Kundu Debabrata1, Bandyopadhyay Prasanta1, Nair Vineet1, Garg Anshul1, Saha Arindam2, Das Satadal3. 1. Department of Periodontia, Dr. R. Ahmed Dental College and Hospital, Kolkata, India. 2. Private practice, Peerless Hospital and B.K Roy Research Centre, Kolkata, India. 3. Institute of Haematology and Transfusion Medicine, Peerless Hospital and B.K Roy Research Centre, Kolkata, India.
Abstract
BACKGROUND: Myeloperoxidase (MPO) is a lysosomal enzyme found in the azurophilic granules of polymorphonuclear leukocytes and is able to mediate inflammatory tissue destruction in aggressive and chronic periodontitis (CP). Human telomerase is a multi subunit ribonucleoprotein enzyme concerned with telomeric lengthening and homeostasis in man and has been found to be elevated in inflammatory conditions such as rheumatoid arthritis and periodontitis. The aim of this study was to explore in aggressive periodontitis (AP) subjects: (i) The role of MPO-463G/A gene polymorphism and (ii) the level of telomerase expression. These parameters have been compared with the subjects of CP and that of the healthy controls. MATERIALS AND METHODS: A total of 45 subjects of the age group 20-50 years and free from any known systemic disease were included in the study. They were divided into three groups - Group I-periodontally healthy control (n = 15), Group II-CP (n = 15) and Group III-AP (n = 15). Peripheral blood samples and gingival tissue samples were collected for MPO gene polymorphism and telomerase expression, respectively, for detection by reverse transcriptase polymerase chain reaction. RESULTS: The frequencies of AG and AA genotypes in the MPO gene polymorphism were more common in the AP subjects when compared to the controls. The m-RNA expression of human telomerase reverse transcriptase (hTERT) was undetectable in the gingival tissue of the control group. Its expression in AP subjects was significantly higher than that of CP group (83.61 ± 2.94 in CP and 104.27 ± 6.06 in AP) (P < 0.0001). CONCLUSIONS: Our data suggest that MPO-463G/A may be associated with increased risk of AP. The level of tissue hTERT was elevated in AP subjects as compared to CP and healthy control groups.
BACKGROUND:Myeloperoxidase (MPO) is a lysosomal enzyme found in the azurophilic granules of polymorphonuclear leukocytes and is able to mediate inflammatory tissue destruction in aggressive and chronic periodontitis (CP). Human telomerase is a multi subunit ribonucleoprotein enzyme concerned with telomeric lengthening and homeostasis in man and has been found to be elevated in inflammatory conditions such as rheumatoid arthritis and periodontitis. The aim of this study was to explore in aggressive periodontitis (AP) subjects: (i) The role of MPO-463G/A gene polymorphism and (ii) the level of telomerase expression. These parameters have been compared with the subjects of CP and that of the healthy controls. MATERIALS AND METHODS: A total of 45 subjects of the age group 20-50 years and free from any known systemic disease were included in the study. They were divided into three groups - Group I-periodontally healthy control (n = 15), Group II-CP (n = 15) and Group III-AP (n = 15). Peripheral blood samples and gingival tissue samples were collected for MPO gene polymorphism and telomerase expression, respectively, for detection by reverse transcriptase polymerase chain reaction. RESULTS: The frequencies of AG and AA genotypes in the MPO gene polymorphism were more common in the AP subjects when compared to the controls. The m-RNA expression of humantelomerase reverse transcriptase (hTERT) was undetectable in the gingival tissue of the control group. Its expression in AP subjects was significantly higher than that of CP group (83.61 ± 2.94 in CP and 104.27 ± 6.06 in AP) (P < 0.0001). CONCLUSIONS: Our data suggest that MPO-463G/A may be associated with increased risk of AP. The level of tissue hTERT was elevated in AP subjects as compared to CP and healthy control groups.
