Literature DB >> 26077154

Molecular epidemiology and characterization of an outbreak causing Klebsiella pneumoniae clone carrying chromosomally located bla(CTX-M-15) at a German University-Hospital.

Stephen E Mshana1, Moritz Fritzenwanker2,3, Linda Falgenhauer4,5, Eugen Domann6,7, Torsten Hain8,9, Trinad Chakraborty10,11, Can Imirzalioglu12,13.   

Abstract

BACKGROUND: Multi-drug resistant Klebsiella pneumoniae strains are a common cause of health care associated infections worldwide. Clonal spread of Klebsiella pneumoniae isolates carrying plasmid mediated CTX-M-15 have been commonly reported. Limited data is available regarding dissemination of chromosomally encoded CTX-M-15 in Klebsiella pneumoniae worldwide.
RESULTS: We examined 23 non-repetitive ESBL-producing Klebsiella pneumoniae strains isolated from clinical specimens over a period of 4 months in a German University Hospital. All isolates were characterized to determine their genetic relatedness using Pulsed-Field Gel Electrophoresis (PFGE) and Multi Locus Sequence Typing (MLST). PFGE revealed three clusters (B1, B2, and B3) with a sub-cluster (A3) comprising of 10 isolates with an identical PFGE pattern. All strains of the cluster B3 with similar PFGE patterns were typed as ST101, indicating an outbreak situation. The ESBL allele bla CTX-M-15 was identified in 16 (69.6 %) of all isolates, including all of the outbreak strains. Within the A3 sub-cluster, the CTX-M-15 allele could not be transferred by conjugation. DNA hybridization studies suggested a chromosomal location of bla CTX-M-15. Whole genome sequencing located CTX-M-15 within a complete ISEcp-1 transposition unit inserted into an ORF encoding for a putative membrane protein. PCR-based analysis of the flanking regions demonstrated that insertion into this region is unique and present in all outbreak isolates.
CONCLUSION: This is the first characterization of a chromosomal insertion of bla CTX-M-15 in Klebsiella pneumonia ST101, a finding suggesting that in Enterobacteriaceae, chromosomal locations may also act as reservoirs for the spread of bla CTX-M-15 encoding transposition units.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26077154      PMCID: PMC4469578          DOI: 10.1186/s12866-015-0460-2

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Klebsiella pneumoniae (K. pneumoniae) is among the most common multi-resistant bacteria causing healthcare associated infections [1-3]. Extended-spectrum β-lactamase (ESBL) producing K. pneumoniae are associated with both hospital and community infections [1, 4]. Worldwide, there is an increasing number of reports on CTX-M producing K. pneumonia isolates, as evidenced from data presented in different multi-centre studies. K. pneumoniae isolates with plasmids harbouring CTX-M-15 have been reported from clinical isolates both from Europe and America [1, 2, 5–7]. The mobility of genetic elements, in particular those conferring antibiotic resistance traits, together with clonal expansion contributes to the persistence of these strains in hospitals and in the community [4, 8]. There are currently only a few reports of chromosomally encoded CTX-M alleles in Escherichia coli, K. pneumoniae, Salmonella enterica and Proteus mirabilis [8-10]. Recently, K. pneumoniae strains with chromosomally integrated CTX-M-15 at an undetermined locus were typed as ST1 in a Spanish study [8]. Here we report the clonal outbreak of ESBL producing K. pneumoniae carrying blaCTX-M-15 in a distinct chromosomal location.

Methods

Bacterial isolates

Twenty-three non-repetitive, phenotypically proven ESBL producing- K. pneumoniae clinical isolates collected consecutively were studied. They represent 11.6 % of all K. pneumoniae isolated during the study period. These isolates were taken from miscellaneous specimens including urine, sputum, blood and various swabs over a period of 16 weeks from January 2007 to May 2007. The ESBL phenotype was detected using disk diffusion methods [11]. In addition to routine antimicrobial susceptibility testing by disk diffusion, the Minimal Inhibitory Concentrations (MIC) for cefepime and tigecycline were determined using E-Test stripes (AB BIODISK, Sweden) following the manufacturer’s instruction. Isolates with a MIC of ≥ 8 mg/L for cefepime and a MIC of ≥ 2 mg/L for tigecycline were considered resistant according to recommendations made by the Clinical Laboratory Standards Institute 2010 (CLSI, USA).

