| Literature DB >> 25901572 |
Alison Kernell Burke1, Leah T C Guthrie1, Thero Modise1, Guy Cormier2, Roderick V Jensen1, Linda L McCarter3, Ann M Stevens1.
Abstract
Vibrio parahaemolyticus is an emerging world-wide human pathogen that is associated with food-borne gastroenteritis when raw or undercooked seafood is consumed. Expression of virulence factors in this organism is modulated by the phenomenon known as quorum sensing, which permits differential gene regulation at low versus high cell density. The master regulator of quorum sensing in V. parahaemolyticus is OpaR. OpaR not only controls virulence factor gene expression, but also the colony and cellular morphology associated with growth on a surface and biofilm formation. Whole transcriptome Next Generation sequencing (RNA-Seq) was utilized to determine the OpaR regulon by comparing strains BB22OP (opaR+, LM5312) and BB22TR (∆opaR1, LM5674). This work, using the published V. parahaemolyticus BB22OP genome sequence, confirms and expands upon a previous microarray analysis for these two strains that used an Affymetrix GeneChip designed from the closely related V. parahaemolyticus RIMD2210633 genome sequence. Overall there was excellent correlation between the microarray and RNA-Seq data. Eleven transcription factors under OpaR control were identified by both methods and further confirmed by quantitative reverse transcription PCR (qRT-PCR) analysis. Nine of these transcription factors were demonstrated to be direct OpaR targets via in vitro electrophoretic mobility shift assays with purified hexahistidine-tagged OpaR. Identification of the direct and indirect targets of OpaR, including small RNAs, will enable the construction of a network map of regulatory interactions important for the switch between the nonpathogenic and pathogenic states.Entities:
Mesh:
Substances:
Year: 2015 PMID: 25901572 PMCID: PMC4406679 DOI: 10.1371/journal.pone.0121863
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Fig 1Differential mRNA expression controlled by OpaR in V. parahaemolyticus.
Graphical representation of the RNA-Seq data from V. parahaemolyticus BB22OP strain LM5312 (opaR ) and BB22TR strain LM5674 (∆opaR1) for Chromosome 1 (Panel A) and Chromosome 2 (Panel B). The RPM change of normalized expression for most genes (unfilled circles) falls around a line with a slope of 1, indicating that they are equally expressed in both strains. Points with lighter tone are controlled by OpaR greater than 2-fold and the darker points are controlled by OpaR greater than 4-fold with green shades highlighting activated genes and red shades highlighting repressed genes.
Validation of Transcription Factors Highly Regulated by OpaR via qRT-PCR.
| BB22OP ID | RIMD 2210633 ID | Annotation | Mode of OpaR Regulation | Microarray Data |
|
|
|---|---|---|---|---|---|---|
| Chromosome 1 | ||||||
| VPBB_0491 | VP0514 |
| activated | 3.10 ± 0.31 | 5.76 | 12.87 ± 5.86 |
| VPBB_0645 | VP0675 |
| activated | 4.91 ± 0.27 | 1.98 | 3.50 ± 1.37 |
| VPBB_2530 | VP2710 |
| activated | 6.06 ± 0.94 | 2.45 | 2.88 ± 1.05 |
| VPBB_1307 | VP1391 |
| repressed | 0.03 ± 0.01 | 0.06 | 0.31 ± 0.13 |
| VPBB_1322 | VP1407 |
| repressed | 0.11 ± 0.01 | 0.32 | 0.12 ± 0.03 |
| VPBB_1558 | VP1699 |
| repressed | 0.15 ± 0.02 | 0.29 | 0.30 ± 0.16 |
| VPBB_2619 | VP2762 |
| repressed | 0.24 ± 0.02 | 0.20 | 0.26 ± 0.07 |
| Chromosome 2 | ||||||
| VPBB_A0554 | VPA0606 |
| activated | 5.12 ± 0.57 | 6.12 | 3.43 ± 0.90 |
| VPBB_A0869 | VPA0947 |
| activated | 4.38 ± 0.65 | 8.05 | 3.20 ± 1.74 |
| VPBB_A1319 | VPA1446 |
| activated | 3.54 ± 0.24 | 8.14 | 3.62 ± 0.19 |
| VPBB_A1405 | VPA1538 |
| repressed | 0.02 ± 0.003 | 0.01 | 0.01 ± 0.01 |
| Controls | ||||||
| VPBB_0387 | VP0404 |
| none | 0.99 ± 0.02 | 0.93 | 0.65 ± 0.10 |
| VPBB_2050 | VP2232 |
| none | 0.39 ± 0.25 | 0.50 | 0.75 ± 0.19 |
aFor the microarray data, the standard deviation of the normalized expression in four biological replicates of the ∆opaR1 strain was compared to three biological replicates of opaR strains.
