Literature DB >> 26101183

Puerarin attenuates glucocorticoid-induced apoptosis of hFOB1.19 cells through the JNK- and Akt-mediated mitochondrial apoptotic pathways.

Dongdong Yu1, Shuai Mu1, Danyang Zhao1, Guangbin Wang1, Zhiguang Chen1, Hongfei Ren1, Qin Fu1.   

Abstract

Puerarin is an active component of Pueraria lobata, which is a commonly used Chinese herbal medicine for the treatment of osteoporosis. The present study aimed to evaluate the osteoprotective effect of puerarin on glucocorticoid (GC)-induced apoptosis of osteoblasts in vitro. The effects of puerarin on dexamethasone (DEX)-induced cell apoptosis were assessed using enzyme-linked immunosorbent assay and a terminal deoxynucleotidyl transferase dUTP nick-end labeling assay, and found that the viability of hFOB1.19 cells was significantly increased following exposure to between 10(-6) and 10(-10) M puerarin, with a maximal anti-apoptotic effect at a concentration of 10(-8) M. In addition, compared with the control group, puerarin upregulated the transcription and protein levels of B-cell lymphoma-2 and downregulated B-cell-associated X protein in the hFOB1.19 cells. Puerarin attenuated the DEX-induced release of cytochrome c and cleavage of caspase-3, and treatment with puerarin inhibited the c-Jun N-terminal kinase (JNK) pathway and activated the phosphoinositide 3-kinase (PI3K)/Akt pathway in the hFOB1.19 cells. Furthermore, the Akt inhibitor, LY294002, partly eliminated the protective effect of puerarin on DEX-induced apoptosis, and puerarin combined with the JNK inhibitor, SP600125, suppressed DEX-induced apoptosis to a lesser extent than in the cells treated with SP600125 alone. These results suggested that the JNK and PI3K/Akt signaling pathways mediate the inhibitory effects of puerarin on apoptosis in the hFOB1.19 cells. In conclusion, puerarin prevented DEX-induced apoptosis of hFOB1.19 cells via inhibition of the JNK pathway and activation of the PI3K/Akt signaling pathway in the cells, dependent on the mitochondrial apoptotic pathway. These results support puerarin as a promising target in the treatment of GC-induced osteoporosis.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26101183      PMCID: PMC4501663          DOI: 10.3892/ijmm.2015.2258

Source DB:  PubMed          Journal:  Int J Mol Med        ISSN: 1107-3756            Impact factor:   4.101


Introduction

Glucocorticoids (GCs) are widely used in the treatment of a variety of diseases, including autoimmune diseases, bronchial asthma and skin diseases. Although GCs are potent antiinflammatory agents, long-term use can lead to various adverse effects, including osteoporosis (3). GC-induced osteoporosis (GIOP), the major cause of which is considered to be impairment of bone formation (1,2) is the most common form of secondary osteoporosis (3). Excess GCs inhibits osteoblast maturation and differentiation, and promotes the apoptosis of osteoblasts (4), which is considered to be the third major cause of GIOP (4). Therefore, anti-apoptosis of osteoblasts is generally served as the pivotal target for the prevention of GCs-induced osteoporosis. Puerarin, a C-glycoside compound, is a major component derived from Pueraria lobata (Willd.), which is a commonly used Chinese herbal medicine (5). A number of investigations have been performed internationally to identify the pharmacology functions of puerarin. Previous studies have reported that puerarin possesses antioxidant (6,7), anti-inflammatory (8) and anti-apoptotic properties (7). In addition, investigations have revealed that puerarin has the ability to resist apoptosis in a variety of cells, including liver cells (9), osteoblasts (10), kidney cells (11) and nerve cells (12). Although it acts as an important regulator of cell death, the role of puerarin in the GC-induced apoptosis of osteoblasts and the underlying mechanisms remain to be fully elucidated. Apoptosis is an essential process in maintaining homeostasis under normal conditions (13). To date, studies have indicated that there are two predominant apoptotic pathways: the extrinsic, or death receptor, pathway and the intrinsic, or mitochondrial, pathway (14), B-cell-associated X protein (Bax) and B-cell lymphoma (Bcl)-2 are members of the Bcl-2 family, which is closely associated with the mitochondrial apoptotic pathway (15). Bcl-2 protein forms heterodimer complexes with Bax proteins, leading to the release of cytochrome c from the mitochondria and the induction of apoptosis (16). Liu et al (17) found that puerarin suppresses the apoptosis of human osteoblasts by increasing the protein levels of Bcl-2, while decreasing the levels of Bax in a dose-dependent manner. Wang et al (18) reported that puerarin prevents MPP-induced apoptosis of PC12 cells by suppressing the release of mitochondrial cytochrome c and activation of caspase-3. Several signaling pathways, including the phosphoinositide 3-kinase (PI3K)/Akt pathway and c-Jun N-terminal kinase (JNK) pathway, have also been demonstrated to regulate the apoptosis of osteoblastic cells (18–22). It has been observed that puerarin inhibits serum-free-induced apoptosis of human osteoblast cells (23), however, whether puerarin has an effect on the GC-induced apoptosis of osteoblast remains to be elucidated. The present study aimed to investigate the effects of puerarin on dexamethasone (DEX)-induced apoptosis in hFBO1.19 cells and examine the expression of several apoptosis-associated proteins, including Bcl-2, Bax, caspase-3 and cytochrome c were examined, to determine whether the effects were mediated by the JNK and PI3K/Akt signaling pathways.

