Literature DB >> 26021472

The c-Myc-LDHA axis positively regulates aerobic glycolysis and promotes tumor progression in pancreatic cancer.

Tian-Lin He1, Yi-Jie Zhang, Hui Jiang, Xiao-Hui Li, Hai Zhu, Kai-Lian Zheng.   

Abstract

The transcription factor c-Myc plays critical roles in cancer development and progression through regulating expression of targeted genes. Lactate dehydrogenase A (LDHA), which catalyzes the conversion of L-lactate to pyruvate in the final step of anaerobic glycolysis, is frequently upregulated in pancreatic cancer. However, little is known about the effects of c-Myc-LDHA axis in the progression of pancreatic cancer. In this study, we found that c-Myc and LDHA are concomitantly overexpressed in pancreatic cancer cell lines and clinical specimens. c-Myc overexpression and LDHA overexpression were correlated with TNM stage and tumor size and indicated poor prognosis in patients with pancreatic cancer. Knockdown of c-Myc reduced the protein expression of LDHA, lactate production and glucose consumption, and silencing of LDHA mimicked this effect. Meanwhile, reduced c-Myc-LDHA signaling resulted in decreased tumor growth and metastasis in pancreatic cancer. Treatment with 2-Deoxy-D-glucose, an inhibitor of anaerobic glycolysis, completely blocked the oncogenic roles of c-Myc-LDHA signaling. Taken together, dysregulated c-Myc-LDHA signaling plays important roles in aerobic glycolysis and facilitates tumor progression of pancreatic cancer.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26021472      PMCID: PMC4452209          DOI: 10.1007/s12032-015-0633-8

Source DB:  PubMed          Journal:  Med Oncol        ISSN: 1357-0560            Impact factor:   3.064


Introduction

Pancreatic cancer is one of the most common malignancies worldwide, and its incidence is increasing annually, especially in industrialized countries [1]. Although great achievements have made in early diagnosis, surgical resection and systemic chemotherapy for pancreatic cancer, the overall 5-year survival rate in patients with pancreatic cancer remains at 6 % [2]. The disappointing survival rate and poor prognosis of pancreatic cancer indicate the aggressive nature of this disease. Therefore, it is of great importance to understand the molecular mechanisms that underlie the initiation and progression of pancreatic cancer [3, 4]. c-Myc is a crucial transcription factor involved in the regulation of multiple cellular functions including cell growth, apoptosis, differentiation, protein synthesis, and cell adhesion and energy metabolism [5]. The involvement of c-Myc in such a broad spectrum of cellular functions might be explained by the data that c-Myc binds 10–15 % of all promoter regions [6]. However, the protein encoded by this gene is frequently deregulated in several types of human tumors [7, 8]. Because c-Myc exerts its functions mainly through transcriptional regulation of target genes that associate with tumorigenesis and progression via different mechanisms, c-Myc is therefore an attractive target for cancer therapy [9]. An increase in aerobic glycolysis, which is the ability to switch from an oxidative metabolism to glycolysis and the production of lactate even when oxygen is plentiful (Warburg effect), is a key characteristic of solid tumors, including pancreatic cancer [10]. Because it is closely associated with tumor growth and progression, aerobic glycolysis is considered a metabolic signature for invasive cancer [11]. Lactate dehydrogenase A (LDHA), which catalyzes the last step of anaerobic glycolysis, is abnormally expressed in many human cancers including pancreatic cancer [12], hepatocellular carcinoma [13] and breast cancer [14]. c-Myc can regulate aerobic glycolysis through targeting the metabolic enzymes including HK2, PFKL LDHA, PDK1, etc. [15]. However, the precise role of c-MycLDHA axis in aerobic glycolysis and tumor cell phenotype of pancreatic cancer remains unclear. In this study, we determined the expression pattern and clinical significance of c-MycLDHA axis in pancreatic cancer. We found that up-regulated c-MycLDHA axis is closely associated with tumor progression and indicates a poor prognosis in pancreatic cancer. Suppression of c-MycLDHA axis caused reduced aerobic glycolysis and further contributed to growth arrest and inability of invasion in pancreatic cancer cells.