Periodontitis, viewed for years as primarily the outcome of plaque bacteria, is now seen as resulting from a complex interplay between bacterial infection and host response, which is often modified by behavioral and environmental factors.[1] The host response is now considered as a key factor in the clinical expression of periodontitis.[2] The inflammatory response to the bacterial products and other antigens is responsible for the activation of host immunoinflammatory cells (i.e. neutrophils, macrophages, and lymphocytes). The latter migrate into the local tissues and subsequently produce tissue destructive cytokines, eicosanoids, and tissue matrix metalloproteinases and lead to activation of osteoclasts that are likely to have an indirect but major influence on connective tissue destruction, attachment loss and alveolar bone loss in most form of periodontitis. One such disease entity is aggressive periodontitis (AP).[3] It is claimed that AP generally affects systemically healthy individuals.[4] However, several genetic and inherited disorders are thought to be associated with AP.The present study has been performed to assess in AP subjects:Myeloperoxidase (MPO)-463G/A gene polymorphism andLevel of telomerase expression.The above parameters have been compared with the subjects of chronic periodontitis (CP) and that of the healthy controls (N).Myeloperoxidase is a lysosomal enzyme found in the azurophilic granules of polymorphonuclear leukocytes and is able to mediate inflammatory tissue destruction in AP. Human telomerase is a multi-subunit ribonucleoprotein enzyme concerned with telomeric lengthening and homeostasis in man and has been found to be elevated in inflammatory conditions. In rheumatoid arthritis, the level of telomerase indicates the severity of the condition. Keeping these factors in mind, this study has been performed to explore the probable role in AP of MPO-463G/A gene polymorphism and to evaluate the level of telomerase expression.
MATERIALS AND METHODS
A total of 45 subjects was included in the study. They were of the age group 20-50 years, nonsmokers, free from any known systemic disease and had not undergone any periodontal therapy or had received any antibiotics and anti-inflammatory drugs in the previous 6 months. Ethical clearance was obtained from the institution's ethical committee. This study was conducted in accordance with the Helsinki Declaration of 1975 as revised in 2000. Each subject underwent a complete hemogram. Orthopantomograph supplemented by intraoral periapical radiographs were done to assess the bony architecture.The subjects were divided into three groups as follows:Group I-periodontally healthy control (n = 15) - subjects have “healthy periodontium” with no evidence of loss of connective tissue attachment or supporting bone or other signs of disease activity.Group II-CP[35] (n = 15)-Subjects with signs of clinical inflammation consistent with local etiological factors, gingival index score > 1, probing pocket depth ≥ 5 mm, clinical attachment loss of ≥ 3 mm, with radiographic evidence of bone loss.Group III-AP[36] (n = 15) - subjects with noncontributory medical history, rapid attachment loss, and bone destruction, familial aggregation of cases, and amount of deposits which are inconsistent with the severity of periodontal tissue destruction. The latter is either localized to permanent first molars and incisors or generalized interproximal attachment loss affecting at least three permanent teeth other than first molars and incisors.Peripheral blood collected from the antecubital vein of each subject was kept in a vacutainer® (i.e. vacuum container) coated with ethylene diamine tetra acetic acid.
Myeloperoxidase gene polymorphism was examined by the following procedure
A volume of 5 mL peripheral blood was collected and stored at −20°C until analysis. DNA isolation was performed using the DNA extraction kit by Sure Spin Plasmid Kit. The region with a − 463 A/G gene polymorphism located at the promoter region of the MPO gene was amplified by the reverse transcriptase-polymerase chain reaction (RT-PCR) method in Roche LC 2.0 automated instrument using primer chain-MPOF (5’GGTATAGGCACAATGGTGAG) and MPOR (5’ GCAATGGTTCAAGCGATTCTTC). RT-PCR is used to amplify and simultaneously quantify a targeted DNA molecule. The DNA sample was amplified up to 109 times. Fluorescence was detected and measured in the RT-PCR thermocycler and its geometric increase corresponding to the exponential increase of the genome determined by the primer chains. Amplification would appear as amplification curves [Figure 1] suggesting the quantity of the marked genome in the sample.
Figure 1
Amplification curve
Amplification curve
Measuring the level of telomerase expression
Tissue sample collection
Gingival tissue samples were collected by performing incisional biopsy from the extraction site of hopeless teeth of the subjects of AP and CP. Samples in the control group were collected from the surgical sites of crown lengthening procedures. The gingival tissue specimens obtained were thoroughly rinsed with sterile normal saline solution and transferred into two separate Eppendorf microcentrifuge tubes one of which contained 1 mL 1X PBS (phosphate buffer solution) and 20 μl protease inhibitor cocktail (Sigma-Aldrich, USA), while the other contained 1 mL of TRYZOL reagent (Invitrogen). The samples were stored at − 70°C until use.
