Literature DB >> 26066324

Correction: Hypothermia and Rewarming Induce Gene Expression and Multiplication of Cells in Healthy Rat Prostate Tissue.

.   

Abstract

Entities:  

Year:  2015        PMID: 26066324      PMCID: PMC4466597          DOI: 10.1371/journal.pone.0131261

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


× No keyword cloud information.
The second sentence of the final paragraph of the Introduction is incorrect. The correct sentence is: Ventral lobes of rat prostate tissues were used in determination of the relative mRNA expressions of AMR, TM and the transmembrane form of the PAcP (Quintero et al. 2007). Cellular form of PAcP in the cytosol has been suggested to down-regulate prostate cell growth in human prostate cancer cells [15]. There are errors in Table 1, “Primers used in qPCR analysis.” Please see the corrected Table 1 here.
Table 1

Primers used in qPCR analysis

Gene symbol/ accession numberDirectionPrimer sequenceAmplicon size
AMR NM_017123.1ForwardGTGCATGCCATTGCCTAGCTGA78
ReverseTCATTTCCGGTGTGGCTTGGCA
Bax NM_017059.2ForwardCCAGGACGCATCCACCAAGAAGC136
ReverseTGCCACACGGAAGAAGACCTCTCG
Bcl-2 NM_016993.1ForwardGAGGCTGGGATGCCTTTGTGGA89
ReverseGCTGAGCAGCGTCTTCAGAGA
CyD1 NM_171992.4ForwardATCAAGTGTGACCCGGACTG216
ReverseGCCACTACTTGGTGACTCCC
HSF1 XM_006241890.1ForwardCCATGAAGCACGAGAACGAG117
ReverseACTGCACCAGTGAGATCAGGA
PAcP NM_001134901.1ForwardCGGGATCCTGGTGATATTGCT70
ReverseCCGATACACGTCTCTCTGCC
p21 NM_080782.3ForwardACATCTCAGGGCCGAAAACG78
ReverseCTTGCAGAAGACCAATCGGC
TM NM_031771.2ForwardGATCTCCATTGCCAGCCT140
ReverseCACGTGCTGCAGTACTACCT
GAPDH BC029618ForwardTGGAAGGACTCATGACCACA160
ReverseTTCAGCTCAGGGATGACCTT
The legend for Fig 1, “Relative mRNA expressions of AMR, PAcP, TM, CyD1, p21 and HSF1 in rat ventral prostate,” does not appear. Please see the complete, correct Fig 1 legend here.
Fig 1

Relative mRNA expressions of AMR, PAcP, TM, CyD1, p21 and HSF1 in rat ventral prostate.

C, control; MH1, mild hypothermia 1; MH2, mild hypothermia 2; SH1, severe hypothermia 1; SH2, severe hypothermia 2; SHW1, severe hypothermia followed by rewarming at room temperature; SHW2, severe hypothermia followed by rewarming at +28C; **p≤0.01, ***p≤0.001 compared with MH1; ††p≤0.01, †††p≤0.001 compared with MH2; ‡‡p≤0.01, ‡‡‡p≤0.001 compared with SH1; data are mean ± SEM.

Relative mRNA expressions of AMR, PAcP, TM, CyD1, p21 and HSF1 in rat ventral prostate.

C, control; MH1, mild hypothermia 1; MH2, mild hypothermia 2; SH1, severe hypothermia 1; SH2, severe hypothermia 2; SHW1, severe hypothermia followed by rewarming at room temperature; SHW2, severe hypothermia followed by rewarming at +28C; **p≤0.01, ***p≤0.001 compared with MH1; ††p≤0.01, †††p≤0.001 compared with MH2; ‡‡p≤0.01, ‡‡‡p≤0.001 compared with SH1; data are mean ± SEM. The legend for Fig 2, “Bax mRNA to Bcl-2 mRNA ratios in rat ventral prostate” does not appear. Please see the complete, correct Fig 2 caption here.
Fig 2

Bax mRNA to Bcl-2 mRNA ratios in rat ventral prostate.

C, control; MH1, mild hypothermia 1; MH2, mild hypothermia 2; SH1, severe hypothermia 1; SH2, severe hypothermia 2; SHW1, severe hypothermia followed by rewarming at room temperature; SHW2, severe hypothermia followed by rewarming at +28C; **p≤0.01 compared with MH1; †p≤0.05 compared with SHW1; data are mean ± SEM.

Bax mRNA to Bcl-2 mRNA ratios in rat ventral prostate.

C, control; MH1, mild hypothermia 1; MH2, mild hypothermia 2; SH1, severe hypothermia 1; SH2, severe hypothermia 2; SHW1, severe hypothermia followed by rewarming at room temperature; SHW2, severe hypothermia followed by rewarming at +28C; **p≤0.01 compared with MH1; †p≤0.05 compared with SHW1; data are mean ± SEM. The legend for Fig 3, “EGFR-ligand AMR protein expression and proliferative Ki-67 index in rat ventral prostate” does not appear. Please see the complete, correct Fig 3 caption here. The publisher apologizes for these errors.
Fig 3

EGFR-ligand AMR protein expression and proliferative Ki-67 index in rat ventral prostate.

Mean AMR protein expression values in rat prostate ventral lobe tissues (A); cytosolic AMR immunoreactivity in SH1 (B) and in SHW1 (C); mean Ki-67 index values in rat prostate ventral lobe tissues (D); nuclear Ki-67 immunoreactivity in SH2 (E) and in SHW2 (F). C, control; MH1, mild hypothermia 1; MH2, mild hypothermia 2; SH1, severe hypothermia 1; SH2, severe hypothermia 2; SHW1, severe hypothermia followed by rewarming at room temperature; SHW2, severe hypothermia followed by rewarming at +28C; **p≤0.01, ***p≤0.001 compared with SHW1; ††p≤0.01, †††p≤0.001 compared with C; ‡p≤0.05 compared with MH2; scale bar = 50 μm; data are mean ± SEM.

EGFR-ligand AMR protein expression and proliferative Ki-67 index in rat ventral prostate.

Mean AMR protein expression values in rat prostate ventral lobe tissues (A); cytosolic AMR immunoreactivity in SH1 (B) and in SHW1 (C); mean Ki-67 index values in rat prostate ventral lobe tissues (D); nuclear Ki-67 immunoreactivity in SH2 (E) and in SHW2 (F). C, control; MH1, mild hypothermia 1; MH2, mild hypothermia 2; SH1, severe hypothermia 1; SH2, severe hypothermia 2; SHW1, severe hypothermia followed by rewarming at room temperature; SHW2, severe hypothermia followed by rewarming at +28C; **p≤0.01, ***p≤0.001 compared with SHW1; ††p≤0.01, †††p≤0.001 compared with C; ‡p≤0.05 compared with MH2; scale bar = 50 μm; data are mean ± SEM.
  1 in total

1.  Hypothermia and rewarming induce gene expression and multiplication of cells in healthy rat prostate tissue.

Authors:  Helena Kaija; Lasse Pakanen; Marja-Leena Kortelainen; Katja Porvari
Journal:  PLoS One       Date:  2015-05-21       Impact factor: 3.240

  1 in total
  1 in total

1.  Correction: Correction: Hypothermia and Rewarming Induce Gene Expression and Multiplication of Cells in Healthy Rat Prostate Tissue.

Authors: 
Journal:  PLoS One       Date:  2015-08-25       Impact factor: 3.240

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.