b RNA-Seq data is fold change of the opaR strain gene expression divided by the ∆opaR1 strain gene expression. Error for the ratios of normalized gene expression levels were conservatively estimated using the standard deviation ratios across the majority of genes with less than 4-fold change. The standard deviation for chromosome 1 is 1.53 and the error for chromosome 2 is 1.59.
c The error in fold changes for each gene was estimated by computing the standard deviation for four replicates of the qRT-PCR measurements.
Predicted OpaR-binding sites in Promoters of Select Transcription Factors .
| Transcription factor: BB22OP (RIMD2210633)/ annotation | Score | OpaR-binding site 5′ end | OpaR-binding site 3′ end | Sequence (5′ to 3′)e |
|---|---|---|---|---|
|
| 3.73 | −57 | −38 | AAAAAATAATAATCATTATT |
|
| 4.39 | −296 | −277 | TATTGGATAAAAAACCAATA |
| 5 | −263 | −244 | TAATAATAAATTGATTCAAT | |
| 3.34 | −259 | −240 | AATAAATTGATTCAATTTTA | |
| 4.74 | −255 | −236 | AATTGATTCAATTTTAAAAA | |
|
| 3.48 | −397 | −378 | AACTATCAAAATAGGCATTT |
| 3.26 | −388 | −369 | AATAGGCATTTCAACCATTA | |
| 3.72 | −287 | −268 | TAATAAAAAAACACCTAATA | |
| 4.14 | −272 | −253 | TAATATTAAGTTTATTAAAA | |
| 5.06 | −264 | −245 | AGTTTATTAAAATGTTCATT | |
| 6.35 | −182 | −163 | AATTGATATTAATATTAGGA | |
| 5.59 | −99 | −80 | TTTTATCTATAAAATCAGAA | |
| 5.9 | −40 | −21 | AATAAAAAAATCTATCTTTA | |
| 3.69 | −26 | −7 | TCTTTATTATTTTATTATCA | |
| 5.37 | −23 | −4 | TTATTATTTTATTATCAACT | |
|
| 3.38 | −369 | −350 | TAATTTTTATTATCATATTA |
| 3.89 | −366 | −347 | TTTTTATTATCATATTAGTA | |
| 6.71 | −362 | −343 | TATTATCATATTAGTAATTT | |
| 7.97 | −354 | −335 | TATTAGTAATTTAATTTATT | |
| 4.47 | −342 | −323 | AATTTATTCTAATATAAAAA | |
| 5.74 | −283 | −264 | AATAGACTTATAAGAAAGTA | |
| 3.92 | −79 | −60 | AAATAACAACAAACAAAGTA | |
|
| 3.54 | −299 | −280 | TATTAACTACAAAATAACTC |
| 10.35 | −279 | −260 | TATTGAGTATTATGTTAGTT | |
| 4.06 | −94 | −75 | TACTTATACATTAAAAAACT | |
| 3.81 | −23 | −4 | TATTGACCATTTGGATTGAA | |
|
| 5.59 | −123 | −104 | TATAATTAACTAAATTAGAA |
| 5.58 | −90 | −71 | ATTTATCTAAATTCACAATT | |
| 4.63 | −47 | −28 | TATTGTTTTAGTAATATCTA | |
| 3.53 | −39 | −20 | TAGTAATATCTAATTTAGTT | |
|
| 4 | −133 | −114 | TTTTGTTTCTGTTTTTAATA |
| 5.26 | −121 | −102 | TTTTAATAAATTAGTAATTC | |
| 3.11 | −46 | −27 | TGCTGATAATTAACTACGAA | |
| 4.06 | −39 | −20 | AATTAACTACGAAATTAAGA | |
|
| 4.89 | −214 | −195 | CATTTATAAATCGGTTAATA |
| 3.63 | −198 | −179 | AATAAATTAAAATAGCAACT | |
| 7.26 | −122 | −103 | TTATTATAAAAAAATTAATA | |
| 3.91 | −118 | −99 | TATAAAAAAATTAATATAAA | |
| 4.21 | −116 | −97 | TAAAAAAATTAATATAAATA | |
| 4.76 | −113 | −94 | AAAAATTAATATAAATAGTT | |
| 3.59 | −110 | −91 | AATTAATATAAATAGTTGTT |
aPutative binding sites identified through PATSER using MQSR matrix [27]
bScores and locations are upstream of VPBB_1307 (VP1392), the first gene of the operon.
c Scores and locations are upstream of VPBB_1322 (VP1409), the first gene of the operon.
