Literature DB >> 26017916

One-Step Reverse-Transcription FRET-PCR for Differential Detection of Five Ebolavirus Species.

Guangwu Lu1, Jilei Zhang1, Chuntao Zhang2, Xiaolu Li3, Dawei Shi2, Zhaopeng Yang2, Chengming Wang1.   

Abstract

Ebola is an emerging infectious disease caused by a deadly virus belonging to the family Filoviridae, genus Ebolavirus. Based on their geographical distribution, Ebolavirus has been classified into total five species so far, mainly Zaire, Sudan, Taï Forest, Bundibugyo and Reston. It is important to be able to differentiate the Ebolavirus species as they significantly differ in pathogenicity and more than one species can be present in an area. We have developed a one-step step-down RT-PCR detecting all five Ebolavirus species with high sensitivity (1 copy of Ebolavirus DNA, 10 copies of RNA and 320 copies of RNA spiked in 1 ml whole blood). The primers and FRET-probes we designed enabled us to differentiate five Ebolavirus species by distinct Tm (Zaire: flat peaks between 53.0°C and 56.9°C; Sudan: 51.6°C; Reston: flat peaks between 47.5°C and 54.9°C; Tai Forest: 52.8°C; Bundibugyo: dual peaks at 48.9°C and 53.5°C), and by different amplicon sizes (Zaire 255 bp, Sudan 211 bp, Reston 192 bp, Taï Forest 166 bp, Bundibugyo 146 bp). This one-size-fit-all assay enables the rapid detection and discrimination of the five Ebolavirus species in a single reaction.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26017916      PMCID: PMC4446292          DOI: 10.1371/journal.pone.0126281

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Ebola Virus Disease (EVD), previously known as Ebola hemorrhagic fever, is an emerging infectious disease caused by a deadly virus of the family Filoviridae, genus Ebolavirus [1, 2]. Of the five identified Ebolavirus species, four of them (Zaire ebolavirus, Sudan ebolavirus, Taï Forest ebolavirus and Bundibugyo ebolavirus) are known to cause disease in humans, whereas the fifth (Reston ebolavirus) causes disease in non-human primates and swine only [3-6]. Since human infections were first reported in 1976 on the Ebola River in Democratic Republic of the Congo [7], outbreaks of EVD have occurred into twelve countries (South Sudan, Democratic Republic of Congo, Côte d’Ivoire, Gabon, Uganda, Republic of Congo, Guinea, Philippines, Nigeria, Senegal, Liberia, Mali). There have also been imported cases in Sierra Leone, Spain, and the United States of America [8–10, 3, 11, 12]. By January 25, 2015, a total of 22, 092 cases of Ebola infections have been confirmed, of which 8, 810 cases of EVD have been fatal [12]. While simple or multiplex PCRs have been successfully used to detect Ebolavirus, most of the published assays can only detect a single Ebolavirus species [13, 14] or, in the case of those that detect multiple Ebolavirus species, they show reduced sensitivity [15-17]. Whereas simple PCR tends to provide high sensitivity but lacks ability to differentiate multiple targets simultaneously [13, 14, 18], multiplex PCR has the capacity to detect and differentiate multiple targets but tends to have a reduced sensitivity [17, 19–21]. The TaqMan RT-PCR assay targeting the nucleoprotein gene of Zaire ebolavirus developed by Huang Y et al. [14] had a wide range in sensitivity, from 103 to 109 virus copies per reaction. The primers and fluorogenic probe of the one-step qRT-PCR described by Towner JS et al. [13] were specific for Sudan ebolavirus and showed a high sensitivity (103 genomic-sense Ebolavirus-RNA copies per ml; one genomic-sense RNA per reaction). Panning et al. [19] established a complicated system with 5 primers and 3 probes for Filoviridae with the detection limit from 487 to 4546 RNA copies/ml depending on the species of Ebolavirus. Trombley et al. [20] established a system to detect multiple hemorrhagic fever viruses including Ebolavirus by using 48 TaqMan-based PCR assays with the limit of detection for the assays ranging from 10 to 0.001 plaque-forming units / PCR. While RT-PCR with high sensitivity and specificity have been widely used to quantify RNA viruses, RNA templates as positive controls were not always available and safe for highly infective pathogens such as SARS virus and highly pathogenic avian influenza viruses. In addition, RNA templates from killed viruses tend to degrade under the influence of RNase and metal ions. In comparison, the VLPs equipped with specific RNA fragments have been widely used as stable, reliable and safe positive controls for RT-PCR [22-24]. A generic PCR that can detect and differentiate all Ebolavirus species is needed as increased international movement of people increases the potential of transmission for multiple Ebolavirus species with varying pathogenicity [11, 17, 25–28]. Here we report a highly-sensitive one-step reverse-transcription FRET-PCR capable of rapidly identifying and differentiating all five Ebolavirus species.

