| Literature DB >> 26061363 |
Rafael Silva-Rocha1, Marjorie Cornejo Pontelli1, Gilvan Pessoa Furtado1, Livia Soares Zaramela1, Tie Koide1.
Abstract
Our ability to genetically manipulate living organisms is usually constrained by the efficiency of the genetic tools available for the system of interest. In this report, we present the design, construction and characterization of a set of four new modular vectors, the pHsal series, for engineering Halobacterium salinarum, a model halophilic archaeon widely used in systems biology studies. The pHsal shuttle vectors are organized in four modules: (i) the E. coli's specific part, containing a ColE1 origin of replication and an ampicillin resistance marker, (ii) the resistance marker and (iii) the replication origin, which are specific to H. salinarum and (iv) the cargo, which will carry a sequence of interest cloned in a multiple cloning site, flanked by universal M13 primers. Each module was constructed using only minimal functional elements that were sequence edited to eliminate redundant restriction sites useful for cloning. This optimization process allowed the construction of vectors with reduced sizes compared to currently available platforms and expanded multiple cloning sites. Additionally, the strong constitutive promoter of the fer2 gene was sequence optimized and incorporated into the platform to allow high-level expression of heterologous genes in H. salinarum. The system also includes a new minimal suicide vector for the generation of knockouts and/or the incorporation of chromosomal tags, as well as a vector for promoter probing using a GFP gene as reporter. This new set of optimized vectors should strongly facilitate the engineering of H. salinarum and similar strategies could be implemented for other archaea.Entities:
Mesh:
Substances:
Year: 2015 PMID: 26061363 PMCID: PMC4465625 DOI: 10.1371/journal.pone.0129215
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Fig 1Modular design of pHsal vector series.
The format is inspired in the SEVA platform [] and is divided into four modules: (i) the E. coli specific part (origin of replication and ampicillin resistance gene); (ii) the replication origin; (iii) the resistance marker (tagged as AbR) and (iv) the cargo. Each module is flanked by a unique restriction site that allows the easy replacement of a segment by a new sequence (for example, different resistance markers or origin of replications). The cargo is the main region of the vectors since it is used for cloning the fragments of interest.
Fig 2Schematic representation of the cargo architecture.
(A) The basic cargo is a 150 nt long sequence containing an extensive multiple cloning site and a pair of universal primers (F24 and R24), allowing the user to easily clone and check the sequence of interest. (B) The expression systems of the pHsal series are cloned as PacI/AvrII fragments at the 5’-end of the MCS. (C) The reporter systems for promoter probing are cloned as HindIII/SpeI fragments at the 3’-end of the MCS. With this design, the fragments of interest could be cloned using any of the restriction sites from AvrII to HindIII, always considering the directionality of the expression and reporter systems.
Fig 3Physical maps of the modular cloning (pHsal-C) and suicide (pHsal-S) vectors.
The main features of the vectors are represented, along with their relative positions. (A) pHsal-C is formed by the cargo, a mev resistance marker and an origin for autonomous replication in H. salinarum, while (B) pHsal-S is endowed with a mevR and an ura3 marker and is devoid of replication origins for this archaeon. Yet, both vectors have the fragment with the ApR resistance marker (bla gene) and the ColE1 replication origin for replication and selection in E. coli host.
Fig 4Sequence optimization of a strong promoter sequence for H. salinarum.
(A) A 200 bp long sequence for the fer2 promoter was sequence edited by overlapping PCR to eliminate 3 restriction sites for the enzymes NcoI, SphI and SmaI. The resulting edited sequence was named Pzero, cloned in front of a promoterless GFP reporter gene and inserted in H. salinarum NRC-1. In the schema, the TATA box, BRE, PPE and UAS elements are represented []. (B) For the analysis of promoter activity, H. salinarum strains were assayed at mid (16h) and late (24h) exponential phases and the activity of the edited promoter was compared to the wild type sequence (Pfer2). An empty vector with no promoter cloned was used as control to check basal GFP expression of the system. Vertical bars represent standard deviation from experiments performed in triplicate.
Fig 5Construction of H. salinarum strains with chromosomal tags.
(A) A suicide plasmid pHsal-S-Lsm::FLAG-tag, harboring a modified flanking region of the Lsm gene to introduce a FLAG-tag epitope, was transformed into H. salinarum. Double recombination events were selected and correct incorporation of the FLAG-tag was checked using primers Pck1 and Pflag. As a control, primers Pck1/Pck2 were used to amplify the whole flanking region of the Lsm coding gene. (B) PCR validation of the FLAG-tag incorporation. Ten (numbered from 1 to 10) independent colonies were selected and screened using primers Pck1/Pflag, which should give rise to an amplification band of ~ 600 bp. The 1.0 kb DNA ladder is shown on line 1, while line 2 shows the amplification control, representing the flanking region obtained using primers Pck1/Pck2.
Strains, plasmids and primers used in this study.
| Strains | Description | Reference |
|
|
| [ |
|
| Wild type reference strain of | [ |
| Plasmids | ||
| pMTF1025GFP_CHA |
| Baliga’s lab |
| pUC19 |
| [ |
| pRzero |
| This study |
| pRU |
| This study |
| pRO |
| This study |
| pHsal-S |
| This study |
| pHsal-C |
| This study |
| pHsal- |
| This study |
| pHsal- |
| This study |
| Primers |
|
|
| 5-pUC-BglII | GGCG | This study |
| 3-pUC-AscI | CGCC | This study |
| 5-mev-SpeI | GCGG | This study |
| 3-mut1 | GACGAGCAGTCGGCGGGCCTCGGCGGCGGTG | This study |
| 5-mut1 | CACCGCCGCCGAGGCCCGCCGACTGCTCGTC | This study |
| 3-mut2 | GACGGAGCCGCCGTCCACGCTGACGGGGCCG | This study |
| 5-mut2 | CGGCCCCGTCAGCGTGGACGGCGGCTCCGTC | This study |
| 3-mev-AscI | CCGC | This study |
| 3-mev-XbaI | CCGC | This study |
| 5-Pfer2-KpnI | GCGC | This study |
| 5-Pfer2-M | CATACCCCCACCATGCCCATGCCGTGGATAA | This study |
| 3-Pfer2-M | TTATCCACGGCATGGGCATGGTGGGGGTATG | This study |
| 3-Pfer2 | TTGTGTGACCGCCATCACG | This study |
| 5-GRB1-PacI | GCGG | This study |
| 3-GRB1-BglII | CCGC | This study |
| 5-Pzero-PacI | GCGC | This study |
| 3-Pzero-AvrII | GCGC | This study |
| 5-GFP-HindIII | GCGC | This study |
| 3-GFP-SpeI | GCGC | This study |
| 5-FLAG | GACTACAAAGACGATGACGACAAG | This study |
| 3-FLAG | CTTGTCGTCATCGTCTTTGTAGTC | This study |
| 5-Lsm-EcoRI | ATCT | This study |
| 3-Eflag | TTACTTGTCGTCATCGTCTTTGTAGTCTGGTTTGATGGTGACG | This study |
| 5-Eflag | GACGATGACGACAAGTAACTGGCGCAGGAACCCCGA | This study |
| Pck2 | AGAT | This study |
| Pck1 | TTGGGTTCGACCTCGACGTG | This study |
| Pflag | CTTGTCGTCATCGTCTTTGTAGTC | This study |