Letter Concerning: "Genotyping for Kidd, Kell, Duffy, Scianna, and RHCE Blood Group Antigens Polymorphisms in Jiangsu Chinese Han".

To the Editor: We have been genotyping blood group systems in Brazilian population[12] and most of the techniques used by us have been the restriction fragment length polymorphism-polymerase chain reaction (PCR), which were previously reported by Reid et al.[3] Based on the manuscript written by Liu et al.,[4] published in Chinese Medical Journal (Genotyping for Kidd, Kell, Duffy, Scianna, and RHCE blood group antigens polymorphisms in Jiangsu Chinese Han, Chin Med J 2012;125:1076-1081), we intended to change some genotyping procedures for allele specific-PCR technique. However, we detected an exchange in the identification of primers RHCE*E and RHCE*e shown in Table 1, line 18–20 (specifics primers) by Liu et al.[4] These primers were previously reported by Gassner et al.[5] and the correct sequences for RHCE oligonucleotides were: E-reverse gatgttctggccaagtgtcaactctc; e-reverse atgttctggccaagtgtcaactctg; and forward to both E and e-ctgctcaccatgctgatcttcct. After using the correct primers, the genotype for the RHCE*CE as well as the genotype for Kell, Duffy and Kidd blood group systems were specific and reproducible.

Authors’ Reply

First of all, thanks to the editors for giving us the opportunity to answer questions concerning our publication in Chinese Medical Journal entitled “Genotyping for Kidd, Kell, Duffy, Scianna, and RHCE blood group antigens polymorphisms in Jiangsu Chinese Han”.[4]

The authors of the letter to the editor stated that they detected an exchange in the identification of primers by RHCE*E and RHCE*e shown in the Table 1, line 18–20 (specifics primers). We double checked the data and found that the nucleotide sequences of the specific primers for genotyping RHEe in the Table 1 from the line 18–19 were correct, however, there were typos that line 18 “reverse” should be “forward,” and line 19 “forward” should be “reverse.” Although we tried to be careful in our proof reading, we did not notice this error. Sorry for the mistake, however, we had cited in this article that these primers were previously reported by Gassner et al.[5] (Prof. Qing Chen, Jiangsu Province Blood Center, Nanjing, Jiangsu 210042, China. E-mail: chenqing90@yahoo.com)