Materials and Methods

Plasmids containing portion of Ebolavirus

Five plasmids, each compromised the first 600 bp (5’end) of five Ebolavirus species (Zaire ebolavirus, Sudan ebolavirus, Reston ebolavirus, Taï Forest ebolavirus and Bundibugyo ebolavirus), were created (GenScript, Nanjing, China) to serve as positive controls and quantitative standards in this study. The nucleotide fragments were synthesized and inserted into the pUC57 cloning vector, and the resulting plasmids were linearized with Sac I (Takara Biotechnology, Dalian, China) and quantified using the PicoGreen DNA fluorescence assay (Molecular Probes, Eugene, OR, USA) for preparation of quantitative standards (104, 103, 102, 101, 100 copies /10 μl).

Preparation of Ebolavirus RNA transcripts

Since it is not allowed to use viable Ebolavirus for research in China and none of five Ebolavirus species was available to us, transcripts made from the plasmids described above and virus-like-particles (VLPs) containing Ebolavirus RNA fragment were used as positive controls. The transcription reaction was run with MEGAscript Kit (Ambion by life technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. After incubation at 37°C for 4h, the transcribed products were treated with TURBO DNase (Ambion by life technologies, California, USA), followed by precipitation with lithium chloride. Finally, the yield of RNA transcripts was determined with the Quant-iT RiboGreen RNA Kit (Molecular Probes, Eugene, OR, USA) for preparation of the RNA standards (105, 104, 103, 102, 101, 100copies /10μl).

Construction and expression of virus-like particles (VLPs) containing Ebolavirus NP RNA

In addition to the positive controls of plasmids and transcripts described above, we prepared also the VLPs containing the Ebolavirus NP RNA fragment to further verify the specificity and reverse-transcription efficiency of the established PCR in this study. The MS2 VLPs containing the NP RNA fragments of each of these five Ebolavirus species were prepared as the method described by Drosten et al. [29]. The primers (forward primer: 5’-ATGAATTCTCCTGCTCAACTTCCTGTCG-3’; reverse primer: 5’-GCAAGCTTGTTAGTAGATGCCGGAGTTT-3’) of MS2 phage (ATCC 15591-B1) assembly protein gene, coat protein gene and the fragment of Eblolavirus RNA NP gene was synthesized according to their sequences from GenBank data (Gene Accession#: KC24280) and were used to amplify their cDNAs by RT-PCR. Expression vector pTrc99a (Pharmacia) and their cDNA fragments were ligated with T4 DNA ligase after digestion with restriction enzyme. The prokaryotic expression was obtained by transformation of recombinant plasmids into E. coli JM109.The obtained VLPs were purified and tested by quantitative analysis and RT-PCR.

Inoculation of transcribed Ebolavirus RNA and VLPs in human blood

Ten μl serially diluted transcribed RNAs and VLPs (106, 105, 104, 103, 102, 101 copies/10 μl) were thoroughly mixed with 50 μl human whole blood (collected in EDTA) and 150 μl 1× PBS for RNA extraction (High Pure RNA Isolation Kit, Roche, Mannheim, Germany). After vortexing for 15s with Lysis/-Binding Buffer and Red Cell Lysis Buffer (Roche Diagnostics GmbH, Mannheim, Germany), the blood samples were transferred to the High Pure filter tube and RNA eluted with 60 μl elution buffer which was stored at -80°C until thawed at room temperature for RT-PCR.

