG. The start codon is boxed. An asterisk (*) represents the stop codon. An arrow indicates the position and direction of the 5′-RACE primer. The amino acid residues marked with double underlines indicate glutamic acid residues responsible for catalysis.

Fig. 6.

PCR product from the BmpreBG promoter. M represents the DL2000 marker and an arrow indicates the PCR product. Lines 1 and 2 represent the wild-type and l- 4 i mutant.

Discussion

The cellulose digestive system of herbivorous insects has been intensely investigated. β-glucosidase is a digestive enzyme associated with cellulose degradation in termite species ( Hirayama et al. 2010 , Scharf et al. 2010 , Uchima et al. 2011 ). In addition, endogenous β-glucosidases have been purified from many orders of insect species such as coleopteran and orthopteran species ( Pontoh and Low 2002 , Yapi et al. 2009 ) and function as digestive enzymes in Lepidoptera Spodoptera frugiperda ( Marana et al. 2001 ), B. mori ( Byeon et al. 2005 ), Blattodea Leucophaea maderae ( Cornette et al. 2003 ), and Coleoptera Tenebrio molitor ( Ferreira et al. 2001 ).

RT-PCR analysis showed that BmpreBG could be detected from egg to the fifth-instar larvae at about the same level, except in the pupa and moth. The reason may be that the pupa and moth barely take mulberry leaves and do not require digestion for energy, while the larval stage is significant period for growth ( Byeon et al. 2005 ). In this report, the extremely low mRNA expression level of BmpreBG in the l- 4 i mutant verified that BmpreBG is associated with digestion or even energy metabolism. There have been several relevant studies on the relationship between downregulated β-glucosidase levels and the no-diet stage or starvation on Lepidoptera, such as B. mori ( Byeon et al. 2005 ) and S. frugiperda , Diatraea saccharalis ( Ferreira et al. 1997 ). Analysis of BmpreBG mRNA in different tissues showed that it could be detected in almost all tissues, moreover, it is the midgut that has the highest expression level, which is an important organ for digestion and absorption in the silkworm ( Jiang et al. 2013 ). In most insects, however, the midgut is the major site of β-glucosidase expression (Terra 1996).

qPCR was conducted to examine the transcription pattern of the BmpreBG in midgut of the wild and l- 4 i mutant larvae. Remarkably, we found that the mRNA expression level of BmpreBG in the midgut of wild type was significantly higher than in the l- 4 i mutant, while the transcription of BmpreBG gene in the mutant can hardly be detected, suggesting that the digestive function of the mutant would be severely damaged, which was consistent with the mutant phenotype of not taking mulberry leaves, exhaustion and death. Indeed, the β-glucosidase usually have derived from the midgut or salivary glands and its main function is involved in processing of dieting and feeding for digestion in other insects, such as Nephotettix cincticeps (Uhler) and Nasutitermes takasagoensis (Shiraki) ( Tokuda et al. 1997 , 2002 ), which might be implied that the l- 4 i mutant dead from wear-out of energy.

To analyze the reason for the decreased transcription level of BmpreBG in l- 4 i mutant, we obtained the ORF and putative promoter sequences by cloning and the 5′-UTR by RACE. However, there was no sequence difference between the wild-type and l- 4 i mutant, which suggested that the down-regulation of BmpreBG transcription in l- 4 i mutant may be affected or regulated by other genes or factors in the mutant. After all, a phenotype is result of a series of pathways.

These results hinted that BmpreBG might be associated with the death of the mutant by switching off the energy supply in the mutant, although no evidence is available to clarify its mechanism at present. Taken together, it is suggested that attenuated BmpreBG expression may be related to the l- 4 i mutant phenotype in this study; however, its precise biochemical function and possible role in this process remain to be determined.