Genetic relatedness and genes encoding for β-lactamases

All isolates were screened for the presence of CTX-M, TEM and SHV genes using primers and methods described previously [12]. PCR fragments were sequenced with the ABI Prism 3100 sequencer (Life technology/Applied Biosystems, USA). DNA sequence analysis was performed using the DNASTAR software (DNASTAR, USA) and homology searches performed using the NCBI Blast database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). PFGE was performed according to the Pulse Net protocol of the Centre for Disease Control and Prevention (Atlanta, USA). Strain differentiation by PFGE analysis was achieved by comparison of band patterns using Gelcompar II (Applied Maths, Belgium). Patterns were normalized using the molecular weight marker (PFGE Lambda Marker, New England Biolabs, Germany). The similarity coefficient (SAB) of sample pairs was calculated based on band positions by using the DICE metric [13, 14]. Dendograms were generated to visualize relationships among the isolates. The cut-off value in the dendograms was calculated at a SAB of 0.97 as a threshold for defining clusters of genetically similar isolates. Phylogenetic grouping was performed using a rapid method combining gyrA PCR- restricted fragment length polymorphisms analysis (RFLP), parC-PCR and adonitol fermentation as described previously [15]. PCR based replicon typing was done as described by Carattoli et al. [16] to determine the replicons of plasmid in all clinical isolates. To detect sequence type (ST), MLST was performed as described previously [17]. Briefly, PCR for seven housekeeping genes (rpoB, gapA, mdh, pgi, phoE, infB and tonB) was conducted and the products were directly sequenced and analyzed for single loci variants.

Location of the CTX-M-15 gene

Conjugation was performed using plate mating experiments as described [18] . Plasmid analysis was done using the method described [19]. The DNA was transferred on a polyvinyl-based membrane using overnight capillary transfer (CUMC Protocol for Southern Blot, New York) and hybridization done using a CTX-M-15 DIG labelled probe (DIG High Prime DNA Labelling and Detection Starter Kit II, Roche, Germany) following manufacturer’s instructions. The whole genome sequence of chromosomal DNA of isolate number 39 was determined. Chromosomal DNA was isolated from an overnight culture with the Purelink DNeasy kit according to the manufacturer’s instructions (Invitrogen, Germany). The DNA was then sheared to about 290 bp on the Bioruptor sonication system (Diagenode, Belgium). A chromosomal DNA library was built on the ABI library builder, using the Library Builder™ Fragment Core Kit for SOLiD® 4 according to the protocol demonstrated by Life Technologies (Life Technologies, Germany). The library was then sequenced on a 316 Ion Torrent Chip using the Ion PGM 200 Sequencing Kit (Life Technologies, Germany). The Ion Torrent PGM (Life Technologies, Germany) produced 2.8 million reads with an average length of 185 bp, which amounted to 525.33 Mbp of bases, 324.43 Mbp of which were Q20 or higher quality. The reads were assembled using MIRA 3.4 [20], resulting in 650 contigs larger than or equal to 500 bp with an average coverage of 69.9 ×. The N50 contig size was 18,876 bp. The assembly was improved by manually adding PCR reads in Lasergene Seqman software environment (DNASTAR, USA). A CTX-M-15 carrying insertion element was detected on the chromosome. The inverted repeats of th element were found by comparing the sequence to those of Partridge [21] and Fukui et al. (accession number AB701572.1). Primers were designed (Tables 1 and 2) to study the regions flanking CTX-M-15.
Table 1