One-step FRET RT-PCR for Ebolavirus

Primers and probes

The full genome sequences of five Ebolavirus species (two representing GenBank Accession # for Zaire ebolavirus NC_002549, KC24280; Sudan ebolavirus NC_006432, KC54539; Reston ebolavirus NC_004161, JX477166; Taï Forest ebolavirus NC_014372, FJ217162; Bundibugyo ebolavirus NC_014373, KC545396), and those two monophyletic genus (Marburgvirus KC545388, NC_001608; Cuevavirus JF828358, NC_016144) were obtained from GenBank (Fig 1). Based on the conserved and variable regions determined by Clustal Multiple Alignment, we identified highly conserved regions in 1–146 bp of the genome which were common to all five Ebolavirus species and used for the forward primer, 6-FAM probe and LCRed 640 probe (Fig 1, Table 1). The regions between 146 bp and 255 bp were highly conserved for individual Ebolavirus species but were highly variable among the different species and were thus used to design five reverse primers to specifically amplify only a single Ebolavirus species (Fig 1, Table 1). The primers and probes demonstrated high level of mismatches with Cuevavirus (35–40 mismatches) and Marburgvirus (no corresponding fragment).
Fig 1

Alignment of primers and probes for five Ebolavirus species.

Nucleotide sequences of the primers (one forward primer and five reverse primers for all Ebolavirus species) and probes are shown at the top of the frames while the corresponding nucleotide sequences of five species of Ebolavirus are shown at the bottom. Dots indicated that nucleotides are identical to those of primers/probes, and strips indicated deletion of nucleotides. The upstream primer was used as shown while the downstream primers and probes were used as reverse oligonucleotides. The 6-FAM and LCRed-640 probes had 5 and 1 degenerate nucleotides, respectively. The numbers associated with primers/probes indicate the positions of primers/probes in the whole genome of Ebolavirus.

Table 1

Primers and probes used in this study.

Primer/probeSequence (5’→3’)LocationNote
Forward primer CGGACACACAAAAAGAAAGAAG-3’ 1–22Common to all Ebolavirus species
6-FAM probe 6-FAM- TAGTTAYTCGCACACAAWARRK-phos 33–54
LCRed probe GAGGAAAATTDTTAATCTTCCTC-LCRed640 56–78
Reverse primer-1 GCCAATTCTCAGTGTTGGTATT 125–146Specific for Bundibugyo
Reverse primer-2 GGAATGGGGTACTTCTGAACA 146–166Specific for Taï Forest
Reverse primer-3 CATGTTGATGGTAATTGGTAATAG 169–192Specific for Reston
Reverse primer-4 AAAGGCAAAGCAATACGACC 192–211Specific for Sudan
Reverse primer-5 GAACTTGTGATGTGATAAGACCTA 232–255Specific for Zaire

Alignment of primers and probes for five Ebolavirus species.

Nucleotide sequences of the primers (one forward primer and five reverse primers for all Ebolavirus species) and probes are shown at the top of the frames while the corresponding nucleotide sequences of five species of Ebolavirus are shown at the bottom. Dots indicated that nucleotides are identical to those of primers/probes, and strips indicated deletion of nucleotides. The upstream primer was used as shown while the downstream primers and probes were used as reverse oligonucleotides. The 6-FAM and LCRed-640 probes had 5 and 1 degenerate nucleotides, respectively. The numbers associated with primers/probes indicate the positions of primers/probes in the whole genome of Ebolavirus.

