Literature DB >> 25947561

The first case of feline sinonasal aspergillosis due to Aspergillus fischeri in Japan.

Rui Kano1, Tomoko Takahashi, Takeshi Hayakawa, Yoshiki Yamaya, Atsuhiko Hasegawa, Hiroshi Kamata.   

Abstract

Feline upper respiratory tract infection due to Aspergillus spp. is considered an emerging disease, with the number of reported cases continuing to rise. In this study, we report the first case of feline sinonasal aspergillosis caused by Aspergillus fischeri in Japan. The patient presented after 2 months of progressive facial deformity around the nose and nasal discharge. The isolate from this case was susceptible to itraconazole (ITZ), voriconazole and micafungin, but was resistant to amphotericine B. However, the infected cat died approximately 1 month after referral, despite treatment for 12 days ITZ administered orally at 10 mg/kg.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25947561      PMCID: PMC4591165          DOI: 10.1292/jvms.14-0454

Source DB:  PubMed          Journal:  J Vet Med Sci        ISSN: 0916-7250            Impact factor:   1.267


Feline upper respiratory tract (URT) infection due to Aspergillus spp. is considered an emerging disease, with the number of reported cases continuing to rise [3,4,5, 7,8,9]. Aspergillus fumigatus has been the most frequently reported etiologic agent of sino-orbital aspergillosis in cats [4, 7]; two other Aspergillus species, A. udagawae and A. fischeri, have also been implicated. The minimum inhibitory concentrations (MICs) of amphotericin B (AMB) and azoles [4, 8, 9] are elevated for A. udagawae and A. fischeri compared with A. fumigatus, but distinguishing A. udagawae and A. fischeri from A. fumigatus requires molecular analyses. Some reports described that the feline infections due to A. udagawae and A. fischeri do not respond to treatment with AMB, itraconazole (ITZ) or micafungin (MCF) [4, 8, 9]. These results suggest that speciation and antifungal susceptibility testing of infecting agents are important to ensure effective treatment of feline URT aspergillosis. In this study, we report the first Japanese feline case of sinonasal aspergillosis caused by A. fischeri. Case: A castrated Russian blue cat (11 years old; weight, 2.9 kg) was referred to the Nihon University Animal Medical Center, Kanagawa, Japan, in June 2014 after exhibited progressive facial deformity around the nose with nasal discharge over the previous 2 months. The cat suffered from diabetes mellitus and had been treated with insulin for 5 years. However, control by insulin injection was not succeesful in the patient cat. Physical examination of the cat showed swelling on the nose (Fig. 1), depression and weight loss. The results of hematological examination, a serum biochemistry panel and urinalysis are shown in Table 1. The cat was positive for the serum Aspergillus galactomannan antigen (Health Sciences Research Institute, Inc., Yokohama, Japan). CT scan revealed a soft-tissue mass within the right nasal cavity (Fig. 2). A chest and abdominal CT scan did not detect typical Aspergillus infection signs. Histopathologic examination of biopsy samples from this mass revealed granulomatous inflammation containing many branching hyphal filaments (Fig. 3). A sample of nasal discharge was inoculated on Sabouraud’s dextrose agar (SDA) and incubated at 28°C. Velvety-grayish white colonies developed within 2 weeks. Based on gross and microscopic characteristics, the isolate was identified as an Aspergillus species, and the case was diagnosed as sinonasal aspergillosis.
Fig. 1.

Pus discharge and an ulcer were observed on the mass on the left side of the bridge of the nose.

Table 1.

Hematological examination, serum biochemistry panel and urinalysis of the patient cat

Ht23%ALB42 U/lNa152 mEq/l
Hb7.3 g/dlALP31 U/lK2.7 mEq/l
PLT772 × 103/µlALT29 U/lCl110 mEq/l
WBC17,900/µlAST10 U/l
Stab0/µlBUN42 mg/dlUrine gravity 1.034
Seg12,440/µlCRE0.8 mg/dlGlycosuria 2,000 mgl
Lym1,969/µlTCHOL380 mg/dl
Mon1,790/µlGLU316 mg/dl
Eos1,700/µlCa10.8 mg/dl
Baso0/µlP2.3 mg/dl
Fig. 2.

The left panel shows a computed tomographic (CT) image after administration of a contrast agent at the level of the canine teeth. The animal’s right nasal cavity (R) is occupied by a large mass (*) that lacks contrast enhancement. The right panel shows a reconstructed image from multiple CT images of the head; the right side of the nasal bone is largely destroyed.

Fig. 3.

Histopathologic examination of the mass from the right nasal cavity of the case revealed chronic purulent inflammation with many branching hyphal filaments (HE stain).