Primers used in this study to investigate CTX-M-15 location

NameNucleotide-Sequence (5’-3’)
DOW2.55GCATCCAAGAGATTCTATCG
DOW2.5CATACACTCCCTTGTACGG
MP4b-FTCCTCGACGTTCACGTCT
MP-3 FAGGGTGAAGCTCAGCTTG
ALA2bATGGTTAAAAAATCACTGCG
ALA3bTTTGCGCATACAGCGGCACAC
P2BCCGCTGATTTAACAGATTCGG
PIAcGGCGATCCGCGTGATACCAC
P2DcCAGCGCTTTTGCCGTCTAAG
MF-2 FTGACGATGACCGCTTTCT
MF-2RCGTCGACTACAGCTTTAA
Table 2

PCR fragment sizes with defined primer combinations as calculated based on the chromosomal insertion*

Forward PrimerReverse PrimerResulting PCR-Fragment length in base pairs (bp)
ALA2bALA3b88
ALA2bP2Bc290
ALA2bP2Dc941
ALA2bMP4b-F1516
MP-3 FDOW2.551156
MP-3 FDOW2.51718
MP-3 FALA3b2078
MP-3 FP2Bc2280
MP-3 FP2Dc2931
MP-3 FMP4b-F3506
P1AcP2Dc410
P1AcMP4b-F985
MF-2 FMF-2R3435

*When the insertion is not present at the examined locus, no specific PCR fragments should be able to be generated, except for the last primer pair, which should then give a PCR product of 459 base pairs (bp)

Primers used in this study to investigate CTX-M-15 location PCR fragment sizes with defined primer combinations as calculated based on the chromosomal insertion* *When the insertion is not present at the examined locus, no specific PCR fragments should be able to be generated, except for the last primer pair, which should then give a PCR product of 459 base pairs (bp)

Ethical approval

The study was approved by the ethics committee of the medical faculty of the Justus-Liebig-University of Giessen (AZ: 95/11). All samples were taken as part of standard care procedures.

Results

ESBL alleles, susceptibility and genetic relatedness

PFGE displayed 3 clusters (B1-B3) using a similarity coefficient (SAB) of 0.8 (Fig. 1). Cluster B3 with 19 (83 %) isolates formed the largest group; within this cluster there were 10 isolates which had an identical PFGE pattern (SAB 1.0, sub-cluster A3). Cluster B3 isolates were assigned to sequence type 101 and cluster B2 to the recently reported ST628, while a representative isolate from cluster B1 was assigned to ST16.
Fig. 1

Dendogram (UPGMA, DICE) showing the similarity for the 23 K. pneumoniae ESBL positive strains. Line B indicates 80 % similarity. Note the clone A3, Phylogenetic group, wards A-I, PFGE clusters, isolate numbers and sequence type (ST)

Dendogram (UPGMA, DICE) showing the similarity for the 23 K. pneumoniae ESBL positive strains. Line B indicates 80 % similarity. Note the clone A3, Phylogenetic group, wards A-I, PFGE clusters, isolate numbers and sequence type (ST) All isolates were resistant to cefotaxime, ceftazidime, ceftriaxone, gentamicin, ciprofloxacin, trimethoprim /sulphamethaxazole and cefepime but sensitive to imipenem, meropenem and tigecycline. CTX-M genes were found in 19/23 of K. pneumoniae isolates. CTX-M-15 was the most common allele found in 16/23 of isolates (Table 3). Isolate no. 71 had the same PGFE pattern as sub clone A3 isolates and phenotypically confirmed for ESBL production by disk approximation method. Even though the original strain was resistant to cefepime, on subculture it became sensitive with a MIC of 0.125 μg/ml. The *71 isolate was found to lack the CTX-M15 gene.
Table 3

