Literature DB >> 26082878

Characterization of microsatellite loci for an Australian epiphytic orchid, Dendrobium calamiforme, using Illumina sequencing.

Dorset W Trapnell1, Rochelle R Beasley2, Stacey L Lance2, Ashley R Field3, Kenneth L Jones4.   

Abstract

PREMISE OF THE STUDY: Microsatellite loci were developed for the epiphytic pencil orchid Dendrobium calamiforme for population genetic and phylogeographic investigation of this Australian taxon. METHODS AND
RESULTS: Nineteen microsatellite loci were identified from an Illumina paired-end shotgun library of D. calamiforme. Polymorphism and genetic diversity were assessed in 24 individuals from five populations separated by a maximum distance of ∼80 km. All loci were polymorphic with two to 14 alleles per locus, expected heterozygosity ranging from 0.486 to 0.902, and probability of identity values ranging from 0.018 to 0.380.
CONCLUSIONS: These novel markers will serve as valuable tools for investigation of levels of genetic diversity as well as patterns of gene flow, genetic structure, and phylogeographic history.

Entities:  

Keywords:  Dendrobium calamiforme; Dockrillia calamiformis; Orchidaceae; genetic diversity; phylogeography; simple sequence repeat (SSR) markers

Year:  2015        PMID: 26082878      PMCID: PMC4467759          DOI: 10.3732/apps.1500016

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Molecular phylogeographic approaches can provide potent tests of historical biogeographic hypotheses, such as the influence of historical barriers to gene flow on evolutionary diversification. The tropical rainforests of northeastern Australia harbor a diverse flora rich in basal angiosperm lineages that has long been thought to have been assembled principally through ecological filtering of relict Gondwanan stock and exchange of lineages with Malesia and Southeast Asia (e.g., Webb and Tracey, 1981; Crayn et al., 2015). However, the role of in situ diversification in this old biome may be underappreciated. Within this biome, a congruent genetic discontinuity has been found in various fauna groups (e.g., Schneider et al., 1998) and tree species (Rossetto et al., 2009) across the biogeographic barrier known as the Black Mountain Corridor (BMC), located between Cairns and Cape Tribulation. To better understand the processes that gave rise to this pattern, and the significance of in situ diversification to the origins and maintenance of tropical rainforest diversity, we aim to determine the phylogeographic structure of a codistributed epiphytic orchid. These orchids release tiny, wind-borne seeds high in the air column, where they can be picked up by wind currents and potentially transported great distances. Dendrobium calamiforme Lodd. ex Lindl., commonly known as the pencil orchid in reference to the long, terete leaves, had been renamed Dockrillia calamiformis (Lodd. ex Lindl.) M. A. Clem. & D. L. Jones (Clements and Jones, 1996); however, this was rejected by Adams (2011). This orchid is indigenous to coastal tropical Queensland, Australia, ranging from Badu Island in the Torres Strait to Mount Elliott near Townsville, with nearly continuous distribution in its habitat across its range. It is a canopy and subcanopy epiphyte that grows in vine forest, swamp forest, beach forest, and riparian forest but is uncommon in ever-wet closed canopy rainforest. Although it can occur on large boulders, populations reach their highest density in large mature trees and can be locally abundant. Individuals become reproductive within five years and can live for several decades. Dendrobium calamiforme flowers in the dry season (July to September) and, while the pollination syndrome has not been verified, Hymenoptera, Coleoptera, and birds have been observed visiting flowering plants. The development of highly polymorphic microsatellite markers will allow insights into the levels and partitioning of neutral genetic variation in this common epiphytic orchid. With these markers, patterns of seed dispersal, colonization, and genetic connectivity across the BMC will be investigated. Based on the dispersal ability of D. calamiforme, we predict low genetic structure among populations straddling the BMC; however, biogeographic disjunctions have been found in Costa Rican epiphytic orchids (Trapnell and Hamrick, 2004; Kartzinel et al., 2013; Trapnell et al., unpublished) that appear to be maintained by cryptic processes.

