| Literature DB >> 26101625 |
M Blais1, Y Pouliot2, S Gauthier2, Y Boutin3, M Lessard4.
Abstract
Bovine colostrum is well known for its beneficial properties on health and development. It contains a wide variety of bioactive ingredients that are known to promote a number of cellular processes. Therefore the use of colostrum whey as a feed additive to promote intestinal health has been proposed, yet little is known about mechanisms implicated in its beneficial properties on intestinal epithelial cells. In the present paper, casein were removed from bovine colostrum and the remaining liquid, rich in bioactive compounds, was evaluated for its capacity to modulate cellular processes in porcine intestinal epithelial cell line IPEC-J2 and human colon adenocarcinoma cell line Caco-2/15. First, we verified the effect of colostrum whey and cheese whey on processes involved in intestinal wound healing, including cell proliferation, attachment, morphology and migration. Our results showed that colostrum whey promoted proliferation and migration, and decreased specifically the attachment of Caco-2/15 cells on the culture dish. On the other hand, cheese whey induced proliferation and morphological changes in IPEC-J2 cells, but failed to induce migration. The gene expression profile of IPEC-J2 cells following colostrum whey treatment was evaluated by microarray analysis. Results revealed that the expression of a significant number of genes involved in cell migration, adhesion and proliferation was indeed affected in colostrum whey-treated cells. In conclusion, colostrum specific bioactive content could be beneficial for intestinal epithelial cell homoeostasis by controlling biological processes implicated in wound healing through a precise gene expression programme.Entities:
Keywords: Bovine colostrum whey; EGF, epidermal growth factor; EMT, epithelial–mesenchymal transition; FBS, fetal bovine serum; Gene expression; Intestinal epithelial cells; TGF-β, transforming growth factor-beta; Wound healing; qPCR, quantitative PCR
Year: 2014 PMID: 26101625 PMCID: PMC4473271 DOI: 10.1017/jns.2014.56
Source DB: PubMed Journal: J Nutr Sci ISSN: 2048-6790
List of primers for quantitative PCR analysis of colostrum-regulated gene targets identified by microarray analysis
| Gene symbol | RefSeqAccession | Primer | Sequence (5′– > 3′) | Start | Stop |
|---|---|---|---|---|---|
| AREG | NM_214376 | Forward | CACAGCTCCGCGGGACCAAT | 172 | 191 |
| Reverse | CCGTTGACGTCCAGTCCAGCA | 281 | 261 | ||
| CDKN2B | NM_214124 | Forward | GCAAGTGGAGACCGTGCGTCA | 82 | 102 |
| Reverse | CACGTGCGCTGCCCATCATCA | 188 | 168 | ||
| CXCR4 | NM_213773 | Forward | AAGGATGGACGCGCCACACA | 23 | 42 |
| Reverse | GCATCCGAGAAGCGTGCCCC | 123 | 104 | ||
| F3 | NM_213785 | Forward | AAGTCGCATTGAGTGCACCAGCC | 818 | 840 |
| Reverse | ACACAGGCGGGACGAGGACG | 927 | 908 | ||
| HAS3 | NM_001001268 | Forward | GCCGGCTTCTTTGTGTGGCG | 436 | 455 |
| Reverse | TGCTGGCCCGCACCACATTC | 544 | 525 | ||
| HBEGF | NM_214299 | Forward | CGTCGGTGGTGCTGAAGCTCT | 14 | 34 |
| Reverse | ATTGCTGGTTCCATCCGCCAGC | 117 | 96 | ||
| IL-8 | NM_213867 | Forward | CAGCCCGTGTCAACATGACTTCCA | 70 | 93 |
| Reverse | GCACTGGCATCGAAGTTCTGCAC | 191 | 169 | ||
| NGF | XM_001929549 | Forward | CGAGAGGGAGAGGGTGGCTGG | 18 | 38 |
| Reverse | AACGCCCACCTGCTTGTTGC | 117 | 98 | ||
| PLAU | NM_213945 | Forward | GGTGAGAGTCACCGGCCTGC | 570 | 589 |
| Reverse | TAAAGCGGGGCCTCAGAGCCT | 669 | 649 | ||
| PTGS1 | XM_001926129 | Forward | GCACCGGTGAACCCCTGTTGT | 126 | 146 |
| Reverse | CAGAGTAGCCCGTGCGGGTG | 231 | 212 | ||
| SERPINE1 | NM_213910 | Forward | CCACCCCCGACGGCCATTAC | 847 | 866 |
| Reverse | TGGTGAGGGCGGAGAGAGGC | 960 | 941 | ||
| SMAD7 | NM_001244175 | Forward | GATGCTGTGCCTTCCTCCGCT | 676 | 696 |
| Reverse | GTGACCGATCCCCAGGCTCCA | 775 | 755 | ||
| TAGAP | NM_001243543 | Forward | CGGCACATTCCAGCGTTGCC | 1014 | 1033 |
| Reverse | ACGTCGGGGTCGGGATCGTT | 1125 | 1106 | ||
| β-actin | XM_003357928 | Forward | CTCTTCCAGCCCTCCTTCCT | 447 | 466 |
| Reverse | GCGTAGAGGTCCTTCCTGATGT | 518 | 497 | ||
| PPIA | NM_214353 | Forward | TGCAGACAAAGTTCCAAAGACAG | 75 | 97 |
| Reverse | GCCACCAGTGCCATTATGG | 225 | 207 |
Fig. 1.Colostrum and cheese whey treatments increased cell proliferation in intestinal epithelial cells. (a) IPEC-J2 and (b) Caco-2/15 cells were incubated with different concentrations of colostrum whey or cheese whey for 24 h. Cell proliferation was measured with an 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay. Values are the mean percentage of proliferating cells compared with control cells (0 mg/ml), as determined by the XTT test, with means with their standard errors of four independent experiments done in triplicate. Mean values were significantly different from control by the post hoc analysis. **P < 0·01; *P < 0·05.