Characteristics of the 23 K. pneumoniae isolates

IsolateWardPFGE cluster/groupESBL typeAntibiotic resistance other than β-LactamsIncompatibility group
20AB1CTX-M-3, TEM-1GM, TET, SXT, CIPFIA, FIB
61GB1TEM-104GM, TET, SXT, CIPFII, FIA, FIB
25IB2TEM-54GM, TET, SXT, CIPFII, FIA, FIB
57CB2CTX-M-15, TEM-1GM, TETFIA
76BB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
82BB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
84BB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
115AB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA
116AB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
30BB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
33AB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
34IB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
39BB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
31CB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
46BB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
65BB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
*71BB3TEM-1GM, TET, SXT, CIPFIA, FIB
78BB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
96GB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
80AB3CTX-M-15, TEM-1GM, TET, SXT, CIPFIA, FIB
89CB3CTX-M-3, TEM-1GM, TET, SXT, CIPFIA, FIB
5CB3TEM-104GM, TET, SXT, CIPND
52AB3CTX-M-3, TEM-1GM, SXT, CIPFIA, FIB

*This isolate was positive for ESBL phenotypically but no ESBL gene was found

GM: Gentamicin, TET: Tetracycline, CIP: Ciprofloxacin, SXT: Sulphamethaxazole/trimethoprim, ND: not determined

Characteristics of the 23 K. pneumoniae isolates *This isolate was positive for ESBL phenotypically but no ESBL gene was found GM: Gentamicin, TET: Tetracycline, CIP: Ciprofloxacin, SXT: Sulphamethaxazole/trimethoprim, ND: not determined

Plasmid analysis and chromosomal location

Plasmid analysis revealed that all isolates harboured multiple plasmids of various sizes ranging from less than 48.5 kb to 436.5 kb. Despite this fact, the CTX-M-15 resistance gene was not transferable from PFGE B3 sub cluster A3 isolates (n = 10) by conjugation or transformation in multiple attempts made. Hybridization using a CTX-M-15 DIG labelled probe indicated a chromosomal location in five isolates of PFGE type B3 subclone A3. Several colonies selected on a lysogeny broth plate containing 2 mg/L cefotaxime with a positive CTX-M PCR and phenotypically confirmed for ESBL production, were investigated for the insertion locus of the CTX-M-15 allele. In all cases a complete CTX-M-15/ISEcp1-element of 2,971 bp with flanking direct repeats (TCAAC) was found (Fig. 2 a/b). Comparison of the contig sequence obtained by whole-genome sequencing of a representative isolate (no.39/URO33115) of the PFGEsub cluster A3, which harbours the CTX-M-15/ISEcp1-element, with a reference strain sequence (K. pneumoniae 342, accession number CP000964.1) revealed that the element is inserted between the coding sequences (CDS) KPK_0275 (hypothetical protein) and KPK_0276 (putative membrane protein, Fig. 2 a/b), indicating integration of the transposition unit harbouring the ISEcp1 insertion sequence and the CTX-M-15 gene into the chromosome of the outbreak strain. The resulting contig sequence was deposited in the GenBank nucleotide database under accession number HG780615.
Fig. 2

Schematic diagram showing the chromosomal insertion site and the surrounding environment. a overview and chromosomal context compared to the reference genome of K. pneumoniae 342, accession number CP000964.1 b detailed view of the chromosomal insertion locus of blaCTX-M-15 in Klebsiella pneumoniae UR033115 (investigated clone no. 39) and binding sites of primers as seen in the Tables 1 and 2

Schematic diagram showing the chromosomal insertion site and the surrounding environment. a overview and chromosomal context compared to the reference genome of K. pneumoniae 342, accession number CP000964.1 b detailed view of the chromosomal insertion locus of blaCTX-M-15 in Klebsiella pneumoniae UR033115 (investigated clone no. 39) and binding sites of primers as seen in the Tables 1 and 2 The other 9 strains within the sub-cluster A3 (ST101) were all tested positive for the same insertion locus using a specifically developed, sequence-based PCR-assay underlining their clonal identity (Table 2).