METHODS AND RESULTS

Total DNA was extracted from one individual of D. calamiforme, following the cetyltrimethylammonium bromide (CTAB) protocol of Doyle and Doyle (1990). After shearing 1 μg of genomic DNA with a Covaris S220 Focused-ultrasonicator (Covaris, Woburn, Massachusetts, USA), a paired-end shotgun library was prepared with the Illumina TruSeq DNA Library Kit (Illumina, San Diego, California, USA). During library preparation, a multiplex identified adapter was incorporated as multiple species were run together on an Illumina MiSeq using 100-bp paired-end reads. The program PAL_FINDER_v0.02.03 (Castoe et al., 2012) was used to examine 5 million reads and identify those containing microsatellite repeats; positive reads were targeted for primer design using Primer3 (version 2.0.0; Rozen and Skaletsky, 1999). The frequency of designed primer sequences in all reads was assessed by the software, and only primers whose sequences occurred ≤2 times were selected to avoid duplicated loci. Forty-eight loci of the 5412 that met this criterion were chosen. To use a three-primer PCR with one universally labeled primer (CAG tag 5′-CAGTCGGGCGTCATCA-3′), one primer from each pair was modified at the 5′ end with the addition of the CAG tag sequence and the 5′ end of the second primer from each pair was modified with the addition of GTTT. The selected 48 primer pairs were tested for clean amplification and polymorphism across four individuals. The PCR amplifications were performed in a 12.5-μL volume (10 mM Tris [pH 8.4], 50 mM KCl, 0.25 μg bovine serum albumin [BSA], 0.4 μM unlabeled primer, 0.04 μM tag-labeled primer, 0.36 μM universal dye-labeled primer, 3.0 mM MgCl2, 0.8 mM dNTPs [Thermo Scientific, Waltham, Massachusetts, USA], 0.5 units AmpliTaq Gold Polymerase [Life Technologies, Carlsbad, California, USA], and 20 ng DNA template) using an Applied Biosystems GeneAmp PCR System 9700 (Life Technologies). For all loci, a touchdown thermal cycling program (Don et al., 1991) was used that had a 10°C span of annealing temperatures ranging between 65–55°C (TD65). The cycling profile consisted of an initial denaturation step of 5 min at 95°C followed by 20 cycles of 95°C for 30 s, highest annealing temperature (decreased 0.5°C per cycle) for 30 s, and 72°C for 30 s; and 20 cycles of 95°C for 30 s, lowest annealing temperature for 30 s, and 72°C for 30 s; and a final extension at 72°C for 5 min. After amplification, all PCR products were genotyped by running on an ABI-3130xl sequencer (Life Technologies) and using a size standard prepared according to DeWoody et al. (2004), with the exception that primers that were not fluorescently labeled had GTTT added to their 5′ ends. Results of fragment analysis were analyzed using GeneMapper version 3.7 (Life Technologies). Of the 48 loci tested, 19 yielded high-quality polymorphic PCR products and were characterized by trinucleotide (12 loci) and tetranucleotide (7 loci) repeat motifs (Table 1). The remaining 29 loci did not amplify well and therefore were not used.
Table 1.

Characteristics of 19 polymorphic microsatellite loci developed for Dendrobium calamiforme.