Materials and methods

Reagents

DEX and 17β-estradiol (E2) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Puerarin (dissolved in dimethyl sulfoxide (DMSO; molecular weight 416.38; purity >98%) was obtained from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). DEX and pueranrin were used in a concentration gradient between 10−5 and 10−10 M. The final concentration of DEX (10−5 M) and of E2 (10−5 M) was dissolved in ethanol, and puerarin (10−5 M) was dissolved in DMSO (Sigma-Aldrich). The DEX, puerarin and E2 were stored at −20°C.

Cell culture

The conditionally immortalized human fetal osteoblastic cell line, hFOB1.19, was provided by Dr Meng (China Medical University, Shenyang, China). The cells were cultured, according to the procedures of American Type Culture Collection (Manassas, VA, USA) and those previously described (24). For in vitro proliferation, the hFOB1.19 cells were maintained in non-differentiation medium consisting of 1:1 Dulbecco’s modified Eagle’s medium (DMEM)/F-12 (GE Healthcare Life Sciences, Logan, UT, USA) medium with 10% fetal bovine serum (FBS; Biological Industries, Beit-Haemek, Israel), and 0.3 g/l G418 (Sigma-Aldrich), and were cultured in a humidified incubator with 5% CO2 at 33.4°C. The medium was replaced twice a week and the cells were cultured using 0.25% trypsin with 0.02% ethylenediaminetetraacetic acid (Sigma-Aldrich).

Cell proliferation assay

The hFOB1.19 cells, at 80–90% confluency, were inoculated at 3×103 cells/well in 96-well plates and the number of cells were quantified using an MTS assay, according to the manufacturer’s instructions (Promega Corporation, Madison, WI, USA). Briefly, 20 µl MTS solution was added to 100 µl culture medium in each well. Following incubation for 2 h at 37°C, the absorbance was read at a wavelength of 490 nm on a microplate reader (Varioskan LUX; Thermo Fisher Scientific, Vantaa, Finland), with measurements presented as the mean of at least three independent experiments, with each data point based upon three replicates. To assess the effects of puerarin on cell proliferation, the cells (5×103 per well) were incubated in conditioned medium at 37°C for 3, 12 and 24 h at a concentration gradient between 0, 10−5 and 10−9 M. Cells were incubated with DEX in conditioned medium for 24, 48 and 72 h at a concentration gradient between 0, 10−5 and 10−10 M.

Determination of cell death

Enzyme-linked immunosorbent assay (ELISA) detection was performed to detect the levels of apoptosis, as previously described (25). According to the kit protocol (Roche Molecular Biochemicals, Mannheim, Germany), the cells were plated at a density of 1×104 cells/well in 24-well plates at 37°C for 1 day and then cultured in the absence or presence of puerarin (10−6–10−9 M) and E2 (10−5 M) at 37°C for 3 h, followed by incubation with 10−5 M DEX medium at 37°C for 48 h. The cells were then rinsed with phosphate-buffered saline (PBS) and incubated with 0.5 ml lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China) at 4°C for 30 min, and centrifuged at 4°C for 10 min at 200 × g. Aliquots (20 µl) of the supernatant were then assessed for the rate of apoptosis using the Cell Death Detection ELISAPLUS kit (Roche Molecular Biochemicals). Quantitification of histone-associated DNA fragments were determined at 405 nm using a microplate ELISA reader (Varioskan LUX; Thermo Fisher Scientific).