Materials and methods

Cell culture and reagents

Human pancreatic cancer cells including AsPC-1, BxPC-3, Capan-2, CFPAC-1, HPAC, PANC-1, MiaPaca2 and SW1990 were cultured in specific media supplemented with 10 % (v/v) fetal bovine serum (FBS), 100 U/mL, penicillin and 100 μg/mL streptomycin at 37 °C in a humidified incubator with 5 % CO2. 2-DG (Sigma, USA) was diluted to preferable concentrations in culture medium before use.

Immunohistochemistry

Tissue microarray (TMA) that contained 90 cases of pancreatic cancer tissues used in current study was purchased from Shanghai Outdo Biotech Inc (HPan-Ade180Sur-01). The collection of human specimens was approved by the Medical Institutional Review Boards in Shanghai and in accordance with the highest ethical guidelines. The follow-up time was calculated from the date of surgery to the date of death, or the last known follow-up. The TMA of pancreatic cancer was deparaffinized with xylene and rehydrated using graded ethanol. After washing in phosphate-buffered saline (PBS) for three times, antigen retrieval and neutralization of endogenous peroxidase were performed, followed by incubation with 5 % bovine serum albumin for 1 h. After rinsing with PBS for three times, slides were incubated overnight at 4 °C with primary antibody (c-Myc, Abcam, #32072; LDHA, Proteintech, #19987-1-AP). After washing in PBS for three times, the sections were incubated with HRP-labeled anti-rabbit secondary antibody for 1 h at room temperature. Visualization was performed by 3, 3′-diaminobenzidine tetrahydrochloride (DAB) and counterstained by hematoxylin. Scoring was conducted according to the positive area and the intensity score as follows. The positive area: 0–10 % scored 0; 11–35 % scored 1; 36–70 % scored 2; more than 70 % scored 3 and intensity score: no staining scored 0, weakly staining scored 1, moderately staining scored 2 and strongly staining scored 3. The final score was designated as the score of positive area × intensity score: “−” for a score of 0–1, “+” for a score of 2–3, “++” for a score of 4–6 and “+++” for a score of >6; low expression was defined as a total score <4 and high expression with a total score ≥4. These scores were determined independently by two senior pathologists.

siRNA transfection

The sequence of two siRNAs targeting c-Myc or LDHA was denoted as follows: si-Myc-1 (TACGGAACTCTTGTGCGTAAGC), si-Myc-2 (GCTTCACCAACAGGAACTATGC); si-LDAH-1 (TTGTTGATGTCATCGAAG), si-LDHA-2 (GGGTCCTTGGGGAACATG). The negative control indicated as si-Ctrl was non-homologous to any human genome sequences. The AsPC-1 and SW1990 cells were transfected with 50 nM of siRNA and 5 μl of RNAi-Mate according to the manufacturer’s instructions (GenePharma, Shanghai, China). Cells were cultured for 48 h, and the interference efficiency was detected by western blotting.

Quantitative real-time PCR

Total RNA was isolated from pancreatic cancer cell lines by using the Trizol reagent (Invitrogen) and reverse transcription was performed using the PrimeScript RT-PCR kit (Takara, Japan). The mRNA levels of detected genes were quantified on an ABIPrism-7500 Sequence Detector System (ABI, Applied Biosystems, USA). β-Actin was used as an internal control. Relative expression of c-Myc or LDAH was normalized to the expression of β-actin, which yielded a 2−ΔCt value. The primer sequences were as follows: c-Myc sense 5′-GTCAAGAGGCGAACACACAAC-3′, c-Myc antisense 5′-TTGGACGGACAGGATGTATGC-3′; LDHA sense 5′-ATGGCAACTCTAAAGGATCAGC-3′, LDHA antisense 5′-CCAACCCCAACAACTGTAATCT-3′; β-actin sense 5′-GTTGTCGACGACGAGCG-3′, β-actin antisense 5′-GCACAGAGCCTCGCCTT-3′. All reactions were run in triplicate.

In vitro cell proliferation assay

Cell Counting Kit-8 (CCK8, Dojindo, Japan) assay was used to measure cell proliferation in AsPC-1 and SW1990 cells. Briefly, after transfection with si-Ctrl and targeted siRNAs for 48 h, AsPC-1 and SW1990 cells (3000 per well) were plated in 96-well plates with RPMI1640 containing 10 % FBS. Each sample had four replicates. At the indicated time points, cells were incubated in media containing 10 % CCK8 for 1 h at 37 °C. The absorbance of the solution was read at 490 nm using a Power Wave XS microplate reader (BIO-TEK).