Fig. 2.Cell attachment is affected specifically in Caco-2/15 cells treated with colostrum whey. (a) IPEC-J2 and (b) Caco-2/15 cells were recovered after trypsinisation and resuspended in the FBS-supplemented medium, with or without colostrum whey (10 mg/ml) or cheese whey (10 mg/ml). Cells were seeded and allowed to attach to the cell culture dish for 18 h, followed by cell count. Values are the mean of viable cells/ml, with means with their standard errors of three independent experiments. Mean values were significantly different from control by the post hoc analysis. **P < 0·01.
Fig. 3.Morphological changes are observed in newly attached IPEC-J2 cell treated with colostrum and cheese wheys. (a) IPEC-J2 and (b) Caco-2/15 cells were recovered after trypsinisation and resuspended in Dulbecco's modified Eagle's medium supplemented with increasing concentrations (0·0, 0·1, 1 and 10 mg/ml) of colostrum or cheese wheys. Cells were seeded in cell culture dishes, and morphology was observed by microscopy after 48 h of incubation. Images shown are representative of three independent experiments.
Fig. 4.Colostrum whey promotes IPEC-J2 cell migration. IPEC-J2 monolayers were wounded with a razor blade, before treatment with colostrum whey or cheese whey (10 mg/ml). Migration was (a) measured and (b) photographed after 18 h. The graph represents mean values from three independent experiments with their standard errors. Mean values were significantly different from control by post hoc analysis. **P < 0·01.
List of known genes significantly increased or decreased more than 2-fold in colostrum whey-treated IPEC-J2 cells, as determined by microarray analysis and quantitative PCR analysis
| Fold change (log2) | |||||
|---|---|---|---|---|---|
| Gene symbol | Gene name | Primary accession | Probe name | Microarray | q-PCR |
| AREG | Amphiregulin | NM_214376 | A_72_P440121 | 1·18* | 0·75† |
| A_72_P302799 | 1* | ||||
| CDKN2B | Cyclin-dependent kinase inhibitor 2B | NM_214124 | A_72_P077616 | 1·44* | 1·49* |
| CITED2 | Cbp/p300-interacting transactivator 2-like | XM_001925774 | A_72_P491235 | −1·27* | |
| A_72_P555835 | −1·07 | ||||
| A_72_P548306 | −1·07* | ||||
| A_72_P192006 | −1·17* | ||||
| A_72_P500550 | −1·23* | ||||
| CSF2 | Colony-stimulating factor 2 | NM_214118 | A_72_P077726 | 2·12* | |
| CXCR4 | Chemokine (C–X–C motif) receptor 4 | AK238923 | A_72_P661857 | 1·02* | 0·98† |
| CYP1A1 | Cytochrome P450 1A1 | NM_214412 | A_72_P443804 | 1·73* | |
| A_72_P223362 | 1·6* | ||||
| CYR61 | Cysteine-rich, angiogenic inducer, 61 | ENSSSCT00000007604 | A_72_P580852 | 1·28* | |
| A_72_P688281 | 1·23* | ||||
| A_72_P552021 | 1·1* | ||||
| A_72_P319303 | 1* | ||||
| F3 | Tissue factor | NM_213785 | A_72_P177461 | 1·45* | 0·71* |
| A_72_P641835 | 1·37* | ||||
| FOS | FBJ murine osteosarcoma viral oncogene homologue | NM_001123113 | A_72_P441284 | 1·12* | |
| A_72_P670145 | 1·11* | ||||
| A_72_P205307 | 1·04* | ||||
| GADD45A | Growth arrest and DNA-damage-inducible, alpha | NM_001044599 | A_72_P146986 | 1·41* | |
| GADD45G | Growth arrest and DNA-damage-inducible, gamma | ENSSSCT00000010506 | A_72_P011276 | 1·05* | |
| HAS3 | Hyaluronan synthase 3 | NM_001001268 | A_72_P303284 | 1·36* | 0·86* |
| HBEGF | Heparin-binding EGF-like growth factor | NM_214299 | A_72_P035756 | 1·27* | 1·44 |
| A_72_P178751 | 1·06* | ||||
| HR | Hairless protein | TC543384 | A_72_P355953 | 2·59* | |
| IL-8 | IL-8 | NM_213867 | A_72_P232367 | 1·04* | 0·69† |
| NGF | Beta-nerve growth factor-like | ENSSSCT00000007392 | A_72_P290809 | 1·54* | 1·30* |
| PLAU | Plasminogen activator, urokinase | NM_213945 | A_72_P010246 | 1·46* | 0·97* |
| A_72_P073101 | 1·02* | ||||