Assessment of apoptosis

Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) (Beyotime Institute of Biotechnology, Shanghai, China) staining were performed according to the manufacturer’s instructions, and the cells were analyzed using flow cytometry (BD FACSCalibur; BD Biosciences, San Jose, CA, USA). Briefly, the cells were harvested by trypsinization and washed in PBS, and 1×105 cells were resuspended in 195 µl binding buffer (Roche Molecular Biochemicals). The cell solution (195 µl; 1×105 cells) were transferred to a 5 ml culture tube and incubated with 5 µl Annexin V-FITC and 10 µl PI for 15 min at 25°C in the dark. Following incubation, 300 µl binding buffer was added to each tube and the cells were analyzed using flow cytometry within 1 h. The cells, which stained positive for Annexin V-FITC and negative for PI were considered to be undergoing early stage apoptosis. Cells that stained positive for Annexin V-FITC and PI were considered to be undergoing late stage apoptosis and those that stain negative for Annexin V-FITC and PI remained alive. A terminal deoxynucleotidyltransferase-mediated dUTP nick-end labeling (TUNEL) assay was performed to identify apoptotic cells with fragmented DNA, which was performed using a in situ cell death detection kit, according to the manufacturer’s instructions (Roche Molecular Biochemicals). Briefly, the hFOB1.19 cells (5×103) were plated onto coverslips and cultured overnight at 37°C and reached 80–90% confluency. The cells were then cultured in medium with different concentrations of puerarin (10−8–10−9 M) at 37°C for 3 h, and then treated with 10−5 M DEX at 37°C for 48 h. Subsequently, the cells were fixed in immune stationary liquid (Beyotime Institute of Biotechnology, Suzhou, China) at 37°C for 60 min at room temperature and washed with immune washing liquid, containing 0.1% Triton X-100 (contained in immune washing liquid; Beyotime Institute of Biotechnology, Suzhou, China), for 2 min on ice. For counterstaining, 4-Diamino-2-phenylindole (DAPI) was used, and the TUNEL+ and DAPI+ nuclei in the cells were counted manually. The cells were observed using an Eclipse E600 fluorescence microscope (magnification, ×100; Nikon, Tokyo, Japan), in which six fields were randomly selected. The percentage of positive cells was calculated as the apoptotic index (AI) using the following equation: AI = (number of positive cells/total number of cells) × 100%, as previously described (26,27).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The total RNA was extracted from the cells using a MiniBEST Universal RNA Extraction kit (Takara Bio, Inc., Dalian, China). The concentration and purity of the total RNA were calculated with absorbance of 260 and 280 nm. Single strand cDNA synthesis was performed using a PrimeScript RT Master Mix kit (Takara, Bio, Inc.). The qPCR was performed using SYBR Premix Ex Taq (Takara, Bio, Inc.) on an Mx3000P Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) as follows: 50 cycles of 95°C for 10 sec and 60°C for 30 sec. Each reaction contains 10 µl SYBR Green 1, 2 µl primer, 1 µl dNTP, 2 µl Taq Polymerase, 5 µl cDNA and 30 µl ddH2O. All the reactions were repeated at least three times. The expression levels of the target genes, caspase-3, Bcl-2 and Bax, were calculated relative to housekeeping β-actin using Stratagene Mx3000P software (Applied Biosystems). The qPCR primers were designed using Primer 5.0 software, the sequences of which are listed in Table I.
Table I

Primer sequences.

NameForward primers (5′→3′)Reverse primers (5′→3′)
Caspase-3TGTGAGGCGGTTGTAGAAGTTGCTGCATCGACATCTGTACC
BaxGTCCAATGTCCAGCCCATGAATCATGTTTGAGACCTTCAACA
Bcl-2GGTGAACTGGGGGAGGATTGGGCAGGCATGTTGACTTCAC
β-actinATCATGTTTGAGACCTTCAACACATCTCTTGCTCGAAGTCCA

Western blot analysis

Total protein was extracted from the cells using radioimmunoprecipitation assay lysis buffer and quantified using a bicinchoninic acid protein assay (Beyotime Institute of Biotechnology, Suzhou, China). Equal quantities of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 10% gel) and transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). The membranes were then blocked with 5% nonfat milk in PBS for 1 h at room temperature and incubated with Bcl-2 (rabbit mAb; 2870), Bax (rabbit mAb; 5023), cytochrome c (rabbit mAb; 11940), Akt (rabbit mAb; 4691), phosphotylated (p)-Akt (Ser473; rabbit mAb; 4060), ERK1/2 (Rabbit Ab; 9102), p-ERK (rabbit mAb; 4370), p38 (rabbit mAb; 8690), p-p38 (rabbit mAb; 4511), JNK (rabbit Ab; 9252) and p-JNK (rabbit mAb; 4668) antibodies (1:1,000; Cell Signaling Technology, Inc., Beverly, MA, USA) overnight at 4°C. Following extensive washing in washing liquid 3 times, the membranes were re-probed with horseradish peroxidase (HRP)-conjugated secondary antibodies (Cell Signaling Technology, Inc.). The blots were then washed, and the signal was visualized using an HRP chemiluminescent substrate reagent kit (Invitrogen Life Technologies, Carlsbad, CA, USA), according to the manufacturer’s instructions. The band intensity was quantified using densitometric analysis with ImageJ 1.36 software (National Institutes of Health, Bethesda, MD, USA), with the absorbance ratio of each protein to the internal reference presented as the relative quantity of target protein.

Statistical analysis

SPSS version 11.5 for Windows was used for all statistical analyses. All data are expressed as the mean ± standard deviation. Statistical analyses of the data were performed using one-way analysis of variance. P<0.05 was considered to indicate a statistically significant difference. All experiments were repeated at least three times.

