Literature DB >> 25889293

Detection of highly pathogenic zoonotic influenza virus H5N6 by reverse-transcriptase quantitative polymerase chain reaction.

Hans G Heine1, Adam J Foord2, Jianning Wang3, Stacey Valdeter4, Som Walker5, Chris Morrissy6, Frank Y K Wong7, Brian Meehan8.   

Abstract

BACKGROUND: Variant high pathogenicity avian influenza (HPAI) H5 viruses have recently emerged as a result of reassortment of the H5 haemagglutinin (HA) gene with different neuraminidase (NA) genes, including NA1, NA2, NA5, NA6 and NA8. These viruses form a newly proposed HA clade 2.3.4.4 (previously provisionally referred to as clade 2.3.4.6), and have been implicated in disease outbreaks in poultry in China, South Korea, Laos, Japan and Vietnam and a human fatality in China. There is real concern that this new clade may be wide spread and not readily identified using existing diagnostic algorithms.
FINDINGS: Fluorescent probe based reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR) assays were developed to facilitate the identification of novel clade 2.3.4.4 viruses of H5N6 subtype emerging in Asia. Assays were aimed at the haemagglutinin (HA) gene for clade identification and at the NA gene to identify N6. The HA assay employing a minor groove binder (MGB) probe was able to detect and differentiate A/duck/Laos/XBY004/2014(H5N6) and related influenza A(H5N6) virus isolates belonging to the proposed clade 2.3.4.4 from other H5 HPAI viruses. In addition, an Eurasian N6 assay was able to differentiate N6 from other NA subtypes.
CONCLUSIONS: Laos influenza A(H5N6) virus representative of proposed clade 2.3.4.4, was detected and differentiated from viruses in other H5N1 clades using a clade-specific HA RT-qPCR assay whereas the N6-NA subtype was determined by an Eurasian N6 RT-qPCR assay. Such a clade-specific assay would be of particular value for surveillance and in diagnostic laboratories where sequencing is not readily available.

Entities:  

Mesh:

Year:  2015        PMID: 25889293      PMCID: PMC4328077          DOI: 10.1186/s12985-015-0250-3

Source DB:  PubMed          Journal:  Virol J        ISSN: 1743-422X            Impact factor:   4.099


Findings

HPAI viruses continue to evolve and pose a threat to animal and human health. Recent HPAI H5 virus variants of different NA subtypes have been implicated in disease outbreaks in poultry in China (H5N1, H5N2, H5N5, H5N6, H5N8) , South Korea (H5N8), Japan (H5N8), Laos (H5N8) and Vietnam (H5N1, H5N6) and an H5N6 subtype virus caused a human fatality in China [1-3]. These variants have previously been referred to as “clade 2.3.4.6” viruses and originate from H5N1 clade 2.3.4 viruses [4,5]. However, the WHO/OIE/FAO H5N1 Evolution Working Group recently designated that these viruses fall into a new clade 2.3.4.4 and not 2.3.4.6 [6]. Of particular significance, these emergent H5 viruses have a propensity for reassortment of the HA gene with different NA subtypes, including NA1, NA2, NA5, NA6, NA8 [7]. Accordingly there is concern that this clade may be spreading more widely [8], and although these variant strains are being detected by diagnostic RT-qPCR assays in current use, they cannot be readily distinguished from other H5N1 HPAI viruses. Molecular identification of this new clade currently requires conventional RT-PCR amplification of the HA gene followed by nucleotide sequence determination. Likewise, identification of the N subtype requires nucleotide sequence determination following conventional RT-PCR of the NA gene or multiple N6 subtype-specific RT-qPCR assays. Here we report the development of RT-qPCR assays to facilitate the identification of A/duck/Laos/XBY004/2014(H5N6) [1] and other closely related H5N6 HPAI viruses that may have zoonotic potential [3]. Primers and probes for HA and NA specific RT-qPCR assays were designed to complement sequences of the A/duck/Laos/XBY004/2014(H5N6) and related viruses. Other HA sequences that belong to the new proposed clade 2.3.4.4 (Table 1) were identified using Basic Local Alignment Search Tool (BLAST) [9] analysis of A/duck/Laos/XBY004/2014(H5N6) against the GenBank nucleotide sequence database (nr/nt) [10]. Subsequently, sequence alignments were performed using Geneious software (Version 7.1.6, Biomatters). Potential primer and probe regions distinctive of proposed clade 2.3.4.4 viruses were identified from these alignments and candidate primers and probes assessed using the Primer Express 3.0.1 program (Applied Biosystems). The clade specific HA probes contained the codon for amino acid substitution 273H that has been identified as one of the distinguishing amino acids for clade 2.3.4.4 viruses [4]. Two candidate probes were designed using black hole quencher 1 (BHQ1) and minor groove binder (MGB) chemistry, respectively. Primer and probe sequences and optimized concentrations of the new and reference assays are listed in Table 2. These assays were developed using thermocycling conditions compatible with the reference avian influenza (AI) type A and the H5 duplex RT-qPCR reference assays [11], (diagnostic manual, CSIRO Australian Animal Health Laboratory, unpublished). Reactions were performed using AgPath-ID One-Step RT-PCR Kit (Ambion - Applied Biosystems) on an AB7500 Fast instrument using the thermal cycle: 1 cycle of 45°C 10 min, 95°C 10 min followed by 45 cycles of 95°C 15 sec, 60°C 45 sec. For interpretation of results samples producing a cycle threshold (CT) less than 40 were considered positive, CT values 40.1 to 45 were considered indeterminate.
Table 1