Thermal cycling

One-step RT-PCR was performed in a LightCycler 480 II real-time PCR platform. Each reaction was performed in a 20μl final volume containing 10μl of plasmid DNA, transcribed RNA or VLPs and 10μl master mix with a final concentration of 1μM forward primer, 0.2μM 6-FAM probe, 0.2μM LCRed 640 probe, 1μM Reston ebolavirus reverse primer and 0.5μM reverse primers for the four other Ebolavirus species (Table 1). For each sample in 20μl reaction, 0.14 U SuperScript III reverse transcriptase (Invitrogen) was added and other reaction components were used as described [30]. Thermal cycling consisted of one reverse transcription step, 18 high-stringency step-down cycles and 30 relaxed-stringency fluorescence acquisition cycles. The reverse transcription step was at 55°C for 15 min, followed by denaturation at 95°C for 2 min. The 18 high-stringency step-down thermal cycles were 6×1 sec @ 95°C, 12 sec @ 70°C, 8 sec @ 72°C; 9×1 sec @ 95°C, 12 sec @ 68°C, 8 sec @ 72°C; 3×1 sec @ 95°C, 12 sec @ 66°C, 8 sec @ 72°C. The relaxed-stringency fluorescence acquisition cycling consisted of 30×1 sec @ 95°C, 8 sec @ 52°C, 30 sec @ 67°C and 30 sec @ 72°C.

High-resolution melting genotyping analysis

After the FRET-PCR was completed, the melting curve analysis for probes annealing to the PCR products was determined by monitoring the fluorescence from 38°C to 85°C as described previously [30, 31]. Data were analyzed as 640 nm: 530 nm (F4/F1) fluorescence ratios, and the first derivative of F4/F1 (-d(F4/F1)/dt) was evaluated (Fig 2).
Fig 2

Discrimination of five Ebolavirus species through HRM genotyping analysis.

Following the completion of PCR, the T m of probe hybridization to the targets was determined by high-resolution melting (HRM) curve analysis as the peak of the second derivative of the fluorescence released during a temperature increase from 38°C to 85°C. Fluorescence F4/F1 demonstrates unique and distinct T m differences between Zaire ebolavirus (flat dual peaks between 53.0°C and 56.9°C, blue), Sudan ebolavirus, (51.6°C, pink), Reston ebolavirus (flat dual peaks between 47.5°C and 54.9°C, red), Taï Forest ebolavirus (52.8°C, black), Bundibugyo ebolavirus (dual peaks at 48.9°C and 53.5°C, green), and negative control (no melting curve, grey). When two concentrations of the targets (100 and 10 copies of the gene / 20 μl reaction system) were used for each Ebolavirus species, the peaks and shapes of the melting curves were the same. Triplicates were performed to show the ranges at which the FRET gave melting temperatures.

Discrimination of five Ebolavirus species through HRM genotyping analysis.

Following the completion of PCR, the T m of probe hybridization to the targets was determined by high-resolution melting (HRM) curve analysis as the peak of the second derivative of the fluorescence released during a temperature increase from 38°C to 85°C. Fluorescence F4/F1 demonstrates unique and distinct T m differences between Zaire ebolavirus (flat dual peaks between 53.0°C and 56.9°C, blue), Sudan ebolavirus, (51.6°C, pink), Reston ebolavirus (flat dual peaks between 47.5°C and 54.9°C, red), Taï Forest ebolavirus (52.8°C, black), Bundibugyo ebolavirus (dual peaks at 48.9°C and 53.5°C, green), and negative control (no melting curve, grey). When two concentrations of the targets (100 and 10 copies of the gene / 20 μl reaction system) were used for each Ebolavirus species, the peaks and shapes of the melting curves were the same. Triplicates were performed to show the ranges at which the FRET gave melting temperatures.