Pus discharge and an ulcer were observed on the mass on the left side of the bridge of the nose. The left panel shows a computed tomographic (CT) image after administration of a contrast agent at the level of the canine teeth. The animal’s right nasal cavity (R) is occupied by a large mass (*) that lacks contrast enhancement. The right panel shows a reconstructed image from multiple CT images of the head; the right side of the nasal bone is largely destroyed. Histopathologic examination of the mass from the right nasal cavity of the case revealed chronic purulent inflammation with many branching hyphal filaments (HE stain). ITZ (Janssen Pharmaceutical K.K., Tokyo, Japan) was administered orally at 10 mg/kg, once daily for 12 days. In addition, antifungal susceptibility tests were initiated for the infecting organism, and plans were made to flush the nasal airway with appropriate antifungal solutions based on the results of these tests. However, the owner declined the use of topical antifungal therapy pending the results of susceptibility testing because of the nasal airway needs to be performed in an anesthetized condition that is a high risk for the patient. The owner desired an effective and safe treatment. In the meantime, the case continued to deteriorate, and the cat died on day 19, i.e., one week after completion of the ITZ regimen (and 28 days after the initial referral). Necropsy was not performed. Molecular identification of fungal species: Isolation of genomic DNA of the isolate was reported previously [9]. The internal transcribed spacer (ITS) region of the isolated Aspergillus was amplified using the universal fungal primers ITS5 (5′ GGAAGTAAAAGTCGTAACAAGC) and ITS4 (5′ TCCTCCGCTTATTGATAGC) [2]. PCR amplification and sequence analyses were performed as described previously [2]. Comparative sequence analyses by nucleotide BLAST analysis on the National Center for Biotechnology Information (NCBI) website showed that the sequence of the ITS region amplified from the isolate from the case was 100% identical to that of A. fischeri (teleomorph of Neosartorya fischeri; GenBank accession no. FJ624264). The sequences determined in this study have been deposited in GenBank (Aspergillus fischeri genes for ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial sequences, strain: NUBS14001 clinical isolate from feline sinonasal aspergillosis; DDBJ accession number, LC011422). Testing of in vitro susceptibility to antifungal drugs: The in vitro susceptibilities of the isolate to the antifungal drugs AMB, ITZ, voriconazole (VRZ) and micafungin (MCF) were assessed by the E-test method [11]. The drug susceptibility tests for this isolate revealed that the MICs of AMB, ITZ, VRZ and MCF by E-test were more than 32 mg/l, 0.25 mg/l, 0.064 mg/l and 0.012 mg/l, respectively. This work represents the first reported Japanese case of feline sinonasal aspergillosis due to A. fischeri. In summarizing 22 cases of feline sinonasal aspergillosis in Australia, Barrs et al. reported that the fungal pathogens were A. fumigates (n=4), Neosartorya fischeri (n=1), A. lentulus (n=1) or other Neosartorya spp. (n=16) [4]. Therefore, non-fumigatus aspergilli, including A. fischeri, should be considered potential fungal pathogens in feline URT aspergillosis. A. fischeri is known as a causative agent of human respiratory aspergillosis [1], but it has not been well investigated with regard to susceptibility to AMB and azoles. The isolate from this case was susceptible to ITZ, VRZ and MCF, but was resistant to AMB. Cantón et al. suggested that the in vitro breakpoints (resistance) for AMB and azoles of Aspergillus spp. were MICs ≥4 mg/l [6]. AMB is frequently selected for treatment of canine and feline cases of aspergillosis, including feline URT aspergillosis [10]. Therefore, the decision-making process for determining the therapy for therapy of feline URT aspergillosis should include determination of the MICs of other antifungal drugs. We administered oral ITZ to the patient cat, but could not confirm the efficacy of this treatment due to subsequent mortality. The poor response in this case may have reflected progression of the infection. In addition, the pathogenesis of diabetes mellitus might interfere with ITZ therapy and has been recognized as a risk factor in feline URT aspergillosis [5]. More aggressive management using intravenous administration or nasal air way flushing with ITZ solution may have been needed. This case was diagnosed as aspergillosis by a serum Aspergillus galactomannan antigen test as well as histopathologic examination and mycological identification. The antigen test has been reported to have poor specificity, but moderate sensitivity as a noninvasive screening test to rule out infection in feline patients with suspected URT aspergillosis [12]. Therefore, the test should be evaluated for rapid, noninvasive screening of feline URT aspergillosis, including A. fischeri infection. The low susceptibility to antifungals seen in isolates of non-fumigatus aspergilli indicates that molecular identification of Aspergillus species and in vitro susceptibility testing are needed in the selection of effective antifungal drugs and prediction of the prognosis of feline URT aspergillosis. Further studies are required to determine the distinct resistance profiles of infecting non-fumigatus aspergilli, since antifungal susceptibility may be a major determinant of treatment outcome. Aspergillosis is generally an opportunistic infection, and host immunocompetence is thought to be an important determinant in the development of the infection. The frequency of use of chemotherapy and immunosuppressive drugs is increasing in the veterinary field. Due to the risk of opportunistic fungal infections should exercise care when they use these drugs. In conclusion, feline URT infection due to Aspergillus spp. is considered an emerging disease, with the number of reported cases continuing to rise. To our knowledge, this was the first feline case of sinosal aspergillosis in Japan caused by A. fischeri. The isolate from this case was susceptible to ITZ, VRZ and MCF, but was resistant to AMB. Therefore, the cat was administered ITZ orally for 12 days, and it died on day 19. The poor response in this case may have reflected progression of the infection. A rapid diagnosis method and effective treatment are needed based on speciation and antifungal susceptibility testing of infecting agents.
  11 in total