Discussion

The study documents the presence of K. pneumoniae clones carrying a chromosomally located CTX-M-15 in a large University Hospital in Germany. The high prevalence of CTX-M-15 is consistent with many other studies worldwide [4, 6] but unlike those studies in a subset of isolates, the CTX-M-15 gene was not transferable by conjugation or transformation and DNA hybridization studies indicated a chromosomal localization for the gene. This was confirmed by whole genome sequencing and PCR mapping studies. Descriptions of chromosomal locations of ESBL genes in clinical isolates are extremely rare, with only a single report of chromosomally located CTX-M-15 at an undetermined location for a K. pneumoniae ST1 isolate and unlike the outbreak isolates reported here which were typed as ST101 [8]. ST101 belongs to the clonal complex 11; this clonal complex of K. pneumoniae has been associated with different ESBL alleles including CTX-M-15, OXA-48 and more recently KPC [22, 23]. It is now globally disseminated and is associated with healthcare-associated infections in North America, Europe and Asia [23-25]. It is worth noting that in most of the studies describing the epidemiology of blaCTX-M-15, the location of the gene is not always stated, thus a chromosomal location may be a more common phenomenon than previously suspected. In the present study the complete ISEcp1/CTX-M-15 transposition unit with inverted repeats was found to be located on the chromosome, resulting in the duplication of a 5 bp repeat sequence (TCAAC). The organization of this transposition unit was similar as in conjugative IncF plasmids [12, 26] where the CTX-M-15 gene was also found 49 bp downstream of ISEcp1. As described in reference plasmids the right inverted repeat was located in ORF477 (378 bp; GenBank accession no. HQ157357), downstream of the CTX-M-15 gene. This organization has been observed in 98 % of IncF plasmids carrying CTX-M-15 and also in the chromosome of Kluyvera ascorbata carrying CTX-M-3 [27]. Chromosomally encoded β-lactamases from some Kluyvera species have been proposed as a possible source of CTX-M enzymes. The finding from this study suggests that other Enterobacteriaceae might also act as intermediate hosts and as a possible source of CTX-M genes.

Conclusions

For the first time we describe the site of integration of a complete CTX-M-15/ISEcp1 element into the chromosome of a K. pneumoniae ST101 strain. This insertion site is distinct and differs markedly from a recently published sequence of a K. pneumoniae ST11 isolate where CTX-M-15 alleles were present both on a plasmid as well as a chromosomal location (CP006659.1, K. pneumoniae ATCC BAA-2146) [28]. The site of insertion also differs from that reported for the ST131 E. coli JJ1886 strain [29]. Our studies also reveal the presence of several large IncF plasmids in K. pneumoniae which have hitherto been poorly characterized, warranting additional studies. Using data derived in this study we have devised a specific PCR-based assay to examine for the chromosomal insertion of CTX-M-15 in ST101 K. pneumoniae isolates.

Availability of supporting data

The data set supporting the results of this article is available in GenBank under the accession number HG780615.
  29 in total

1.  Development of a rapid identification method for Klebsiella pneumoniae phylogenetic groups and analysis of 420 clinical isolates.

Authors:  S Brisse; T van Himbergen; K Kusters; J Verhoef
Journal:  Clin Microbiol Infect       Date:  2004-10       Impact factor: 8.067

2.  Molecular epidemiology of KPC-2- producing Klebsiella pneumoniae isolates in Brazil: the predominance of sequence type 437.

Authors:  Liliane M Seki; Polyana S Pereira; Maria da Penha A H de Souza; Magda de S Conceição; Elizabeth A Marques; Carlos Oliveira Porto; Elvira Maria L Colnago; Carlene de F M Alves; Deize Gomes; Ana Paula D A Carvalho Assef; Ørjan Samuelsen; Marise D Asensi
Journal:  Diagn Microbiol Infect Dis       Date:  2011-03-11       Impact factor: 2.803

3.  Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity.

Authors:  P R Hunter; M A Gaston
Journal:  J Clin Microbiol       Date:  1988-11       Impact factor: 5.948

4.  Characterisation of the CTX-M-15-encoding gene in Klebsiella pneumoniae strains from the Barcelona metropolitan area: plasmid diversity and chromosomal integration.