Specificity of the one-step RT FRET-PCR

The BLASTN with the organism options of including and excluding Ebolavirus (taxid: 186536) was performed on each of the primers and probes to verify the specificity of the designed oligonucleotides we designed. Specificity of the one-step RT FRET-PCR was also evaluated by amplifying each of five plasmids containing portions of each Ebolavirus species (Zaire ebolavirus, Sudan ebolavirus, Reston, ebolavirus Taï Forest ebolavirus and Bundibugyo ebolavirus), and a mixture of the five plasmids (Fig 3). In addition, the following oligonucleotide polymers were synthesized (GenScript, Nanjing, China) to further test the sensitivity of the established PCR: 1) the first 100 bp of the PCR amplicon for EVD Zaire (contains forward primer and two probes); 2) the complimentary sequences of the first 100 bp of the PCR amplicon for EVD Zaire; 3) the 33–250 bp of the the PCR amplicon for EVD Zaire (contains two probes and five downstream primers).
Fig 3

PCR amplification curves of serially diluted plasmids containing each of five Ebolavirus species.

The plasmid quantitative standards (104, 103, 102, 101, 100 /10μl) containing sequences of Zaire ebolavirus (A), Sudan ebolavirus (B), Reston ebolavirus (C), Taï Forest ebolavirus (D), Bundibugyo ebolavirus (E) and negative control were detected by the one-step reverse transcription FRET-PCR established in this study. The detection sensitivity was one copy per reaction system.

PCR amplification curves of serially diluted plasmids containing each of five Ebolavirus species.

The plasmid quantitative standards (104, 103, 102, 101, 100 /10μl) containing sequences of Zaire ebolavirus (A), Sudan ebolavirus (B), Reston ebolavirus (C), Taï Forest ebolavirus (D), Bundibugyo ebolavirus (E) and negative control were detected by the one-step reverse transcription FRET-PCR established in this study. The detection sensitivity was one copy per reaction system. The specificity of the established PCR in this work was further tested on the nucleic acids of other pathogens causing hemorrhagic fever or similar clinical signs as Ebolavirus (Bunyavirus, Japanese encephalitis virus, Cuevavirus, Dengue virus, Yellow fever virus, Hanta virus, forest encephalitis virus, Lassa fever virus, Marburg virus,; Nucleic acids of these viruses were provided by the National Institute for Food and Drug Control, China Food and Drug Administration). The PCR products from the reactions with the plasmids of the individual Ebolavirus species and the mixture containing them all, were verified by electrophoresis through a 4% agarose gel (BIOWEST, Hong Kong, China) at 90 v for 90 min and stained with SYBR Safe DNA Gel Stain (Invitrogen, Carlsbad, USA) (Fig 4). A high concentration (4%) of BIOWEST Gel (gel strength≥750, gelling range around 36–39°C, and melting range around 87–89°C) ensures efficient differentiation of the small sizes of PCR fragments in this study.
Fig 4

Discrimination of five Ebolavirus species by gel electrophoresis of PCR fragments.

Plasmids of the five Ebolavirus species (Zaire, Sudan, Reston, Taï Forest and Bundibugyo), a mixture of all five, and negative controls were tested in the one-step FRET-PCR system established in this study. Amplicons obtained were electrophoresed through a 4% agarose gel and stained with SYBR Safe Gel stain (SYBR Safe DNA Gel Stain, Invitrogen, USA). The different sizes of the PCR products of each species (255 bp, 211 bp, 192 bp, 166 bp and 146 bp) were visualized alongside a 20bp DNA ladder (Thermo Scientific O’RangeRuler 20 bp DNA Ladder, Ready-to-use, Thermo Scientific, USA).

Discrimination of five Ebolavirus species by gel electrophoresis of PCR fragments.

Plasmids of the five Ebolavirus species (Zaire, Sudan, Reston, Taï Forest and Bundibugyo), a mixture of all five, and negative controls were tested in the one-step FRET-PCR system established in this study. Amplicons obtained were electrophoresed through a 4% agarose gel and stained with SYBR Safe Gel stain (SYBR Safe DNA Gel Stain, Invitrogen, USA). The different sizes of the PCR products of each species (255 bp, 211 bp, 192 bp, 166 bp and 146 bp) were visualized alongside a 20bp DNA ladder (Thermo Scientific O’RangeRuler 20 bp DNA Ladder, Ready-to-use, Thermo Scientific, USA).