Results

Effects of puerarin on the viability of hFOB1.19 cells

To examine the effect of puerarin on the survival of hFOB1.19 cells, the present study performed an MTS assay using the puerarin- and vehicle (E2)-treated cells. The cells were treated with different concentrations of puerarin (0, 10−6–10−10 M) or E2 (10−5 M) for different durations (3, 12 and 24 h; Fig. 1). Treatment with lower concentrations of puerarin (10−8–10−9 M) increased cell growth and viability at all time-points (P<0.05), compared with the untreated control cells. Notably, the hFOB1.19 cells treated with puerarin at 10−8 M for 3 h exhibited the highest proliferation rate. By contrast, treatment with a higher dose of puerarin (10−6 M) had no significant effects on cell viability, compared with E2-treated and untreated cells. Therefore, the cells were treated with puerarin at a concentration of 10−8 M for a duration of 3 h in the subsequent experiments.
Figure 1

Puerarin promotes hFOB1.19 cell proliferation. Cells proliferation was measured using an MTS detection kit. The cells were treated with 0 M and 10−6–10−10 M puerarin for 3, 12 and 24 h. Treatment with 10−8 and 10−9 M puerarin significantly increased cell proliferation. Data are presented as the mean ± standard deviation. *P<0.05, vs control. OD, optical density.

DEX inhibits the proliferation of hFOB1.19 cells

The hFOB1.19 cells were exposed to various concentrations (0 and 10−5–10−9 M) of DEX for 24, 48 or 72 h, and the cell viability was analyzed using an MTS assay. DEX had significant inhibitory effects on cell proliferation at concentration of 10−5 and 10−6 M (Fig. 2). Treatment with DEX at 10−5 M resulted in a 49, 37 and 29% reduction of survival at 24, 48 and 72 h, respectively. Treatment with DEX at 10−6 M resulted in a 35, 30 and 25% reduction of survival at 24, 48 and 72 h, respectively. Thus, the hFOB1.19 cells were treated with DEX at a concentration of 10−5 M for a duration of 48 h in the subsequent experiments.
Figure 2

DEX inhibits hFOB1.19 cell proliferation. Cell proliferation was measured using an MTS detection kit following pretreatment of the cells with 0 M and 10−5–10−9 M DEX for 24, 48 and 72 h. Treatment with 10−5 and 10−6 M DEX significantly reduced cell proliferation. Data are presented as the mean ± standard deviation. *P<0.05, vs. control. DEX, dexamethasone; OD, optical density.

Puerarin suppresses DEX-induced apoptosis in hFOB1.19 cells, detected using ELISA and TUNEL

The present study used an ELISA to quantify DNA fragmentation, a hallmark of apoptosis (28). The hFOB1.19 cells were cultured in DEX (10−5 M)-containing medium for 48 h in the presence of either 0–10−6 M puerarin or 10−5 M E2. The hFOB1.19 cells in 10% FBS medium exhibited basal levels of apoptosis (0.13±0.01 ELISA absorbance units), while DEX treatment markedly increased the levels of apoptosis, compared with the control (1.71±0.01 ELISA absorbance units; Fig. 3). However, following exposure to puerarin the numbers of apoptotic cells in the cells treated with puerarin at concentrations of 10−10 M (1.64±0.03), 10−9 M (0.83±0.05), 10−8 M (0.64±0.05), 10−7 M (1.16±0.05) and 10−6 M (1.33±0.04 ELISA absorbance units) were lower, compared with those in the DEX-treated group and positive control group exposed to 10−5 M E2 (P<0.05). The maximal anti-apoptotic effect of puerarin was observed at a concentration of 10−8 M, and no anti-apoptotic effect was observed at a concentration of 10−10 M.
Figure 3

Purearin alleviates DEX-induced hFOB1.19 cell apoptosis. Cell apoptosis was measured using an enzyme-linked immunosorbent assay kit following pretreatment of the cells with 0 M and 10−6–10−10 M puerarin for 3 h. The cells were then incubated with DEX (10−5 M) for 48 h. Treatment with 10−8 and 10−9 M puerarin significantly reduced cell apoptosis. Data are presented as the mean ± standard deviation. *P<0.05, vs. DEX. DEX, dexamethasone.

A TUNEL assay was also performed in the present study, which also indicated that 10−8 M puerarin significantly decrease DEX-induced apoptosis in the hOB1.19 cells. The hFOB1.19 cells were treated with DEX (10−5 M) in the absence or presence of 10−8 and 10−9 M puerarin. The percentage of apoptotic cells exhibiting green condensed or fragmented nuclei, identified by TUNEL staining, was significantly lower in the cells treated with DEX in the presence of puerarin (Fig. 4), compared with the cells in the control group. The data from the above two assays indicated that puerarin protected the hFOB1.19 cells against DEX-induced apoptosis.
Figure 4

Effects of puerarin on apoptosis in hFOB1.19 cells, determined using a TUNEL assay. (A) Cells were pretreated with puerarin (0 or 10−8–10−9 M) for 3 h, and were then incubated with DEX (10−5 M) for 48 h. The number of apoptotic cells were determined using TUNEL staining and observed under a fluorescence microscope; original magnification, ×100. (B) Percentages of positive cells were calculated in six randomly selected fields as the apoptotic index using the following equation: AI = (number of positive cells/total number of cells) × 100%. Arrows indicate apoptotic cells. Data are presented as the mean ± standard deviation (n=3). *P<0.05, vs. DEX; #P<0.05, vs. control. DEX, dexamethasone; TUNEL, terminal deoxynucleotidyltransferase-mediated dUTP nick-end labeling; DAPI, 4-Diamino-2-phenylindole.