LocusPrimer sequences (5′–3′)Repeat motifAllele size range (bp)bTDc
Doca5F: *GAAGGTGGTAGTGCCAGAGCATC252–297TD65
R: AACTTGAATAACACACCCAAGC
Doca6F: *AGTTGTAAGCAATGTGCTAGGCATT219–273TD65
R: AAGGTTCAATTATTGCTCATAGGC
Doca10F: *TTGCTCTCTCTCTTCCTACAAATGCATCT212–222TD65
R: AGAGCGATAGAGAGGGTCTAAGATAGC
Doca11F: *GTCTTTGCTGACCAAGGTGCATT194–209TD65
R: AGGAGACGAGTCCAGGATGG
Doca13F: *CCACCTGCACCCATCTATCCTTC175–211TD65
R: CAACGCAAGGAAAGTCTCCG
Doca14F: *AATGCAATGACCATAAAGTGGCATT251–293TD65
R: CAACTAATCTACCATGCCTTCAAGC
Doca15F: *GGAAGCTGTGGGATTTCTGCTTC184–206TD65
R: CATGCTTCACAGCCCATCC
Doca16F: *CATTTGACGATATGGCGGGATT145–181TD65
R: CCAAAGACCGCTCTTGAAGG
Doca18F: *CATAATGGAGTCTTTCCTTCACCCATCT260–338TD65
R: CTGTTGGCGACCTCAGACC
Doca19F: *GACGACAGAATGTATGGCCGTTC222–271TD65
R: GACATAGATGCCGGTGAAGC
Doca25F: *GACCTAAACTTTCAACTTATACTCATAGCCATT219–264TD65
R: GCTCCTGATGCACAAATAAGAGC
Doca27F: *CTTCAATTACCCGACGAGCCATCT173–175TD65
R: GGAGACTGAGGTGAGACCAGG
Doca28F: *TGCATTTGCTATACAAACATCCCTTC283–313TD65
R: GGCTTCACAGGGATTGAACC
Doca33F: *CATATAAGATCGATAACTGATAAGACCGAATC204–212TD65
R: TACCATACCAGCATAGCCGC
Doca37F: *GGCAGACAAAGAGAGAATAAGGGATCT195–299TD65
R: TCTCTCAAACCCTCCACTTCC
Doca38F: *GAGAGAGACACAAAGCAAGGGATCT216–276TD65
R: TCTCTCTATCCCTCCACTGGC
Doca39F: *AGAGAAAGCGCGAGGAGGATCT244–267TD65
R: TCTCTTTATCCCTTCCCTTGC
Doca40F: *GGATATTAGAGTATGAACAAGGCATGGATT402–477TD65
R: TCTTCTTTATAGCCATCAATCAATAGG
Doca41F: *CGCTTGAAAGCACTAAATGCCATC272–299TD65
R: TGAAACAGGGCTCCAATTCC

The GenBank accession number for all loci is SAMN03437177.

Includes the length of the CAG tag.

Touchdown protocol used for PCR (see Methods and Results section).

Indicates CAG tag (5′-CAGTCGGGCGTCATCA-3′) label.

Characteristics of 19 polymorphic microsatellite loci developed for Dendrobium calamiforme. The GenBank accession number for all loci is SAMN03437177. Includes the length of the CAG tag. Touchdown protocol used for PCR (see Methods and Results section). Indicates CAG tag (5′-CAGTCGGGCGTCATCA-3′) label. We assessed the variability of these 19 loci in 24 specimens of D. calamiforme collected from five sites, spanning a distance of 79.7 km (Appendix 1). Vouchers from each site were deposited at the Australian Tropical Herbarium (CNS) (Appendix 1). Each site consisted of a small number of D. calamiforme individuals in each of two to five host trees. We used GenAlEx version 6.4 (Peakall and Smouse, 2006) to estimate the number of alleles per locus (A), observed heterozygosity (Ho), expected heterozygosity (He), and the probability of identity (PID). To test for deviations from Hardy–Weinberg equilibrium (HWE) and for linkage disequilibrium, GENEPOP version 4.0 (Rousset, 2008) was used. These 19 loci were highly polymorphic with mean per locus values of A = 8.4 (range = 2–14), He = 0.754 (0.486–0.902), and Ho = 0.496 (0.043–0.957). Mean population values were A = 3.7 (range = 2.5–5.0), He = 0.591 (0.484–0.693), Ho = 0.489 (0.432–0.588), and PID = 0.259 (0.161–0.370) (Table 2). After Bonferroni correction for multiple comparisons, 14 loci showed significant deviation from expectations under HWE (Table 2). Linkage disequilibrium was detected for 61 of the 171 paired loci comparisons, which is not surprising considering that our samples came from multiple small populations.
Table 2.