HPAI H5 proposed clade 2.3.4.4 strains containing different N types

Influenza A virus Subtype Accession
A/wild duck/Shandong/628/2011H5N1JX534565
A/chicken/China/AH/2012H5N1KC631941
A/muscovy duck/Vietnam/LBM631/2014H5N1AB979455
A/muscovy duck/Vietnam/LBM635/2014H5N1AB979487
A/muscovy duck/Vietnam/LBM636/2014H5N1AB979495
A/duck/Vietnam/LBM638/2014H5N1AB979503
A/duck/Eastern China/1111/2011H5N2JQ041401
A/goose/Eastern China/1112/2011H5N2JQ041402
A/duck/Jiangsu/m234/2012H5N2JX507355
A/duck/Guangdong/wy11/2008H5N5CY091627
A/duck/Guangdong/wy19/2008H5N5CY091635
A/environment/Zhenjiang/C13/2013H5N6KJ938658
A/duck/Guangdong/GD01/2014H5N6KJ754145
A/duck/Lao/XBY004/2014H5N6KM496977
A/duck/Jiangsu/k1203/2010H5N8JQ973694
A/duck/Zhejiang/W24/2013H5N8KJ476669
A/duck/Zhejiang/6D18/2013H5N8KJ476670
A/breeder duck/Korea/Gochang1/2014H5N8KJ413834
A/broiler duck/Korea/Buan2/2014H5N8KJ413842
A/baikal teal/Korea/Donglim3/2014H5N8KJ413850
A/chicken/Kumamoto/1-7/2014H5N8AB932556

The influenza A virus, segment 4 hemagglutinin (HA) gene sequences were identified by BLASTn analysis of HA sequence from A/duck/Laos/XBY004/2014(H5N6) (GenBank accession performed on 2nd September, 2014). The listed strains share 100% identity to the target region of probes D-720 PRB and D-724 PRB (MGB) of the proposed H5 clade 2.3.4.4 specific qRT-PCR assays. The H5 strains are sorted by N subtype N1, N2, N5, N6, and N8.

Table 2

Primer and probe oligonucleotides for qRT-PCR assays used in this study

Assay/Oligo Sequence (5′ to 3′) Final conc. (μM)
AI Type A
IVA D161MAGATGAGYCTTCTAACCGAGGTCG0.9
IVA D162M1TGCAAAAACATCYTCAAGTCTCTG0.225
IVA D162M2TGCAAACACATCYTCAAGTCTCTG0.225
IVA D162M3TGCAAAGACATCYTCAAGTCTCTG0.225
IVA D162M4TGCAAATACATCYTCAAGTCTCTG0.225
IVA MA(FAM)-TCAGGCCCCCTCAAAGCCGA-(TAMRA)0.25
H5 duplex
IVA D148H5AAACAGAGAGGAAATAAGTGGAGTAAAATT0.675
IVA D149H5AAAGATAGACCAGCTACCATGATTGC0.675
IVA H5A(FAM)-TCAACAGTGGCGAGTTCCCTAGCA-(TAMRA)0.3
IVA D204fATGGCTCCTCGGRAACCC0.675
IVA D205rTTYTCCACTATGTAAGACCATTCCG0.675
IVA D215P(FAM)-ATGTGTGACGAATTCMT-(MGB-NFQ)0.3
H5 2.3.4.4-BHQ1
D-718 FWDCAAGAAAGGGGACTCAACAATTATG0.3
D-719 REVTGAGAGGGTGTATATTGTGGAATGG0.9
D-720 PRB(FAM)-TTGACATTTGGTGTTGCAGTGGCCATA-(BHQ1)0.25
[TTGACATTTGGTGTTGCAGTGCCCATA*]
H5 2.3.4.4-MGB
D-718 FWDCAAGAAAGGGGACTCAACAATTATG0.3
D-719 REVTGAGAGGGTGTATATTGTGGAATGG0.9
D-724 PRB (MGB)(FAM)-ATGGCCACTGCAAC-(MGB-NFQ)0.25
[ATGGGCACTGCAAC*]
AI N6
D-721 FWDCCCCACCAATGGGAACTG0.9
D-722 REVTCTAGGAATGCAAACCCTTTTACC0.3
D-723 PRB(FAM)-CCAATAACAGGAGGGAGCCCAGACCC-(BHQ1)0.25