Effect of puerarin on the expression of apoptosis-associated protein in hFOB1.19 cells

To clarify the possible mechanisms by which puerarin attenuated DEX-induced apoptosis, western blot analysis and RT-qPCR were performed to examine a panel of apoptosis-associated proteins, including Bcl-2, Bax, caspase-3 and cytochrome c. The hFOB1.19 cells were incubated with DEX 10−5 M in combination with different concentrations of puerarin (0, 10−9, 10−8 and 10−7 M) for 48 h, following which the protein and mRNA levels were examined. The results demonstrated that puerarin increased the protein expression of Bcl-2, and decreased the protein expression of Bax in the hFOB1.19 cells in a dose-dependent manner (all P<0.05; Fig. 5). As the concentration of puerarin increased between 10−7 and 10−9 M, the protein expression of Bax decreased gradually, and 10−9 M puerarin almost eradicated the DEX-induced expression of Bax (P<0.05), compared with the cells treated with DEX only (Fig. 5). In addition, puerarin at concentrations of 10−8 and 10−9 M increased the protein expression of Bcl-2, and the maximal effect was observed at 10−8 M (P<0.05, compared with DEX alone; Fig. 5). In accordance, the results of the qPCR revealed similar results to the western blot analyses.
Figure 5

Effects of puerarin on DEX-induced changes in of Bcl-2 and Bax. (A) Cells were treated with puerarin (0, 10−7, 10−8 and 10−9 M) for 3 h prior to incubation with DEX (10−5 M) for 48 h. Western blot analyses for Bcl-2, Bax and β-actin was performed. (B) Relative expression levels of Bcl-2 and Bax compared with β-actin. Data are presented as the mean ± standard deviation (n=3). *P<0.05, vs. DEX; #P<0.05, vs. control. DEX, dexamethasone; Bcl-2, B-cell lymphoma-2; Bax, B-cell-associated X protein.

Cytochrome c was released into the cytoplasm in the DEX-treated cells, whereas pretreatment with puerarin at concentration between 10−7 and 10−9 M attenuated the DEX-induced release of cytochrome c (Fig. 6). Additionally, puerarin pretreatment significantly decreases the protein expression of cleaved caspase-3. Consistent with the results of cellular caspase activity, the results of the qPCR revealed that puerarin pretreatment significantly decreased the mRNA levels of caspase-3 (Fig. 7).
Figure 6

Effects of puerarin on the expression levels of caspase-3 and cytochrome c in the hFOB1.19 cells. (A) Cells were treated with puerarin (0, 10−7, 10−8 and 10−9 M) for 3 h prior to incubation with DEX (10−5 M) for 48 h. Western blot analyses were performed to detect the expression levels of caspase-3, cleaved caspase-3, cytochrome c, and β-actin. (B) Relative expression levels of cleaved caspase-3 and cytochrome c were compared with the expression levels of total caspase-3 and β-actin. Data are presented as the mean ± standard deviation (n=3). *P<0.05, vs. DEX; #P<0.05, vs. control. DEX, dexamethasone.

Figure 7

RT-qPCR analysis of caspase-3, Bax and Bcl-2. The cells were treated with puerarin (0, 10–7, 10−8 and 10−9 M) for 3 h prior to incubation with DEX (10−5 M) for 48 h. RT-qPCR was performed to analyzed expression levels of caspase-3, Bax and Bcl-2. Data are presented as the mean ± standard deviation. *P<0.05, vs. DEX; #P<0.05, vs. control. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; DEX, dexamethasone; Bcl-2, B-cell lymphoma-2; Bax, B-cell-associated X protein.

Puerarin inhibits the JNK pathway and activates the PI3K/Akt signaling pathway in hFOB1.19 cells

Puerarin exhibited no effects on p38 or extracellular signal-regulated kinase (ERK) phosphorylation, however, it increased the levels of p-Akt, and inhibited the levels of p-JNK (Fig. 8). The hFOB1.19 cells were treated with DEX (10−5 M) alone or in combination with puerarin (10−8 M) for 5, 30 or 60 min, respectively. The results revealed that DEX significantly increased the expression of p-JNK, with a maximal effect after 5 min, however, no effect on the expression of p-Akt was observed. Notably, the combined treatment with puerarin ameliorated the DEX-induced activation of the JNK pathway, which became apparent at 30 min and peaked 60 min after puerarin treatment. In addition, puerarin induced the phosphorylation of Akt, which peaked after 30 min.
Figure 8

Effects of puerarin on the phosphorylation of JNK and Akt in hFOB1.19 cells. (A and C) Cells were treated with DEX (10−5 M) alone or in combination with puerarin (10−8 M) for 5, 30 and 60 min. Western blot analysis was performed to detect the expression levels of p-JNK, JNK, p-Akt, Akt, p-ERK and ERK. (B) Relative expression levels of p-Akt and p-JNK compared with t-Akt and t-JNK were analyzed, respectively. Data are presented as the mean ± standard deviation (n=3). *P<0.05, vs. DEX; #P<0.05, vs. control. JNK, c-Jun N-terminal kinase; ERK, extracellular signal-regulated kinase; p-, phosphorylated; t-, total.

