| Literature DB >> 26077154 |
Stephen E Mshana1, Moritz Fritzenwanker2,3, Linda Falgenhauer4,5, Eugen Domann6,7, Torsten Hain8,9, Trinad Chakraborty10,11, Can Imirzalioglu12,13.
Abstract
BACKGROUND: Multi-drug resistant Klebsiella pneumoniae strains are a common cause of health care associated infections worldwide. Clonal spread of Klebsiella pneumoniae isolates carrying plasmid mediated CTX-M-15 have been commonly reported. Limited data is available regarding dissemination of chromosomally encoded CTX-M-15 in Klebsiella pneumoniae worldwide.Entities:
Mesh:
Substances:
Year: 2015 PMID: 26077154 PMCID: PMC4469578 DOI: 10.1186/s12866-015-0460-2
Source DB: PubMed Journal: BMC Microbiol ISSN: 1471-2180 Impact factor: 3.605
Primers used in this study to investigate CTX-M-15 location
| Name | Nucleotide-Sequence (5’-3’) |
|---|---|
| DOW2.55 | GCATCCAAGAGATTCTATCG |
| DOW2.5 | CATACACTCCCTTGTACGG |
| MP4b-F | TCCTCGACGTTCACGTCT |
| MP-3 F | AGGGTGAAGCTCAGCTTG |
| ALA2b | ATGGTTAAAAAATCACTGCG |
| ALA3b | TTTGCGCATACAGCGGCACAC |
| P2BC | CGCTGATTTAACAGATTCGG |
| PIAc | GGCGATCCGCGTGATACCAC |
| P2Dc | CAGCGCTTTTGCCGTCTAAG |
| MF-2 F | TGACGATGACCGCTTTCT |
| MF-2R | CGTCGACTACAGCTTTAA |
PCR fragment sizes with defined primer combinations as calculated based on the chromosomal insertion*
| Forward Primer | Reverse Primer | Resulting PCR-Fragment length in base pairs (bp) |
|---|---|---|
| ALA2b | ALA3b | 88 |
| ALA2b | P2Bc | 290 |
| ALA2b | P2Dc | 941 |
| ALA2b | MP4b-F | 1516 |
| MP-3 F | DOW2.55 | 1156 |
| MP-3 F | DOW2.5 | 1718 |
| MP-3 F | ALA3b | 2078 |
| MP-3 F | P2Bc | 2280 |
| MP-3 F | P2Dc | 2931 |
| MP-3 F | MP4b-F | 3506 |
| P1Ac | P2Dc | 410 |
| P1Ac | MP4b-F | 985 |
| MF-2 F | MF-2R | 3435 |
*When the insertion is not present at the examined locus, no specific PCR fragments should be able to be generated, except for the last primer pair, which should then give a PCR product of 459 base pairs (bp)
Fig. 1Dendogram (UPGMA, DICE) showing the similarity for the 23 K. pneumoniae ESBL positive strains. Line B indicates 80 % similarity. Note the clone A3, Phylogenetic group, wards A-I, PFGE clusters, isolate numbers and sequence type (ST)
Characteristics of the 23 K. pneumoniae isolates
| Isolate | Ward | PFGE cluster/group | ESBL type | Antibiotic resistance other than β-Lactams | Incompatibility group |
|---|---|---|---|---|---|
| 20 | A | B1 | CTX-M-3, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 61 | G | B1 | TEM-104 | GM, TET, SXT, CIP | FII, FIA, FIB |
| 25 | I | B2 | TEM-54 | GM, TET, SXT, CIP | FII, FIA, FIB |
| 57 | C | B2 | CTX-M-15, TEM-1 | GM, TET | FIA |
| 76 | B | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 82 | B | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 84 | B | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 115 | A | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA |
| 116 | A | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 30 | B | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 33 | A | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 34 | I | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 39 | B | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 31 | C | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 46 | B | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 65 | B | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| *71 | B | B3 | TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 78 | B | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 96 | G | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 80 | A | B3 | CTX-M-15, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 89 | C | B3 | CTX-M-3, TEM-1 | GM, TET, SXT, CIP | FIA, FIB |
| 5 | C | B3 | TEM-104 | GM, TET, SXT, CIP | ND |
| 52 | A | B3 | CTX-M-3, TEM-1 | GM, SXT, CIP | FIA, FIB |
*This isolate was positive for ESBL phenotypically but no ESBL gene was found
GM: Gentamicin, TET: Tetracycline, CIP: Ciprofloxacin, SXT: Sulphamethaxazole/trimethoprim, ND: not determined
Fig. 2Schematic diagram showing the chromosomal insertion site and the surrounding environment. a overview and chromosomal context compared to the reference genome of K. pneumoniae 342, accession number CP000964.1 b detailed view of the chromosomal insertion locus of blaCTX-M-15 in Klebsiella pneumoniae UR033115 (investigated clone no. 39) and binding sites of primers as seen in the Tables 1 and 2