| PTGS1 | Prostaglandin-endoperoxide synthase 1 | AK232305 | A_72_P063591 | 1·04* | 0·80 |
| RNF39 | RING finger protein 39-like | XM_003128244 | A_72_P108096 | 1·89* | |
| SERPINE1 | Serpin peptidase inhibitor, clade E, member 1 | NM_213910 | A_72_P077351 | 1·33* | 0·75 |
| A_72_P585596 | 1·14* | ||||
| A_72_P668499 | 1·12* | ||||
| SLITRK6 | SLIT and NTRK-like family, member 6 | ENSSSCT00000010401 | A_72_P452998 | −1·01* | |
| SMAD7 | SMAD family member 7 | ENSSSCT00000004979 | A_72_P492369 | 1·35* | 3·16* |
| SOX9 | SRY (sex-determining region Y)-box 9 | NM_213843 | A_72_P146931 | 1·08* | |
| SPB9 | Serine protease inhibitor 9 | TC587447 | A_72_P334903 | 1·3* | |
| TAGAP | t-cell activation Rho GTPase-activating protein | ENSSSCT00000004481 | A_72_P709805 | 1·75* | 1·24* |
| TIPARP | TCDD-inducible poly(ADP-ribose) polymerase | AK343870 | A_72_P024051 | 1·37* | |
| A_72_P036711 | 1·18* | ||||
| WNT11 | Wingless-type MMTV integration site family, 11 | ENSSSCT00000016217 | A_72_P219917 | 1·37* | |
| XKR8 | XK-related protein 8-like | XM_003127736 | A_72_P259637 | 1·24* | |
| ZNF503 | Zinc finger protein 503-like | XM_003133082 | A_72_P161271 | −1·11* | |
Fold changes = log2 (colostrum whey/control). *P < 0·05, †P < 0·1.
Fig. 5.Colostrum whey treatment significantly increased or decreased gene expression involved in proliferation, adhesion or migration of IPEC-J2. Gene expression in IPEC-J2 cells treated with colostrum whey (10 mg/ml) for 2 h, as determined by microarray analysis, is illustrated in the volcano plot. Genes involved in proliferation, adhesion or cell migration are represented in diamond-shape.
Functional classification (Gene Ontology (GO) biological processes) of genes with increased or decreased expression in colostrum whey-treated IPEC-J2 cells.
| Gene symbol | Gene name | Regulation of cell migration (GO:0030334), * | Regulation of cell adhesion (GO:0030155), * | Regulation of cell proliferation (GO:0042127), * | Response to wounding (GO:0009611), * |
|---|---|---|---|---|---|
| AREG | Amphiregulin | X | |||
| CDKN2B | Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) | X | |||
| CITED2 | Cbp/p300-interacting transactivator 2-like | X | X | ||
| CSF2 | Colony- stimulating factor 2 (granulocyte–macrophage) | X | |||
| CXCR4 | Chemokine (C–X–C motif) receptor 4 | X | X | ||
| CYP1A1 | Cytochrome P450 1A1 | X | |||
| CYR61 | Cysteine-rich, angiogenic inducer, 61 | X | X | X | X |
| F3 | Tissue factor | X | X | X | |
| FOS | FBJ murine osteosarcoma viral oncogene homolog | X | |||
| GADD45A | Growth arrest and DNA-damage-inducible, alpha | ||||
| GADD45G | Growth arrest and DNA-damage-inducible, gamma | ||||
| HAS3 | Hyaluronan synthase 3 | ||||
| HBEGF | Heparin-binding EGF-like growth factor | X | X | X | |
| HR | Hairless protein | ||||
| IL-8 | IL-8 | X | X | X | X |
| NGF | Beta-nerve growth factor-like | X | X | ||
| PLAU | Plasminogen activator, urokinase | X | X | X | X |
| PTGS1 | Prostaglandin-endoperoxide synthase 1 | X | |||
| RNF39 | RING finger protein 39-like | ||||
| SERPINE1 | Serpin peptidase inhibitor, clade E member 1 | X | X | X | X |
| SLITRK6 | SLIT and NTRK-like family, member 6 | ||||
| SMAD7 | SMAD family member 7 | X | X | ||
| SOX9 | SRY (sex determining region Y)-box 9 | X | X | X | |
| SPB9 | Serine protease inhibitor 9 | ||||
| TAGAP | t-cell activation Rho GTPase-activating protein-like | ||||
| TIPARP | TCDD-inducible poly(ADP-ribose) polymerase | ||||
| WNT11 | Wingless-type MMTV integration site family, member 11 | X | X | ||
| XKR8 | XK-related protein 8-like | ||||
| ZNF503 | Zinc finger protein 503-like |
*P values for the Bonferroni test.