Sensitivity of the one-step RT FRET-PCR

The sensitivity was determined using serially diluted plasmids (104, 103, 102, 101, 100 copies of DNA/ 10 μl), transcribed Ebolavirus RNAs (105, 104, 103, 102, 101, 100 copies of RNA/ 10 μl) and Ebolavirus RNA-containing VLPs (105, 104, 103, 102, 101, 100 copies of RNA/ 10 μl). Also, human whole blood spiked with transcribed RNAs (106, 105, 104, 103, 102, 101 copies of RNA/tube with 50 μl whole blood) was amplified to determine the detection limit of the established one-step RT-PCR that could be expected with clinical samples.

Results and Discussion

Our one-step RT FRET-PCR was capable of detecting a single DNA copy and 10 RNA copies of all five Ebolavirus species (Figs 3 and 5). When whole blood spiked with transcribed Ebolavirus RNA and VLPs were tested, the detection limit was 100 copies of RNA per PCR reaction (Fig 5), equivalent to 320 copies of Ebolavirus in 1 ml whole blood. Triplicates were performed for each assay. The BLASTN results for each of the 8 oligonucleotides we used in the one-step RT FRET-PCR showed they were specific for the Ebolavirus species and did not cross-react with partial amplicons or other viruses in the family Filoviridae. No PCR amplification was observed with nucleic acids of eight types of pathogens which induce hemorrhagic fever or similar clinical signs as Ebolavirus.
Fig 5

Amplification curves of reverse-transcription PCR on transcribed Ebolavirus RNAs and blood samples spiked with transcribed RNA.

A: The different concentrations of transcribed Zaire ebolavirus RNA (105, 104, 103, 102, 101, 100 /10μl) were detected with the one-step reverse transcription FRET-PCR described in this study, and the detection limitation was 10 copies per reaction system. B: Serial concentrations of transcribed Zaire ebolavirus RNAs (106, 105, 104, 103, 102, 101/10μl) were spiked into human whole blood and were extracted with RNA purification kit, followed by the one-step reverse transcription FRET-PCR established in this study. The detection limitation was 100 RNA copies per reaction, equivalent to 320 copies of Zaire Ebolavirus in 1 ml whole blood. Triplicates (A) or duplicates (B) were performed for each concentration of tested Ebolavirus RNA.

Amplification curves of reverse-transcription PCR on transcribed Ebolavirus RNAs and blood samples spiked with transcribed RNA.

A: The different concentrations of transcribed Zaire ebolavirus RNA (105, 104, 103, 102, 101, 100 /10μl) were detected with the one-step reverse transcription FRET-PCR described in this study, and the detection limitation was 10 copies per reaction system. B: Serial concentrations of transcribed Zaire ebolavirus RNAs (106, 105, 104, 103, 102, 101/10μl) were spiked into human whole blood and were extracted with RNA purification kit, followed by the one-step reverse transcription FRET-PCR established in this study. The detection limitation was 100 RNA copies per reaction, equivalent to 320 copies of Zaire Ebolavirus in 1 ml whole blood. Triplicates (A) or duplicates (B) were performed for each concentration of tested Ebolavirus RNA. Due to the different levels of mismatches between the probes we designed and the PCR amplicons we generated from the different Ebolavirus species (Fig 1), melting curve analysis of the PCRs products showed unique and distinct T m for each of the five Ebolavirus species (Fig 2): Zaire: flat dual peaks between 53.0°C and 56.9°C; Sudan: 51.6°C; Reston: flat dual peaks between 47.5°C and 54.9°C; Taï Forest: 52.8°C; Bundibugyo: dual peaks at 48.9°C and 53.5°C. The temperatures and shapes of the melting curves were consistent even with changes in the concentrations of Ebolavirus used in the reaction (Fig 2). Furthermore, the specific reverse primers we designed gave amplicons of different sizes for each of the five Ebolavirus species (Zaire ebolavirus 255bp; Sudan ebolavirus 211bp; Reston ebolavirus 192bp; Taï Forest ebolavirus 166bp; Bundibugyo ebolavirus 146bp) (Fig 4). The detection sensitivity, melting temperatures and amplicon sizes of each of these five Ebolavirus species were confirmed when the established RT-PCR was applied on Ebolavirus NP RNA-containing VLPs (Fig 6).
Fig 6

The sensitivity, melting curve analysis and gel electrophoresis of the one-step RT-FRET-PCR performed on Ebolavirus RNA-containing VLPs.