Cell migration and invasion assays

The invasive potential of AsPC-1 and SW1990 cells was measured by transwell model (Corning, USA) according to the manufacturer’s instructions. Briefly, 2 × 104 cells in 100 μl medium were seeded into the upper compartment of the transwell inserts. Importantly, the invasion assay was performed with matrigel-coated filters (BD Bioscience, USA). The lower chambers were filled with 800 μl of RPMI-1640 medium containing 2 % FBS. After the cells were incubated for 16 h in cell migration assay and 40 h in cell invasion assay, the non-invading cells that remained on the upper surface were removed. The migrated and invaded cells were fixed with 4 % paraformaldehyde and stained with 0.1 % crystal violet. The number of invaded cells was counted under a light microscope in six random fields. Each experiment was performed in triplicate.

Measurement of glucose and lactate

Lactate Colorimetric Assay Kit (BioVision) and Glucose Colorimetric Assay Kit (Life technologies) were used according to the manufacturer’s protocols to estimate the intracellular glucose utilization and lactate concentration in pancreatic cancer cells. The glucose utilization or lactate production was estimated using a standard glucose calibration curve prepared under the same condition.

Statistical analysis

Data were presented as the mean ± SD. The SPSS software program (version 17.0; IBM Corporation) was used for statistical analysis, and graphical representations were performed with GraphPad Prism 5 (San Diego, CA) software. The Chi-square test was used to analyze the overall survival rate, and the difference in survival curves was evaluated by the log-rank test. Correlations between c-Myc and LDHA levels in pancreatic cancer were analyzed by Spearman’s rank correlation. All other data were analyzed using two-sided Student’s t test. P values <0.05 were considered statistically significant.

Results

Dysregulated c-Myc–LDHA axis is closely associated with tumor progression and indicates a poor prognosis in pancreatic cancer

To observe the expression pattern of c-MycLDHA axis in pancreatic cancer, we first used immunohistochemistry to investigate c-Myc and LDHA protein levels in 90 pancreatic cancer specimens and qRT-PCR to measure c-Myc and LDHA mRNA levels in seven pancreatic cancer cell lines. Immunohistochemical analysis showed that high c-Myc expression and LDHA expression were 65.56 and 70.00 % in tested specimens, respectively (Fig. 1a–d); elevated c-Myc expression and LDHA expression are closely associated with tumor size (P < 0.001) and TNM stage (P < 0.001) (Table 1). Besides, we found a significant positive correlation between mRNA levels of c-Myc and LDHA in pancreatic cancer cell lines (P < 0.001, Fig. 1e). Consistent with qRT-PCR results, there was also significant positive correlation between c-Myc and LDHA in pancreatic cancer specimens (P < 0.001, Fig. 1f). Moreover, we tested the clinical significance of c-Myc and LDHA in patients with pancreatic cancer. Ninety pancreatic cancer patients with clinical follow-ups were analyzed by Kaplan–Meier estimation. The result indicated that tumors with high expression of c-Myc (P = 0.002, Fig. 1g) or LDHA (P = 0.008, Fig. 1h) indeed significantly associated with poor overall survival of pancreatic cancer patients. These findings strongly indicate that c-MycLDHA axis plays a critical role in pancreatic cancer development and progression and is a potential valuable predictor for this disease.
Fig. 1

Dysregulated c-Myc–LDHA axis is closely associated with tumor progression and indicates a poor prognosis in pancreatic cancer. Representative images of high c-Myc expression (a), low c-Myc expression (b), high LDHA expression (c) and low LDHA expression (d) in pancreatic cancer specimens, scale bar: 100 μm. e Correlation between c-Myc and LDHA mRNA expression in pancreatic cancer cell lines. f Immunohistochemical analysis of the correlation between c-Myc and LDHA expression; P value was calculated by the Spearman’s rank correlation test. g Kaplan–Meier survival curves of pancreatic cancer patients according to the status of c-Myc expression. h Kaplan–Meier survival curves of pancreatic cancer patients according to the status of LDHA expression

Table 1

Correlations between c-Myc or LDHA expression and clinicopathologic features in patients with pancreatic cancer