Authors:  Alicia Coelho; Juan José González-López; Elisenda Miró; Carles Alonso-Tarrés; Beatriz Mirelis; María Nieves Larrosa; Rosa María Bartolomé; Antonia Andreu; Ferran Navarro; James R Johnson; Guillem Prats
Journal:  Int J Antimicrob Agents       Date:  2010-04-13       Impact factor: 5.283

5.  Prevalence of transferable blaCTX-M-15 from hospital- and community-acquired Klebsiella pneumoniae isolates in Scotland.

Authors:  A Younes; A Hamouda; J Dave; S G B Amyes
Journal:  J Antimicrob Chemother       Date:  2010-12-05       Impact factor: 5.790

6.  Chromosome-encoded CTX-M-3 from Kluyvera ascorbata: a possible origin of plasmid-borne CTX-M-1-derived cefotaximases.

Authors:  María Margarita Rodríguez; Pablo Power; Marcela Radice; Carlos Vay; Angela Famiglietti; Moreno Galleni; Juan A Ayala; Gabriel Gutkind
Journal:  Antimicrob Agents Chemother       Date:  2004-12       Impact factor: 5.191

7.  Ceftazidime-hydrolysing CTX-M-15 extended-spectrum beta-lactamase (ESBL) in Poland.

Authors:  Anna Baraniak; Janusz Fiett; Waleria Hryniewicz; Patrice Nordmann; Marek Gniadkowski
Journal:  J Antimicrob Chemother       Date:  2002-09       Impact factor: 5.790

8.  Intercontinental spread of OXA-48 beta-lactamase-producing Enterobacteriaceae over a 11-year period, 2001 to 2011.

Authors:  A Potron; L Poirel; E Rondinaud; P Nordmann
Journal:  Euro Surveill       Date:  2013-08-01

9.  Complete Genome Sequence of the Epidemic and Highly Virulent CTX-M-15-Producing H30-Rx Subclone of Escherichia coli ST131.

Authors:  Paal S Andersen; Marc Stegger; Maliha Aziz; Tania Contente-Cuomo; Henry S Gibbons; Paul Keim; Evgeni V Sokurenko; James R Johnson; Lance B Price
Journal:  Genome Announc       Date:  2013-12-05

10.  Predominance of Klebsiella pneumoniae ST14 carrying CTX-M-15 causing neonatal sepsis in Tanzania.

Authors:  Stephen E Mshana; Torsten Hain; Eugen Domann; Eligius F Lyamuya; Trinad Chakraborty; Can Imirzalioglu
Journal:  BMC Infect Dis       Date:  2013-10-07       Impact factor: 3.090

View more
  12 in total

1.  The spread of KPC-producing Enterobacteriaceae in Spain: WGS analysis of the emerging high-risk clones of Klebsiella pneumoniae ST11/KPC-2, ST101/KPC-2 and ST512/KPC-3.

Authors:  Jesús Oteo; María Pérez-Vázquez; Verónica Bautista; Adriana Ortega; Pilar Zamarrón; David Saez; Sara Fernández-Romero; Noelia Lara; Raquel Ramiro; Belén Aracil; José Campos
Journal:  J Antimicrob Chemother       Date:  2016-08-15       Impact factor: 5.790

2.  Emergence and Evolution of Multidrug-Resistant Klebsiella pneumoniae with both blaKPC and blaCTX-M Integrated in the Chromosome.

Authors:  Weihua Huang; Guiqing Wang; Robert Sebra; Jian Zhuge; Changhong Yin; Maria E Aguero-Rosenfeld; Audrey N Schuetz; Nevenka Dimitrova; John T Fallon
Journal:  Antimicrob Agents Chemother       Date:  2017-06-27       Impact factor: 5.191

3.  Novel chromosomal insertions of ISEcp1-blaCTX-M-15 and diverse antimicrobial resistance genes in Zambian clinical isolates of Enterobacter cloacae and Escherichia coli.