Effect of LY294002and SP600125 on puerarin-induced changes in the expression levels of p-Akt, p-JNK in hFOB1.19 cells

In order to clarify whether the PI3K/Akt inhibitor, LY294002, or JNK inhibitor, SP600125, had any effect on puerarin-induced phosphoralation changes of Akt and JNK, the present study incubated the cells with DEX, puerarin, LY294002 and SP600125, alone or in combination, for 30 min (p-Akt) or 5 min (p-JNK) (Fig. 9). The results demonstrated that puerarin combined with DEX increased the phosphorylation of Akt, compared with DEX alone, however, LY294002 partially abrogated this effect. The JNK inhibitor, SP600125, ameliorated DEX-induced phosphorylation of JNK (Fig. 10). In addition, puerarin combined with SP600125 almost eliminated the DEX-induced expression of p-JNK, indicating puerarin as a potent JNK suppressor, which had synergistic effect with SP600125.
Figure 9

Effects of LY294002 and SP600125 on the expression levels of p-Akt and p-JNK in hFOB1.19 cells. (A) Cells were treated with DEX (10−5 M), DEX (10−5 M) + LY294002 (10−5 M), or DEX (10−5 M) + puerarin (10−8 M) + LY294002 (10−5 M). Expression levels of p-Akt and t-Akt were detected using western blot analysis. (B) Cells were treated with DEX (10−5 M), DEX (10−5 M) + SP600125 (10−5 M), or DEX (10−5 M) + puerarin (10−8 M) + SP600125 (10−5 M). Expression levels of p-JNK and t-JNK were detected using western blot analysis. Data are presented as the mean ± standard deviation. *P<0.05, vs. DEX. JNK, c-Jun N-terminal kinase; p-, phosphorylated; t-, total.

Figure 10

Effects of JNK and Akt on the apoptosis of hFOB1.19 cells. (A) Cells were treated with puerarin (10−8 M), SP600125 (10−5 M) or LY294002 (10−5 M) for 3 h prior to incubation with DEX (10−5 M) for 48 h. Flow cytometric analysis was performed following Annexin V-FITC/PI double staining. The upper left quadrant represents dead cells or debris, the upper right quadrant represents the late stage of apoptotic cells, the lower right quadrant represents the early stage of apoptotic cells and the lower left quadrant represented normal cells. (B) Levels of apoptosis of the hFOB1.19 cells were analyzed. Data are presented as the mean ± standard deviation. *P<0.01, vs. DEX; #P<0.05, vs. control. DEX, dexamethasone; FITC, fluorescein isothiocyanate; PI, propidium iodide.

JNK and PI3K/Akt signaling pathways mediate the inhibitory effects of puerarin on apoptosis in hFOB1.19 cells

As puerarin treatment was observed to inhibit the JNK signaling pathway and activate the PI3K/Akt signaling pathway in the hFOB1.19 cells, and it is well known that these two pathways are closely associated with the regulation of apoptosis, the present study further examined whether these two pathways are involved in the anti-apoptotic activity of puerarin. Cell apoptosis was determined using Annexin V-FITC/PI flow cytometric analysis (Fig. 10). According to the results, DEX treatment significantly induced apoptosis, while combined treatment with puerarin significantly attenuated this effect. In addition, inhibition of the Akt pathway by LY294002 caused a marginal increase in DEX-induced apoptosis, and LY294002 partly eliminated the protective effect of puerarin on DEX-induced apoptosis, indicating that puerarin exhibited anti-apoptotic properties, partly dependent on the Akt signaling pathway. In line with the above results, puerarin combined with SP600125 suppressed DEX-apoptosis to a lesser extent, compared with SP600125 alone, suggesting that puerarin enhanced the anti-apoptotic effect of the JNK inhibitor, and that combination treatment may be a potentially therapeutic option for GC-induced osteoporosis.