VariableExpression of c-MycExpression of LDHA
LowHigh P valueLowHigh P value
Age
 ≤60 years16260.49515270.268
 >60 years15331236
Gender
 Female12210.77111220.600
 Male19381641
Tumor size
 ≤4 cm23290.013*23290.001**
 >4 cm730433
Tumor location
 Head17341.00015360.909
 Body/tail12241125
TNM stage
 I20200.005**19210.001**
 II–III1037740
Neuronal invasion
 Yes11260.43212250.674
 No20331538
Histological grade
 I–II21360.35717400.738
 II–IV617617

The asterisk represents the P values with significant differences

Dysregulated c-MycLDHA axis is closely associated with tumor progression and indicates a poor prognosis in pancreatic cancer. Representative images of high c-Myc expression (a), low c-Myc expression (b), high LDHA expression (c) and low LDHA expression (d) in pancreatic cancer specimens, scale bar: 100 μm. e Correlation between c-Myc and LDHA mRNA expression in pancreatic cancer cell lines. f Immunohistochemical analysis of the correlation between c-Myc and LDHA expression; P value was calculated by the Spearman’s rank correlation test. g Kaplan–Meier survival curves of pancreatic cancer patients according to the status of c-Myc expression. h Kaplan–Meier survival curves of pancreatic cancer patients according to the status of LDHA expression Correlations between c-Myc or LDHA expression and clinicopathologic features in patients with pancreatic cancer The asterisk represents the P values with significant differences

Effects of c-Myc–LDHA axis on aerobic glycolysis in pancreatic cancer cells in vitro

To demonstrate the effect of c-MycLDHA axis on aerobic glycolysis in pancreatic cancer cells, we firstly silenced c-Myc expression in AsPC-1 and SW1990 cells by siRNAs. As shown in Fig. 2a, knockdown of c-Myc resulted in reduced LDHA expression, further confirming the regulation of c-Myc in LDHA expression. And expectedly, suppression of c-Myc also markedly inhibited aerobic glycolysis as demonstrated by decreased glucose utilization (Fig. 2b) and lactate production (Fig. 2c). To determine the implications of c-Myc on aerobic glycolysis mediated by LDHA, glucose utilization and lactate production were further measured after treatment with LDHA siRNAs in AsPC-1 and SW1990 cells (Fig. 2d). Indeed, inhibition of LDHA also resulted in reduced aerobic glycolysis (Fig. 2f, g). Collectively, these results suggest that c-MycLDHA axis exhibits a critical role in regulation of aerobic glycolysis in pancreatic cancer.
Fig. 2

Effects of c-Myc–LDHA axis on aerobic glycolysis in pancreatic cancer cells in vitro. a The protein level of c-Myc and LDHA was detected by western blotting in AsPC-1 and SW1990 cells after c-Myc-specific siRNA treatment. Glucose utilization (b) and lactate production (c) were measured after c-Myc was silenced (si-Ctrl vs. si–c-Myc-1 or si–c-Myc-2; *P < 0.05; **P < 0.01). d The interference efficiency of LDHA was detected by western blotting in AsPC-1 and SW1990 cells. Glucose utilization (e) and lactate production (f) were measured after LDHA was silenced (si-Ctrl vs. si-LDHA-1 or si-LDHA-2; *P < 0.05; **P < 0.01)

Effects of c-MycLDHA axis on aerobic glycolysis in pancreatic cancer cells in vitro. a The protein level of c-Myc and LDHA was detected by western blotting in AsPC-1 and SW1990 cells after c-Myc-specific siRNA treatment. Glucose utilization (b) and lactate production (c) were measured after c-Myc was silenced (si-Ctrl vs. si–c-Myc-1 or si–c-Myc-2; *P < 0.05; **P < 0.01). d The interference efficiency of LDHA was detected by western blotting in AsPC-1 and SW1990 cells. Glucose utilization (e) and lactate production (f) were measured after LDHA was silenced (si-Ctrl vs. si-LDHA-1 or si-LDHA-2; *P < 0.05; **P < 0.01)

Suppression of aerobic glycolysis induced by c-Myc–LDHA axis inhibits tumor growth and progression in pancreatic cancer cells in vitro