Genetic diversity values for five populations of Dendrobium calamiforme in Queensland, Australia, using 19 newly developed polymorphic microsatellite loci.

Font Hill Station (n = 5)Bruce Hwy. at Toogood Rd. (n = 5)Bruce Hwy. at Mulgrave River (n = 4)Barron River (n = 4)Centenary Lakes (n = 6)
LocusAHoHePIDAHoHePIDAHoHePIDAHoHePIDAHoHePID
Doca530.8000.5400.28540.4000.6400.18840.5000.6560.16940.2500.6560.16940.5000.6530.174
Doca620.6000.4200.42560.8000.7600.08840.7500.6560.16961.0000.8130.06271.0000.8060.062
Doca1020.000.4800.38641.0000.6600.16530.5000.4060.38820.3330.5000.37560.6670.7780.082
Doca1120.6000.4200.42530.2000.6200.21741.0000.7190.13060.7500.8130.06250.5000.7360.114
Doca1331.0000.6200.21750.6000.6000.19030.2500.4060.38841.0000.6670.15731.0000.5690.278
Doca1430.6000.6600.18940.4000.7200.12640.2500.7190.13040.2500.6560.16940.1670.6810.161
Doca1530.2000.5800.26540.4000.5800.22140.5000.6560.16940.2500.7190.13050.6670.7640.094
Doca1630.2000.5400.28550.8000.7400.10661.0000.8130.06240.7500.6560.16960.8330.7920.072
Doca1841.0000.6880.15561.0000.7800.08050.7500.7500.10141.0000.7190.13081.0000.8470.041
Doca1920.6000.4200.42550.4000.6800.14040.7500.6880.15530.5000.6250.21160.8330.7780.082
Doca2540.2000.7000.14540.4000.5800.22130.0000.6250.21130.2500.5310.28360.1670.7920.072
Doca2710.0000.0001.00020.0000.3200.51410.0000.0001.00010.0000.0001.00020.3330.4440.407
Doca2820.0000.4800.38620.0000.3750.46120.0000.3750.46120.0000.3750.46140.1670.5140.274
Doca3320.0000.4800.38620.2000.1800.68920.2500.4690.39230.2500.5940.24820.3330.2780.560
Doca3720.4000.3200.51440.8000.5800.22140.5000.6560.16910.0000.0001.00030.3330.5690.278
Doca3820.4000.3200.51450.6000.7800.08430.0000.6250.21130.5000.6250.21170.6670.8060.062
Doca3920.0000.4800.38630.2000.3400.46130.5000.6250.21120.0000.5000.37540.3330.7220.128
Doca4031.0000.6200.21760.6000.8000.06840.5000.6560.16960.5000.8130.06270.6670.8330.049
Doca4120.6000.4200.42561.0000.7800.08041.0000.7190.13050.7500.7810.08361.0000.8060.066
Mean2.50.4320.4840.3704.20.5160.6060.2273.50.4740.5900.2533.50.4390.5810.2825.00.5880.6930.161

Note: A = number of alleles identified; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals genotyped; PID = probability of identity.

See Appendix 1 for locality and voucher information.

Indicates significant deviations from Hardy–Weinberg expectations for all 24 samples after Bonferroni corrections.

Genetic diversity values for five populations of Dendrobium calamiforme in Queensland, Australia, using 19 newly developed polymorphic microsatellite loci. Note: A = number of alleles identified; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals genotyped; PID = probability of identity. See Appendix 1 for locality and voucher information. Indicates significant deviations from Hardy–Weinberg expectations for all 24 samples after Bonferroni corrections.