Scores and locations are upstream of VPBB_A1405 (VPA1538), the first gene of the operon.
Fig 2Organization of select gene loci of V. parahaemolyticus in the OpaR regulon.
Cartoon gene maps, not to scale, are provided for the promoter regions and gene organization near OpaR-regulated transcription factors identified through the RNA-Seq data analysis. Dark green arrows represent genes of transcription factors activated by OpaR, dark red arrows indicate genes of repressed transcription factors and the lighter arrows illustrate other genes in the operons of interest. The diamonds represent predicted OpaR-binding sites from PATSER data (see Table 2 for specific locations and scores).
Fig 3EMSA analysis of putative OpaR direct targets.
Each panel is labeled with the promoter being analyzed. The black arrow indicates unbound DNA and the grey arrow indicates the DNA shift due to bound OpaR, with additional complexes with higher mobility present at some promoters. The concentration of FAM-labeled DNA probe in all lanes is 10 nM. The lanes within each panel (left to right) consist of the following: DNA probe with 0 nM, 25 nM, 50 nM, 100 nM OpaR, 200 nM or 400 nM OpaR. The sample in the far right lane contains DNA probe plus 100 nM of OpaR with 100 nM unlabeled DNA for competition. Gene names are: VPBB_0491(cpsR), VPBB_0645 (crl family), VPBB_2530 (cspD/vpsT family), VPBB_1307 (fhlA family), VPBB_1322 (asnC family), VPBB_1558 (exsA), VPBB_2619 (aphA), VPBB_A0554 (araC family), VPBB_A0869 (ars family), VPBB_A1319 (cpsQ family), and VPBB_A1405 (lafK).
Putative sRNAs and 5’-untranslated leaders regulated four-fold or more by OpaR.
| sRNA ID | Flanking BB22OP genes | Length (bp) | Mode of OpaR Regulation |
|
|---|---|---|---|---|
|
| ||||
| Candidate | VPBB_2071-VPBB_2072 | 93 | repressed | 0.15 |
| Candidate | VPBB_2279-VPBB_2280 | 133 | repressed | 0.15 |
| Srr (swarm-specific RNA) | VPBB_1217-VPBB_1218 | 190 | repressed | 0.005 |
|
| ||||
| Cyclic di-GMP-II Riboswitch | VPBB_A1460-VPBB_A1461 | 105 | repressed | 0.07 |
| MicX | VPBB_A1271-VPBB_A1272 | 196 | activated | 4.58 |
| Purine_riboswitch | VPBB_A1172-VPBB_A1173 | 100 | repressed | 0.24 |
| Candidate 12 | VPBB_A1578-VPBB_A1579 | 207 | repressed | 0.15 |
asRNAs identified with sRNAPredict2
b Not found in either database
c sRNAs identified with BSRD
d Due to the qRT-PCR size and primer requirements, sRNA expression was not further validated. Only the Srr was confirmed via qRT-PCR since it was not part of one of the existing sRNA databases.
e The approximate genomic location of Srr is 1354895–1355085 bp and Candidate 12 is 1776278–1776403 bp. Due to the lack of strand specific data, the location of the other sRNAs was not determined, although all sRNAs were observed in the RNA-Seq data.
fRNA-Seq data is fold change of the opaR + strain gene expression divided by the ∆opaR1 strain gene expression. Error for the ratios of normalized gene expression levels were conservatively estimated using the standard deviation ratios across the majority of genes with less than 4-fold change. The standard deviation for chromosome 1 is 1.53 and the error for chromosome 2 is 1.59.
Fig 4Model of OpaR regulon highlighting downstream transcription factors.
Downstream targets of OpaR include 11 transcription factors differentially regulated by OpaR four-fold or more. The genes controlling nine of the transcription factors are directly controlled by OpaR, as indicated by the solid lines. VPA0606 (AraC family protein) and VP2710 (CsgD/VpsT family protein) appear to be indirectly regulated as indicated by the dashed lines. Blue indicates genes about which some experimental data with relation to hierarchical control has been obtained in V. parahaemolyticus.