Total RNA extraction and reverse transcriptase polymerase chain reaction
Total RNA was isolated from the gingival tissue specimens using Trizol (Invitrogen) following the manufacturer's instructions. 40 μl of diethyl pyrocarbonate treated water was added to the RNA pellet to ensure complete dissolution of RNA into the solution. 1 μg RNA was used to perform RT-PCR using the one-step RT-PCR kit (QIAGEN, USA). Humantelomerase reverse transcriptase (hTERT) from tissue was amplified using the forward primer: 5′-AGAGTGTCTGGAGCAAGTTGC-3′ and reverse primer: 5′-CGTAGTCCATGTTCACAATCG-3′. The amplification conditions were reverse transcription at 50°C for 30 min, initial PCR activation step at 95°C for 15 min followed by 35 cycle denaturation at 95°C for 30 s. Annealing was done at 61°C for 30 s. Extension of the chain was done at 72°C for 1 min with a final extension performed at 72°C for 10 min. The glyceraldehydes-3-phosphate dehydrogenase was used as internal control for tissue expression which was amplified with a forward primer: 5′-ATGGGGAAGGTGAAGGTCGG-3′ and reverse primer: 5′-GGATGCTAAGCAGTTGGT-3′. The amplification conditions were 35 cycle denaturation at 95°C for 30 s, followed by annealing at 61°C for 30 s and finally the extension at 72°C for 1 min. The amplified RT-PCR products were subjected to electrophoresis on 2% agarose gels and stained with ethidium bromide. The gel was placed in Gel Doc system (PerkinElmer, USA) for visualization.
Statistical analysis
The data were analyzed using software SPSS, version 13.0 (Chicago, IL, USA). They were analyzed for appropriateness between the observed and expected genotypes and Hardy-Weinberg Equilibrium.Expression of hTERT between the groups was analyzed Mann–Whitney U-tests. One-way analysis of variance was assessed by ANOVA followed by Tukey's test. The correlation of hTERT expression with clinical parameters was assessed by Spearman's signed rank test. The RT-PCR expression was found using color deconvolution program in ImageJ® image analysis system (software, National Institutes of Health, Bethesda, MD, USA).The significance level was set as <0.05 in both the cases.
RESULTS
The frequencies of AG and AA genotypes in the MPO gene polymorphism were more common in the AP subjects when compared to the controls [Figure 2]. However, there were no significant differences between the CP subjects and controls regarding MPO gene polymorphism either in terms of allele frequency or genotype frequency.
Figure 2
Line graph showing the level (%) of A/A and A/G genotype
Line graph showing the level (%) of A/A and A/G genotypeThe prime used for the detection of m-RNA hTERT expression was showing the bands in the all tissue biopsy samples of the test groups against GAPDH which was used as internal control but not detected in the control group [Figure 3]. The relative hTERT m-RNA expression in Group III was significantly higher than that of Group II (P < 0.0001) [Table 1]. Table 2 shows Spearman's ranked correlation between hTERT expression versus clinical parameters in chronic periodontitis and aggressive periodontitis.
Figure 3
Expression of hTERT m-RNA
Table 1
Expression of hTERT in aggressive periodontitis group in comparison to control group and chronic periodontitis group
Table 2
Spearman's ranked correlation between of hTERT expression versus clinical parameters in chronic periodontitis and aggressive periodontitis
Expression of hTERT m-RNAExpression of hTERT in aggressive periodontitis group in comparison to control group and chronic periodontitis groupSpearman's ranked correlation between of hTERT expression versus clinical parameters in chronic periodontitis and aggressive periodontitis
DISCUSSION
It is well-recognized that poor oral hygiene alone cannot account for periodontal tissue destruction as some individuals are at relatively high risk for tissue destruction than others.[78] Hence, investigators put forward the idea that a constitutional factor, probably of genetic origin might play a part.[910] According to a genetic study, approximately 50% of the population variance for disease is attributed to genetic factors.[11]In this study, an investigation was done to correlate the MPO-463G/A polymorphism with AP and CP and it shows that this polymorphism is associated with an increased risk of AP in the test groups.The role of MPO in inflammatory diseases has been supported by genetic studies reporting an association with the-463G/A polymorphism located in the promoter region of the MPO gene.[12131415] MPO activity is increased in inflammatory gingival tissue and gingival crevicular fluid.[16] Recently, Meisel et al. have reported an association between MPO-463G/A polymorphism and periodontal disease.[17] They examined more than 3000 subjects and found that females with GG genotype were 50% more susceptible to periodontal disease. Apparently, this was due to MPO released by reactive neutrophils damaging the cells. According to the study, it was stated that through MPO G/A base change, mRNA expression and MPO level were decreased. However, MPO production was increased by the G allele in subjects with MPO-463G/A polymorphism.[18] Atzeni et al. did not find any association between the -463G/AMPO promoter polymorphism and susceptibility to and clinical expression of Behcet's disease.