Authors:  Misheck Shawa; Yoshikazu Furuta; Gillan Mulenga; Maron Mubanga; Evans Mulenga; Tuvshinzaya Zorigt; Christone Kaile; Manyando Simbotwe; Atmika Paudel; Bernard Hang'ombe; Hideaki Higashi
Journal:  Antimicrob Resist Infect Control       Date:  2021-05-10       Impact factor: 4.887

4.  Defining and Evaluating a Core Genome Multilocus Sequence Typing Scheme for Whole-Genome Sequence-Based Typing of Klebsiella pneumoniae.

Authors:  Haijian Zhou; Wenbing Liu; Tian Qin; Chen Liu; Hongyu Ren
Journal:  Front Microbiol       Date:  2017-03-08       Impact factor: 5.640

5.  Whole Genome Sequence Analysis of CTX-M-15 Producing Klebsiella Isolates Allowed Dissecting a Polyclonal Outbreak Scenario.

Authors:  Laura Becker; Stephan Fuchs; Yvonne Pfeifer; Torsten Semmler; Tim Eckmanns; Gerit Korr; Dagmar Sissolak; Michael Friedrichs; Edith Zill; Mei-Lin Tung; Christian Dohle; Martin Kaase; Sören Gatermann; Holger Rüssmann; Matthias Steglich; Sebastian Haller; Guido Werner
Journal:  Front Microbiol       Date:  2018-02-23       Impact factor: 5.640

6.  Genomic Epidemiology of an Outbreak of Klebsiella pneumoniae ST471 Producing Extended-Spectrum β-Lactamases in a Neonatal Intensive Care Unit.

Authors:  Yuan Wang; Chunyu Luo; Pengcheng Du; Jinrui Hu; Xiaowei Zhao; Dianjun Mo; Xiaoli Du; Xin Xu; Man Li; Hong Lu; Zhiqiang Zhou; Zhigang Cui; Haijian Zhou
Journal:  Infect Drug Resist       Date:  2020-04-15       Impact factor: 4.003

7.  Multidrug-resistant Klebsiella pneumoniae harboring extended spectrum β-lactamase encoding genes isolated from human septicemias.

Authors:  Isabel Carvalho; Nadia Safia Chenouf; José António Carvalho; Ana Paula Castro; Vanessa Silva; Rosa Capita; Carlos Alonso-Calleja; Maria de Lurdes Nunes Enes Dapkevicius; Gilberto Igrejas; Carmen Torres; Patrícia Poeta
Journal:  PLoS One       Date:  2021-05-04       Impact factor: 3.240

8.  Identification of a Cluster of Extended-spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Sequence Type 101 Isolated From Food and Humans.

Authors:  Lisandra Aguilar-Bultet; Claudia Bagutti; Adrian Egli; Monica Alt; Laura Maurer Pekerman; Ruth Schindler; Reto Furger; Lucas Eichenberger; Tim Roloff; Ingrid Steffen; Philipp Huebner; Tanja Stadler; Sarah Tschudin-Sutter
Journal:  Clin Infect Dis       Date:  2021-07-15       Impact factor: 9.079

9.  Characterization of vB_Kpn_F48, a Newly Discovered Lytic Bacteriophage for Klebsiella pneumoniae of Sequence Type 101.

Authors:  Nagaia Ciacci; Marco Maria D'Andrea; Pasquale Marmo; Elisa Demattè; Francesco Amisano; Vincenzo Di Pilato; Maurizio Fraziano; Pietro Lupetti; Gian Maria Rossolini; Maria Cristina Thaller
Journal:  Viruses       Date:  2018-09-09       Impact factor: 5.048

Review 10.  Prevalence of blaCTX-M Gene among Extended-Spectrum β-Lactamases Producing Klebsiella pneumoniae Clinical Isolates in Iran: A Meta-Analysis.

Authors:  Ebrahim Eskandari-Nasab; Mehdi Moghadampour; Arezoo Tahmasebi
Journal:  Iran J Med Sci       Date:  2018-07
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.