The amplification curves of 100 copies of VLPs containing each of these five Ebolavirus species were run in the RT FRET PCR established in this study (A), followed by melting curves analysis (B) and gel electrophoresis (C). The Amplification curves of reverse-transcription PCR on serially diluted VLPs inoculated in blood sample showed similar sensitivity as in blood samples spiked with transcribed RNA (data not shown).

The sensitivity, melting curve analysis and gel electrophoresis of the one-step RT-FRET-PCR performed on Ebolavirus RNA-containing VLPs.

The amplification curves of 100 copies of VLPs containing each of these five Ebolavirus species were run in the RT FRET PCR established in this study (A), followed by melting curves analysis (B) and gel electrophoresis (C). The Amplification curves of reverse-transcription PCR on serially diluted VLPs inoculated in blood sample showed similar sensitivity as in blood samples spiked with transcribed RNA (data not shown). In the one-step RT-PCR established in this study, the combination of a single set of forward primer and probes with five different reverse primers gave very high sensitivity and differential ability. While the system detects all five Ebolavirus with highly sensitivity (1 copy of DNA, 10 copies of RNA, or 320 copies of RNA / 1 ml whole blood), the unique T m distribution enables the convenient differentiation of the five Ebolavirus species (Fig 2). In laboratories that do not have real-time PCR machines and melting curve analysis, our primers can be used in standard PCRs and the five Ebolavirus species differentiated by the specific size of the amplicon identified for each species in gel electrophoresis (Fig 4). While RNA templates as positive controls were not always available and safe for highly infective pathogens such as SARS virus and highly pathogenic avian influenza viruses, the VLPs equipped with specific RNA fragments have been widely used as stable, reliable and safe positive controls for RT-PCR [22-24]. The VLPs containing Ebolavirus NP RNA established in this work are adopted as standards to evaluate and certify Ebolavirus-related commercial diagnostic kits by National Institute for Food and Drug Control, Food and Drug Administration of China. While simple PCR tends to provide high sensitivity but lacks ability to differentiate multiple targets simultaneously, multiplex PCR has the capacity to detect and differentiate multiple targets but tends to have a reduced sensitivity. Our study has established a novel highly-sensitive one-step RT FRET-PCR with one set of upstream primer /probes and five downstream primers that can rapidly identify and differentiate all five Ebolavirus species.
  30 in total

1.  Development and evaluation of a fluorogenic 5' nuclease assay to detect and differentiate between Ebola virus subtypes Zaire and Sudan.

Authors:  T R Gibb; D A Norwood; N Woollen; E A Henchal
Journal:  J Clin Microbiol       Date:  2001-11       Impact factor: 5.948

2.  TaqMan 5'-nuclease human immunodeficiency virus type 1 PCR assay with phage-packaged competitive internal control for high-throughput blood donor screening.

Authors:  C Drosten; E Seifried; W K Roth
Journal:  J Clin Microbiol       Date:  2001-12       Impact factor: 5.948

3.  Isolation and partial characterisation of a new virus causing acute haemorrhagic fever in Zaire.

Authors:  K M Johnson; J V Lange; P A Webb; F A Murphy
Journal:  Lancet       Date:  1977-03-12       Impact factor: 79.321

4.  Ebola hemorrhagic fever: Tandala, Zaire, 1977-1978.

Authors:  D L Heymann; J S Weisfeld; P A Webb; K M Johnson; T Cairns; H Berquist
Journal:  J Infect Dis       Date:  1980-09       Impact factor: 5.226

5.  Recombinant hepatitis C virus-like particles expressed by baculovirus: utility in cell-binding and antibody detection assays.