[19] Many studies provide strong evidence that the polymorphism does result in a difference in MPO activity that affects disease susceptibility.[2021] Thus, MPO protects against microbial invasion, while in inflammatory disease states it unintentionally contributes to cell damage.[22] However, the assessment of MPO as a biological marker requires knowledge of its biological variations, which are poorly documented.The precise mechanisms underlying the relationship of the MPO polymorphism and periodontal disease remain unclear. MPO protein is mainly expressed at high levels in neutrophils, monocytes and some reactive microglial.[23] The G allele is the wild type with normal MPO expression, while the A allele is a low-expression allele.[23] There were no significant differences between the CP subjects and controls regarding MPO-463A/G gene polymorphism either in terms of allele frequency or genotype frequency of MPO-463A/G. However, either in terms of allele frequency or genotype frequency of MPO-463A/G there was significant differences between the AP subjects and the controls. Importantly, we found that the MPO-463AA genotype or A allele had a role in susceptibility to AP.Somatic human cells show a strictly limited growth potential and enter senescence after a determined number of cell divisions due to progressive telomere shortening. Telomeric lengthening by telomerase (hTERT mainly) is the main mechanism of telomere homeostasis in man.[24] Transient elevation in telomerase levels has been found in inflammatory conditions like silicosis of lung and rheumatoid arthritis.[25] This enzyme is present constitutively in normal human cells and organs with a high turnover rate like testes and spleen and in high amounts in activated T and B lymphocytes.[2627]In the present study, hTERT was observed to be in elevated levels in both the forms of periodontitis (83.61 ± 2.94 in CP and 104.27 ± 6.06 in AP as against nil in healthy control). Chronic inflammation observed in periodontitis is marked by the presence of antigen presenting cells like dendritic cells and T and B lymphocytes which have a long life span and possess the telomerase.[28] These cells have been demonstrated to infiltrate in the gingival tissue of CP and AP subjects.[29] Recently Weng et al. and Igarashi et al. suggested that the activation of the T cell and B cell receptors by mitogens and phytohemagglutinins increases the telomerase levels by many folds.[3031] Since sustained activation of T and B cells occurs in CP and AP, this could be a reason for the telomerase up-regulation.[24]Moreover, the involvement of lymphocytes and monocytes in CP and AP results in the production of many cytokines such as IL-2 and IL-6. These cytokines up-regulate telomerase through the IL-2 receptor and signal transducer and activator of transcription 3 signaling mechanisms in T lymphocytes and monocytes, respectively.[32] B and T lymphocytes, the major antigen-specific lineages of the immune system, require extensive cell division and clonal expansion for their functions.The most implicated pathogen in periodontitis is Porphyromonas gingivalis. This pathogen is capable of intracellular invasion into buccal epithelial cells.[33] It can down-regulate p53, conferring an anti-apoptotic phenotype to epithelial cells. A study by Rahman et al. 2005, recently found that p-53 down-regulation is associated with telomerase up-regulation.[34] It is possible that intracellular colonization of P. gingivalis in oral and sulcular epithelial cells in CP may indirectly up-regulate the telomerase. Periodontal pockets have lowered oxygen tension and were more hypoxic than the healthy gingival sulcus. Anderson et al. found that hypoxia can stimulate telomerase expression by unknown mechanisms.[35]In the present study, the gingival tissue samples of 10 healthy controls, 10 subjects of CP and 10 subjects of AP were subjected to evaluate the hTERT-m-RNA expression by RT-PCR. The m-RNA expression of hTERT was undetectable in the gingival tissue of the control group by RT-PCR. A possible reason for the absence of the telomerase in healthy gingiva could be the presence of plenty of fibroblasts which are telomerase negative cells and a diminished number of stem cells which are telomerase-positive cells.[3637] The presence of hTERT expression in the gingival tissue of CP and AP subjects might be due to B cell and T cell infiltration. The possible reason for higher hTERT gene expression in cases of AP as compared to subjects of CP might be due to an increased host response and elevated amount of chronic inflammatory cells like B and T cells in cases of AP.
SUMMARY AND CONCLUSION
The results show that MPO-463 gene polymorphism demonstrated a significant association with AP. The different association of AP and CP with this gene polymorphism may help to explain their differing etiopathogenesis. Our data suggest that MPO-463G/A may be associated with increased risk of AP. The level of tissue hTERT was elevated in AP subjects as compared to CP and healthy control groups.
Authors: B S Michalowicz; D Aeppli; J G Virag; D G Klump; J E Hinrichs; N L Segal; T J Bouchard; B L Pihlstrom Journal: J Periodontol Date: 1991-05 Impact factor: 6.993