Discussion

GCs are widely used for their unsurpassed anti-inflammatory and immunomodulatory effects, however, the clinical applications are limited by substantial adverse outcomes, including osteoporosis (29). GIOP is the most common cause of secondary osteoporosis (30) and the pro-apoptotic effect of high-dose GCs on osteoblasts has been identified as a major cause for GIOP (4,31,32). However, the underlying molecular mechanisms underlying this action remain to be elucidated, which has impeded the prevention and cure of this side effect. The identification of naturally occurring phytochemicals, which can antagonize osteopo rosis has received increased attention. Studies have demonstrated that dehydrocostus lactone, puerarin and chemical constituents of the fruits of Prunus mume can reverse GC-induced apoptosis in osteoblasts by regulating of various signaling pathways (10,33,34). Puerarin, the major isoflavonoid in the traditional Chinese herb pueraria lobata, is unique in that it contains a C-C conjugated glucose at position 8 of the isoflavonoid structure (35), and has been widely used in traditional Chinese medicine for the treatment of various diseases (36,37). Puerarin is reported to significantly facilitate the survival rate of osteoblasts, and regulate osteoblast proliferation and differentiation. In vivo studies have demonstrated that osteoblast implants in the puerarin-treated rats have a higher rate of bone formation (38,39). In addition, puerarin in the diet has been observed to effectively prevent osteoporosis in ovariectomized rats by increasing bone mineral density and bone mineral content (35,40). Furthermore, bone defects, created in rabbit parietal bone grafted using a mixture of puerarin and collagen, formed >5-fold more new bone, compared with defects grafted with collagen alone (41). In addition, various studies have reported that puerarin stimulates the proliferation and differentiation of osteoblasts and protects osteoblasts against cell death in vitro (10,17,35,42). In the present study, puerarin attenuated DEX-induced apoptosis in hFOB1.19 cells through activation of the PI3K/Akt signaling pathway and inhibition of the JNK signaling pathway. In addition, puerarin upregulated Bcl-2, downregulated Bax, and inhibited the cleavage of caspase-3 and release of cytochrome c. These findings indicated that puerarin exhibited anti-apoptotic properties through the mitochondrial apoptotic pathway. Mitochondria have been reported to be key in the regulation of apoptosis. The activation of Bax triggers the release of cytochrome c from the intermembrane space into the cytoplasm, which finally activates caspase enzymes that mediate the entrance in the execution phase of the apoptotic program (43). Anti-apoptotic Bcl-2-associated proteins suppress the activities of Bax and prevent the release of cytochrome c (44). Previous studies have demonstrated that puerarin suppresses apoptosis through regulation of the Bcl-2 family proteins in a variety of cells, including vascular endothelial cells, osteobastic cells, vascular smooth muscle cells and human neurons (10,45–47). In the present study, western blot analysis and RT-qPCR were used to examine the effect of puerarin on major members of the Bcl-2 family, including anti-apoptotic Bcl-2 and pro-apoptotic Bax (48). The results demonstrated that DEX repressed the expression of Bcl-2 and promoted the release of Bax. Puerarin attenuated these changes, indicating that puerarin exerted its activities by modulating Bcl-2 and Bax in hFOB1.19 cells. Caspase-3 is one of the major activated cysteine proteases in the caspase family and is pivotal in apoptosis. Caspase-3 was considered to be a central mediator of apoptosis, it cleaves a number of substrates and activates endonucleases, including the activation of caspase-activated DNase, which is responsible for internucleosomal DNA fragmentation, a hallmark of apoptosis (49–51). In addition to activation of the caspase family, the release of cytochrome c is regarded as a key regulatory event in apoptosis under certain conditions and is released from mitochondria into the cytosol, which results in caspase activation and cell apoptosis (52). It is reported that osteoblasts undergoing apoptosis in response to GCs exhibit typical features, including the activation of caspase-3 and release of cytochrome c (53,54). In the present study, DEX induced the cleavage of caspase-3 and the release of cytochrome c, whereas treatment with puerarin suppressed the cleavage of caspase-3 and release of cytochrome c, suggesting that puerarin inhibited DEX-induced apoptosis in a mitochondria-dependent manner. To further investigate the detailed mechanisms and signaling pathways involved in the anti-apoptotic activity of puerarin, the present study investigated the responses of the PI3K/Akt and MAPK serine/threonine kinase signaling pathways to puerarin treatment in the hFOB1.19 cells. MAPK pathways, including the ERK, JNK and p38 pathways, are activated by several stimuli, and one of their major functions is to connect cell surface receptors to transcription factors in the nucleus, which consequently triggers long-term cellular responses (54). ERK1/2 is generally associated with proliferation and growth. By contrast, the JNK and p38 pathways are pivotal in mediating apoptosis by modulating the transcription of apoptosis-associated genes, and is involved in the progression of apoptosis in osteoblasts (17–20,27,55–57). The present study provided the first evidence, to the best of our knowledge, that the JNK-MAPK pathways mediated the inhibitory effects of puerarin on DEX-induced apoptosis in the hFOB1.19 cells. Among the pathways linked to apoptosis resistance, the PI3K/Akt pathway stands out as the convergent point for a variety of stimuli generated at the cell surface (58,59). The PI3K/Akt pathway, which can be activated by growth factors and certain extracellular signals, regulates cell proliferation, differentiation and survival (60). It has been reported that the PI3K/Akt pathway is involved in the protection of osteoblasts from apoptosis (21,22,61). The present study investigated whether puerarin affected the activation of PI3K/Akt, and found that puerarin increased the phosphorylation of Akt. In addition, the involvement of the PI3K/Akt signaling pathway in the anti-apoptotic activity of puerarin was examined. The results revealed that PI3K inhibitor, LY294002, partially abrogated the anti-apoptotic effects of puerarin, confirming that the PI3K/Akt pathway is critical in the anti-apoptotic effect of puerarin against DEX-induced apoptosis in hFOB1.19 cells. In conclusion, the present study demonstrated that puerarin prevented the DEX-induced apoptosis of hFOB1.19 cells via inhibition of the JNK pathway and activation of the PI3K/Akt signaling pathway in hFOB1.19 cells, which was dependent on the mitochondrial apoptotic pathway. These results indicated puerarin as a promising target in the treatment of GC-induced osteoporosis.
  61 in total

1.  Colocalization of glucocorticoid and mineralocorticoid receptors in human bone.

Authors:  S Beavan; A Horner; S Bord; D Ireland; J Compston
Journal:  J Bone Miner Res       Date:  2001-08       Impact factor: 6.741

Review 2.  Glucocorticoid-induced osteoporosis.