1.  Two cases of feline orbital aspergillosis due to Aspergillus udagawae and A. viridinutans.

Authors:  Rui Kano; Ayami Shibahashi; Yasuhito Fujino; Hiroki Sakai; Takashi Mori; Hajime Tsujimoto; Tokuma Yanai; Atsuhiko Hasegawa
Journal:  J Vet Med Sci       Date:  2012-08-10       Impact factor: 1.267

2.  Sinonasal and sino-orbital aspergillosis in 23 cats: aetiology, clinicopathological features and treatment outcomes.

Authors:  V R Barrs; C Halliday; P Martin; B Wilson; M Krockenberger; M Gunew; S Bennett; E Koehlmeyer; A Thompson; R Fliegner; A Hocking; S Sleiman; C O'Brien; J A Beatty
Journal:  Vet J       Date:  2011-03-08       Impact factor: 2.688

3.  Evaluation of serum galactomannan detection for diagnosis of feline upper respiratory tract aspergillosis.

Authors:  J Whitney; J A Beatty; P Martin; N K Dhand; K Briscoe; V R Barrs
Journal:  Vet Microbiol       Date:  2012-09-12       Impact factor: 3.293

4.  Isolation of Aspergillus udagawae from a fatal case of feline orbital aspergillosis.

Authors:  Rui Kano; Kazuhito Itamoto; Masaru Okuda; Hisashi Inokuma; Atsuhiko Hasegawa; S Arunmozhi Balajee
Journal:  Mycoses       Date:  2008-07       Impact factor: 4.377

Review 5.  Trends in antifungal susceptibility testing using CLSI reference and commercial methods.

Authors:  Emilia Cantón; Ana Espinel-Ingroff; Javier Pemán
Journal:  Expert Rev Anti Infect Ther       Date:  2009-02       Impact factor: 5.091

6.  In vitro susceptibility testing of filamentous fungi: comparison of Etest and reference M38-A microdilution methods for determining posaconazole MICs.

Authors:  M A Pfaller; S A Messer; L Boyken; R J Hollis; D J Diekema
Journal:  Diagn Microbiol Infect Dis       Date:  2003-04       Impact factor: 2.803

Review 7.  Phenotypic and genotypic identification of human pathogenic aspergilli.

Authors:  S Arunmozhi Balajee; Kieren A Marr
Journal:  Future Microbiol       Date:  2006-12       Impact factor: 3.165

8.  Characterization of a novel gene for strain typing reveals substructuring of Aspergillus fumigatus across North America.

Authors:  S Arunmozhi Balajee; Sun T Tay; Brent A Lasker; Steve F Hurst; Alejandro P Rooney
Journal:  Eukaryot Cell       Date:  2007-06-08

9.  Invasive mould infections of the naso-orbital region of cats: a case involving Aspergillus fumigatus and an aetiological review.

Authors:  Cristina Giordano; Paola Gianella; Stefano Bo; Antonella Vercelli; Chiara Giudice; Daniele Della Santa; Anna Maria Tortorano; Claudio Peruccio; Andrea Peano
Journal:  J Feline Med Surg       Date:  2010-09       Impact factor: 2.015

10.  Bilateral orbital and nasal aspergillosis in a cat.

Authors:  Laura Barachetti; Carlo M Mortellaro; Mauro Di Giancamillo; Chiara Giudice; Pieranna Martino; Olga Travetti; Paul E Miller
Journal:  Vet Ophthalmol       Date:  2009 May-Jun       Impact factor: 1.644

View more
  3 in total

1.  Evaluation of Serum Aspergillus-Specific Immunoglobulin A by Indirect ELISA for Diagnosis of Feline Upper Respiratory Tract Aspergillosis.

Authors:  A Taylor; I Peters; N K Dhand; J Whitney; L R Johnson; J A Beatty; V R Barrs
Journal:  J Vet Intern Med       Date:  2016-09-01       Impact factor: 3.333

Review 2.  Extrolites of Aspergillus fumigatus and Other Pathogenic Species in Aspergillus Section Fumigati.

Authors:  Jens C Frisvad; Thomas O Larsen
Journal:  Front Microbiol       Date:  2016-01-07       Impact factor: 5.640

3.  Discovery of Aspergillus frankstonensis sp. nov. during environmental sampling for animal and human fungal pathogens.

Authors:  Jessica J Talbot; Jos Houbraken; Jens C Frisvad; Robert A Samson; Sarah E Kidd; John Pitt; Sue Lindsay; Julia A Beatty; Vanessa R Barrs
Journal:  PLoS One       Date:  2017-08-09       Impact factor: 3.240

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.