CONCLUSIONS

The 19 novel microsatellites developed for D. calamiforme revealed high levels of polymorphism and genetic diversity and thus should prove valuable for elucidating levels and patterns of genetic variation in future population genetic and phylogeographic investigations of this species in northeastern Australia. These highly variable markers may also be useful for discerning species boundaries among D. calamiforme and the putative taxa D. baseyanum St. Cloud and D. ×foederatum St. Cloud, which have in the past been recognized as occurring in the Cairns area of northeastern Australia (Field and Zich, 2012).
Appendix 1.

Geographic locations and voucher information for Dendrobium calamiforme samples collected from five sites in Queensland, Australia, and deposited in the Australian Tropical Herbarium (CNS) by Ashley R. Field (ARF).

Geographic coordinatesSite descriptionCNS primary collector no.
16°40′52.6″S, 145°10′47.0″EFont Hill Station in Baker and Blue Mountain RangeARF4151
16°57′02.1″S, 145°44′36.8″EBruce Hwy. and Toogood Rd. intersectionARF4154
17°06′00.3″S, 145°47′12.0″EBruce Hwy. crossing of Mulgrave RiverARF4155
16°52′29.7″S, 145°40′40.8″EBarron River off of Stony Creek Rd.ARF5152
16°54′08.6″S, 145°45′08.3″ECentenary Lakes, on track to Flecker Botanical GardenARF4150
  9 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  Partitioning nuclear and chloroplast variation at multiple spatial scales in the neotropical epiphytic orchid, Laelia rubescens.

Authors:  Dorset W Trapnell; J L Hamrick
Journal:  Mol Ecol       Date:  2004-09       Impact factor: 6.185

3.  Universal method for producing ROX-labeled size standards suitable for automated genotyping.

Authors:  J Andrew DeWoody; Jim Schupp; Leo Kenefic; Joseph Busch; Lisa Murfitt; Paul Keim
Journal:  Biotechniques       Date:  2004-09       Impact factor: 1.993

4.  'Touchdown' PCR to circumvent spurious priming during gene amplification.

Authors:  R H Don; P T Cox; B J Wainwright; K Baker; J S Mattick
Journal:  Nucleic Acids Res       Date:  1991-07-25       Impact factor: 16.971

5.  The influence of environment and life-history traits on the distribution of genes and individuals: a comparative study of 11 rainforest trees.

Authors:  M Rossetto; D Crayn; A Ford; R Mellick; K Sommerville
Journal:  Mol Ecol       Date:  2009-04       Impact factor: 6.185

6.  Relative importance of pollen and seed dispersal across a Neotropical mountain landscape for an epiphytic orchid.

Authors:  Tyler R Kartzinel; Richard P Shefferson; Dorset W Trapnell
Journal:  Mol Ecol       Date:  2013-11-08       Impact factor: 6.185

7.  genepop'007: a complete re-implementation of the genepop software for Windows and Linux.

Authors:  François Rousset
Journal:  Mol Ecol Resour       Date:  2008-01       Impact factor: 7.090

8.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

9.  Rapid microsatellite identification from Illumina paired-end genomic sequencing in two birds and a snake.

Authors:  Todd A Castoe; Alexander W Poole; A P Jason de Koning; Kenneth L Jones; Diana F Tomback; Sara J Oyler-McCance; Jennifer A Fike; Stacey L Lance; Jeffrey W Streicher; Eric N Smith; David D Pollock
Journal:  PLoS One       Date:  2012-02-14       Impact factor: 3.240

  9 in total
  2 in total

Review 1.  Genome-wide researches and applications on Dendrobium.

Authors:  Shi-Gang Zheng; Ya-Dong Hu; Ruo-Xi Zhao; Shou Yan; Xue-Qin Zhang; Ting-Mei Zhao; Ze Chun
Journal:  Planta       Date:  2018-07-31       Impact factor: 4.116

2.  Microsatellite markers: what they mean and why they are so useful.

Authors:  Maria Lucia Carneiro Vieira; Luciane Santini; Augusto Lima Diniz; Carla de Freitas Munhoz
Journal:  Genet Mol Biol       Date:  2016-08-04       Impact factor: 1.771

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.