Authors:  Yasuhiro Tamura; Hiroko Okinaga; Hiroshi Takami
Journal:  Biomed Pharmacother       Date:  2004-11       Impact factor: 6.529

Review 3.  Neuroprotective herbs for stroke therapy in traditional eastern medicine.

Authors:  Hocheol Kim
Journal:  Neurol Res       Date:  2005-04       Impact factor: 2.448

Review 4.  How do BCL-2 proteins induce mitochondrial outer membrane permeabilization?

Authors:  Jerry E Chipuk; Douglas R Green
Journal:  Trends Cell Biol       Date:  2008-03-07       Impact factor: 20.808

5.  In vitro and in vivo effects of puerarin on promotion of osteoblast bone formation.

Authors:  Ming-Yu Zhang; Hui Qiang; Hua-Qing Yang; Xiao-Qian Dang; Kun-Zheng Wang
Journal:  Chin J Integr Med       Date:  2012-03-30       Impact factor: 1.978

6.  Dexamethasone induces caspase activation in murine osteoblastic MC3T3-E1 cells.

Authors:  Chu Chang Chua; Balvin H L Chua; Zhongyi Chen; Cathy Landy; Ronald C Hamdy
Journal:  Biochim Biophys Acta       Date:  2003-09-23

7.  [Effects of puerarin on the neurocyte apoptosis and p-Akt (Ser473) expressions in rats with cerebral ischemia/reperfusion injury].

Authors:  Jiang-quan Han; Kui-ying Yu; Min He
Journal:  Zhongguo Zhong Xi Yi Jie He Za Zhi       Date:  2012-08

8.  Puerarin stimulates proliferation and differentiation and protects against cell death in human osteoblastic MG-63 cells via ER-dependent MEK/ERK and PI3K/Akt activation.

Authors:  Yue Wang; Wen Liang Wang; Wen Li Xie; Ling Zhi Li; Jing Sun; Wei Jia Sun; Hai Ying Gong
Journal:  Phytomedicine       Date:  2013-04-29       Impact factor: 5.340

9.  Mechanical induction of PGE2 in osteocytes blocks glucocorticoid-induced apoptosis through both the β-catenin and PKA pathways.

Authors:  Yukiko Kitase; Leonardo Barragan; Hai Qing; Shino Kondoh; Jean X Jiang; Mark L Johnson; Lynda F Bonewald
Journal:  J Bone Miner Res       Date:  2010-06-24       Impact factor: 6.741

10.  In vivo and in vitro assessment of pathways involved in contrast media-induced renal cells apoptosis.

Authors:  C Quintavalle; M Brenca; F De Micco; D Fiore; S Romano; M F Romano; F Apone; A Bianco; M A Zabatta; G Troncone; C Briguori; G Condorelli
Journal:  Cell Death Dis       Date:  2011-05-12       Impact factor: 8.469

View more
  4 in total

1.  Puerarin induces cell apoptosis in human chondrosarcoma cell line SW1353 via inhibition of the PI3K/Akt signaling pathway.

Authors:  Li Huang; Junqing Cao; Lan Cao; Ling Gao; Ying Yang; Li Xu
Journal:  Oncol Lett       Date:  2017-09-06       Impact factor: 2.967

2.  Anti-inflammatory and anti-osteoarthritis effects of tectorigenin.

Authors:  Cheng-Long Wang; Chuan-Dong Wang; Fei Xiao; Jun-Feng Zhu; Chao Shen; Bin Zuo; Yi-Min Cui; Hui Wang; Yuan Gao; Guo-Li Hu; Xiao-Ling Zhang; Xiao-Dong Chen
Journal:  Biol Open       Date:  2017-08-15       Impact factor: 2.422

3.  Cyclic Compressive Stress Regulates Apoptosis in Rat Osteoblasts: Involvement of PI3K/Akt and JNK MAPK Signaling Pathways.

Authors:  Fanglong Song; Yi Wang; Dawei Jiang; Tianchen Wang; Yinquan Zhang; Hui Ma; Yifan Kang
Journal:  PLoS One       Date:  2016-11-02       Impact factor: 3.240

4.  Overexpression of adrenomedullin protects mesenchymal stem cells against hypoxia and serum deprivation‑induced apoptosis via the Akt/GSK3β and Bcl‑2 signaling pathways.

Authors:  Hongjin Si; Yao Zhang; Yuqing Song; Lili Li
Journal:  Int J Mol Med       Date:  2018-03-05       Impact factor: 4.101

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.