Switching to the aerobic glycolysis, also known as Warburg effect, is a key characteristic of cancer metabolism and is not only critical factor for tumor growth but also essential for tumor metastasis [16]. Next, we determined the effects of c-MycLDHA axis on tumor growth and progression in AsPC-1 and SW1990 cells. As shown in Fig. 3a, b, knockdown of c-Myc resulted in pronounced decreased cell growth rate in both AsPC-1 and SW1990 cells. Using a Transwell model, we found the ability of cell migration and invasion was also reduced by suppression of c-Myc expression (Fig. 3c, d). Meanwhile, inhibition of LDHA also mimicked the effects of c-Myc on cell proliferation, migration and invasion (Fig. 3e–h). Given that the aerobic glycolysis was significantly reduced by inhibition of c-MycLDHA axis, we thereby hypothesized whether c-MycLDHA axis functions through regulating the aerobic glycolysis. To test this hypothesis, cellular functions in AsPC-1 and SW1990 cells were measured after treatment with 2-Deoxy-d-glucose (2-DG), a glycolysis inhibitor. The results showed that the disadvantage of tumor growth and progression conferred by inhibition of c-MycLDHA axis was completely abolished (Fig. 4a–h). Taken together, these data suggest that decreased aerobic glycolysis accounts for the tumor growth and progression induced by c-MycLDHA axis.
Fig. 3

Suppression of c-Myc–LDHA axis inhibits tumor growth and progression in pancreatic cancer cells in vitro. Cell viability of AsPC-1 cells (a) and SW1990 cells (b) was measured after c-Myc was silenced. Cell migration (c) and invasion (d) abilities were measured after c-Myc was silenced (si-Ctrl vs. si–c-Myc-1 or si–c-Myc-2; *P < 0.05; **P < 0.01; ***P < 0.001). Cell viability of AsPC-1 cells (e) and SW1990 cells (f) were measured after LDHA was silenced. Cell migration (g) and invasion (h) abilities were measured after LDHA was silenced (si-Ctrl vs. si-LDHA-1 or si-LDHA-2; *P < 0.05; **P < 0.01; ***P < 0.001)

Fig. 4

Treatment with 2-DG blocks the effects of c-Myc–LDHA axis on tumor growth and progression in pancreatic cancer cells in vitro. In the presence of 2-DG, cell viability of AsPC-1 cells (a) and SW1990 cells (b), cell migration (c) and invasion (d) abilities were measured after c-Myc was silenced. In the presence of 2-DG, cell viability of AsPC-1 cells (e) and SW1990 cells (f), cell migration (g) and invasion (h) abilities were measured after LDHA was silenced

Suppression of c-MycLDHA axis inhibits tumor growth and progression in pancreatic cancer cells in vitro. Cell viability of AsPC-1 cells (a) and SW1990 cells (b) was measured after c-Myc was silenced. Cell migration (c) and invasion (d) abilities were measured after c-Myc was silenced (si-Ctrl vs. si–c-Myc-1 or si–c-Myc-2; *P < 0.05; **P < 0.01; ***P < 0.001). Cell viability of AsPC-1 cells (e) and SW1990 cells (f) were measured after LDHA was silenced. Cell migration (g) and invasion (h) abilities were measured after LDHA was silenced (si-Ctrl vs. si-LDHA-1 or si-LDHA-2; *P < 0.05; **P < 0.01; ***P < 0.001) Treatment with 2-DG blocks the effects of c-MycLDHA axis on tumor growth and progression in pancreatic cancer cells in vitro. In the presence of 2-DG, cell viability of AsPC-1 cells (a) and SW1990 cells (b), cell migration (c) and invasion (d) abilities were measured after c-Myc was silenced. In the presence of 2-DG, cell viability of AsPC-1 cells (e) and SW1990 cells (f), cell migration (g) and invasion (h) abilities were measured after LDHA was silenced