Authors:  Jinhua Xiang; Sabina Wünschmann; Sarah L George; Donna Klinzman; Warren N Schmidt; Douglas R LaBrecque; Jack T Stapleton
Journal:  J Med Virol       Date:  2002-12       Impact factor: 2.327

6.  Structure of small virus-like particles assembled from the L1 protein of human papillomavirus 16.

Authors:  X S Chen; R L Garcea; I Goldberg; G Casini; S C Harrison
Journal:  Mol Cell       Date:  2000-03       Impact factor: 17.970

Review 7.  Ebola and marburg hemorrhagic fever.

Authors:  Amy L Hartman; Jonathan S Towner; Stuart T Nichol
Journal:  Clin Lab Med       Date:  2010-03       Impact factor: 1.935

8.  Rapid diagnosis of Ebola hemorrhagic fever by reverse transcription-PCR in an outbreak setting and assessment of patient viral load as a predictor of outcome.

Authors:  Jonathan S Towner; Pierre E Rollin; Daniel G Bausch; Anthony Sanchez; Sharon M Crary; Martin Vincent; William F Lee; Christina F Spiropoulou; Thomas G Ksiazek; Mathew Lukwiya; Felix Kaducu; Robert Downing; Stuart T Nichol
Journal:  J Virol       Date:  2004-04       Impact factor: 5.103

9.  Isolation and partial characterisation of a new strain of Ebola virus.

Authors:  B Le Guenno; P Formenty; P Formentry; M Wyers; P Gounon; F Walker; C Boesch
Journal:  Lancet       Date:  1995-05-20       Impact factor: 79.321

10.  Diagnostic reverse-transcription polymerase chain reaction kit for filoviruses based on the strain collections of all European biosafety level 4 laboratories.

Authors:  Marcus Panning; Thomas Laue; Stephan Olschlager; Markus Eickmann; Stephan Becker; Sabine Raith; Marie-Claude Georges Courbot; Mikael Nilsson; Robin Gopal; Ake Lundkvist; Antonino di Caro; David Brown; Hermann Meyer; Graham Lloyd; Beate M Kummerer; Stephan Gunther; Christian Drosten
Journal:  J Infect Dis       Date:  2007-11-15       Impact factor: 5.226

View more
  4 in total

1.  Serological Evidence for Henipa-like and Filo-like Viruses in Trinidad Bats.

Authors:  Jonathan E Schulz; Stephanie N Seifert; John T Thompson; Victoria Avanzato; Spencer L Sterling; Lianying Yan; Michael C Letko; M Jeremiah Matson; Robert J Fischer; Alexandre Tremeau-Bravard; Janine F R Seetahal; Vernie Ramkissoon; Jerome Foster; Tracey Goldstein; Simon J Anthony; Jonathan H Epstein; Eric D Laing; Christopher C Broder; Christine V F Carrington; Tony Schountz; Vincent J Munster
Journal:  J Infect Dis       Date:  2020-05-11       Impact factor: 5.226

Review 2.  Neglected filoviruses.

Authors:  Robin Burk; Laura Bollinger; Joshua C Johnson; Jiro Wada; Sheli R Radoshitzky; Gustavo Palacios; Sina Bavari; Peter B Jahrling; Jens H Kuhn
Journal:  FEMS Microbiol Rev       Date:  2016-06-05       Impact factor: 16.408

Review 3.  The current landscape of nucleic acid tests for filovirus detection.

Authors:  David J Clark; John Tyson; Andrew D Sails; Sanjeev Krishna; Henry M Staines
Journal:  J Clin Virol       Date:  2018-03-22       Impact factor: 3.168

4.  Detection of influenza A virus from live-bird market poultry swab samples in China by a pan-IAV, one-step reverse-transcription FRET-PCR.

Authors:  Lu Luan; Zhihao Sun; Bernhard Kaltenboeck; Ke Huang; Min Li; Daxin Peng; Xiulong Xu; Jianqiang Ye; Jing Li; Weina Guo; Chengming Wang
Journal:  Sci Rep       Date:  2016-07-22       Impact factor: 4.379

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.