Discussion

In the current study, we determined the critical roles of c-MycLDHA axis in aerobic glycolysis and its cellular functions in pancreatic cancer. First, we observed that c-Myc and LDHA are concomitantly up-regulated in pancreatic cancer specimens and cell lines, and up-regulated c-Myc expression and LDHA expression lead to poor prognosis in pancreatic cancer patient. Second, suppression of c-Myc resulted in decreased expression of LDHA, reduced aerobic glycolysis, growth arrest and inability of invasion; meanwhile, knockdown of LDHA mimicked this effect. Third, inhibition of aerobic glycolysis abolished the effects of c-MycLDHA axis on cell growth and metastasis in vitro. Therefore, our findings demonstrated that c-MycLDHA axis contributed to the Warburg effect, thus facilitating tumor development and progression in pancreatic cancer. Metabolic alternations in cancers not only support energy requirements but also provide enormous biosynthetic needs [17]. c-Myc contributes to the glucose metabolic reprogramming of tumor cells through several different targets [6]. Briefly, through up-regulation of glucose transporters, c-Myc increases the uptake of glucose; by regulation of LDHA and the lactate transporter MCT1, c-Myc promotes the Warburg effect; c-Myc also prevents pyruvate to enter the TCA cycle by regulating pyruvate dehydrogenase (PDK) expression [15]. Consistent with this, c-Myc regulates LDHA expression in pancreatic cancer and suppression of c-Myc significantly inhibited the Warburg effect. In pancreatic cancer, it has been demonstrated that the expression level of LDHA is up-regulated in both clinical specimens and cell lines, and forced expression of LDHA promoted tumor growth and tumorigenicity of pancreatic cancer [18]. Overexpressed LDHA promotes the production of lactate and further contributes to the acidification of tumor microenvironment [19]. A low pH induced by extracellular acidification favors the activation of proteases, including MMPs [20] and urokinase-type plasminogen activator [21], which ultimately result in extracellular matrix degradation and facilitate cancer cells to metastasis [22]. In our study, we found both c-Myc expression and LDHA expression are closely associated with tumor size and TNM stage and indicate poor prognosis in patients with pancreatic cancer. Meanwhile, inhibition of c-MycLDHA axis inhibits glucose utilization, lactate production, cell proliferation, migration and invasion. All these can be explained by the favorable tumor microenvironment induced by c-MycLDHA axis facilitates tumor progression. However, because c-Myc regulates the expression of multiple targeted genes, it is hard to draw a conclusion that this cell phenotype was mediated by LDHA. And because LDHA expression is also regulated by many other transcription factors including HIF1a [23] and KLF4 [12] in pancreatic cancer, the oncogenic activity of LDHA in Warburg effect and tumor progression also remains to be further analyzed. Despite the presence of these limits, we at least confirmed the oncogenic roles of c-MycLDHA axis on tumor progression through enhancing Warburg effect. In conclusion, our study provided both clinical and mechanistic evidences supporting that c-Myc modulates LDHA expression and that the c-MycLDHA axis exhibits a critical role in aerobic glycolysis and tumor progression in pancreatic cancer. Our research identified dysregulated c-MycLDHA axis as a promising new molecular target for the design of novel therapeutic to control development and progression of pancreatic cancer.
  23 in total

Review 1.  Regulation of gene transcription by the oncoprotein MYC.

Authors:  Bernhard Lüscher; Jörg Vervoorts
Journal:  Gene       Date:  2011-12-28       Impact factor: 3.688

Review 2.  Reflecting on 25 years with MYC.

Authors:  Natalie Meyer; Linda Z Penn
Journal:  Nat Rev Cancer       Date:  2008-12       Impact factor: 60.716

3.  Knockdown of lactate dehydrogenase A suppresses tumor growth and metastasis of human hepatocellular carcinoma.

Authors:  Shi L Sheng; Jian J Liu; Yun H Dai; Xiao G Sun; Xiao P Xiong; Gang Huang
Journal:  FEBS J       Date:  2012-09-13       Impact factor: 5.542

Review 4.  MYC on the path to cancer.

Authors:  Chi V Dang
Journal:  Cell       Date:  2012-03-30       Impact factor: 41.582

Review 5.  Otto Warburg's contributions to current concepts of cancer metabolism.

Authors:  Willem H Koppenol; Patricia L Bounds; Chi V Dang
Journal:  Nat Rev Cancer       Date:  2011-04-14       Impact factor: 60.716

Review 6.  Why do cancers have high aerobic glycolysis?

Authors:  Robert A Gatenby; Robert J Gillies
Journal:  Nat Rev Cancer       Date:  2004-11       Impact factor: 60.716

7.  Attenuation of LDHA expression in cancer cells leads to redox-dependent alterations in cytoskeletal structure and cell migration.

Authors:  Robert Arseneault; Andrew Chien; Jordan T Newington; Tim Rappon; Richard Harris; Robert C Cumming
Journal:  Cancer Lett       Date:  2013-04-11       Impact factor: 8.679

Review 8.  Pancreatic cancer: current and future treatment strategies.

Authors:  K Pliarchopoulou; D Pectasides
Journal:  Cancer Treat Rev       Date:  2009-03-27       Impact factor: 12.111

9.  Pericellular proteolysis by leukocytes and tumor cells on substrates: focal activation and the role of urokinase-type plasminogen activator.

Authors:  Andrei L Kindzelskii; Imran Amhad; Donald Keller; M-J Zhou; Richard P Haugland; B A Garni-Wagner; Margaret R Gyetko; Robert F Todd; Howard R Petty
Journal:  Histochem Cell Biol       Date:  2004-03-20       Impact factor: 4.304

10.  Anticancer targets in the glycolytic metabolism of tumors: a comprehensive review.

Authors:  Paolo E Porporato; Suveera Dhup; Rajesh K Dadhich; Tamara Copetti; Pierre Sonveaux
Journal:  Front Pharmacol       Date:  2011-08-25       Impact factor: 5.810

View more
  38 in total

1.  ATM deficiency promotes progression of CRPC by enhancing Warburg effect.

Authors:  Lingfan Xu; Enze Ma; Tao Zeng; Ruya Zhao; Yulei Tao; Xufeng Chen; Jeff Groth; Chaozhao Liang; Hailiang Hu; Jiaoti Huang
Journal:  Endocr Relat Cancer       Date:  2019-01-01       Impact factor: 5.678

2.  Paraoxonase 2 Facilitates Pancreatic Cancer Growth and Metastasis by Stimulating GLUT1-Mediated Glucose Transport.

Authors:  Arvindhan Nagarajan; Shaillay Kumar Dogra; Lisha Sun; Neeru Gandotra; Thuy Ho; Guoping Cai; Gary Cline; Priti Kumar; Robert A Cowles; Narendra Wajapeyee
Journal:  Mol Cell       Date:  2017-08-10       Impact factor: 17.970

3.  LDHB may be a significant predictor of poor prognosis in osteosarcoma.

Authors:  Chao Li; Yu Chen; Pingping Bai; Jiaqiang Wang; Zhenhui Liu; Tao Wang; Qiqing Cai
Journal:  Am J Transl Res       Date:  2016-11-15       Impact factor: 4.060

Review 4.  Glycolysis in the progression of pancreatic cancer.

Authors:  Xinyao Chang; Xingchen Liu; Haoze Wang; Xuan Yang; Yan Gu
Journal:  Am J Cancer Res       Date:  2022-02-15       Impact factor: 6.166

Review 5.  Glucose metabolic phenotype of pancreatic cancer.

Authors:  Anthony K C Chan; Jason I E Bruce; Ajith K Siriwardena
Journal:  World J Gastroenterol       Date:  2016-03-28       Impact factor: 5.742

6.  MiR-323a-3p suppressed the glycolysis of osteosarcoma via targeting LDHA.

Authors:  Hanwen Chen; Shuming Gao; Cai Cheng
Journal:  Hum Cell       Date:  2018-08-07       Impact factor: 4.174

Review 7.  The metabolism of cancer cells during metastasis.

Authors:  Gabriele Bergers; Sarah-Maria Fendt
Journal:  Nat Rev Cancer       Date:  2021-01-18       Impact factor: 60.716

8.  Novel Primary Human Cancer Stem-Like Cell Populations from Non-Small Cell Lung Cancer: Inhibition of Cell Survival by Targeting NF-κB and MYC Signaling.

Authors:  Beatrice A Windmöller; Morris Beshay; Laureen P Helweg; Clara Flottmann; Miriam Beermann; Christine Förster; Ludwig Wilkens; Johannes F W Greiner; Christian Kaltschmidt; Barbara Kaltschmidt
Journal:  Cells       Date:  2021-04-27       Impact factor: 6.600

9.  KIFC1 promotes aerobic glycolysis in endometrial cancer cells by regulating the c-myc pathway.

Authors:  Kening Zhou; Jing Lin; Mimi Dai; Yingying He; Jingui Xu; Qian Lin
Journal:  J Bioenerg Biomembr       Date:  2021-11-03       Impact factor: 2.945

Review 10.  Natural products targeting cancer cell dependency.

Authors:  Changxiang Shi; Eun Ju Yang; Shishi Tao; Guowen Ren; Pui Kei Mou; Joong Sup Shim
Journal:  J Antibiot (Tokyo)       Date:  2021-06-23       Impact factor: 2.649

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.