*H5N6 2.3.4.4 virus with a single nucleotide mismatch in the TaqMan probe sequences has also been recently detected. Accordingly, to ensure greatest potential future utility additional probe sequences containing the single nucleotide substitution are given in bold.

HPAI H5 proposed clade 2.3.4.4 strains containing different N types The influenza A virus, segment 4 hemagglutinin (HA) gene sequences were identified by BLASTn analysis of HA sequence from A/duck/Laos/XBY004/2014(H5N6) (GenBank accession performed on 2nd September, 2014). The listed strains share 100% identity to the target region of probes D-720 PRB and D-724 PRB (MGB) of the proposed H5 clade 2.3.4.4 specific qRT-PCR assays. The H5 strains are sorted by N subtype N1, N2, N5, N6, and N8. Primer and probe oligonucleotides for qRT-PCR assays used in this study *H5N6 2.3.4.4 virus with a single nucleotide mismatch in the TaqMan probe sequences has also been recently detected. Accordingly, to ensure greatest potential future utility additional probe sequences containing the single nucleotide substitution are given in bold. The assays used in this study were: AI Type A (generic). This is a generic assay targeting the matrix gene to detect influenza A viruses from different animal hosts, including avian, equine and/or other species. This assay is in routine use for AI diagnosis at the CSIRO Australian Animal Health Laboratory and Australian state veterinary diagnostic laboratories. H5 duplex (generic H5). This is a generic assay to detect H5 subtypes, consisting of two sets of primers and probes targeting two different regions (C-terminus and N-terminus) of the H5 HA gene. H5 2.3.4.4-BHQ1 (candidate clade specific). This assay was designed specifically for detection of new proposed HA clade 2.3.4.4 strains and utilizes a BHQ1 probe. H5 2.3.4.4-MGB (candidate clade specific). This assay was designed specifically for detection of new proposed HA clade 2.3.4.4 strains and utilizes a MGB probe. The same primers were used for both H5 2.3.4.4 assays. AI N6. This assay design was based on A/duck/Laos/XBY004/2014(H5N6) to detect Asian lineage N6-NA of novel A(H5N6) viruses, however it is not specific for all N6 viruses. Reaction efficiencies and limit of detection (LOD) of the RT-qPCR assays were determined for the A/duck/Laos/XBY004/2014(H5N6) isolate (5 × 109/ml median embryo infective dose) using a serial 10 fold dilution of template and assays were performed in triplicate. The reaction efficiencies were 80.5, 92.0, 87.0, 91.2 and 86.3% for the AI type A, H5 duplex, H5 2.3.4.6-BHQ1, H5 2.3.4.6-MGB and AI N6, respectively. The LOD for all assays was observed at the 10−7 dilution, equivalent to approximately five median embryo infective doses for the given template and displaying the last positive CT values between 37.9 and 38.5 (data not shown). The capability of the candidate RT-qPCR assays to differentiate proposed clade 2.3.4.4 viruses from other H5 HPAI viruses was evaluated using A/duck/Laos/XBY004/2014(H5N6) as a representative of clade 2.3.4.4 viruses in comparison with other relevant AI reference virus strains (Table 3).
Table 3

Comparison of RT-qPCR assays

Sample description RT-qPCR assays
AI type A (generic) H5 duplex (generic H5) H5 2.3.4.4-BHQ1 H5 2.3.4.4-MGB AI N6
A/shearwater/Australia/75(H5N3) 22.9 25.3 UUU
A/Chicken/Myanmar/295/2010(H5N1); clade 2.3.2.1 20.8 22.8 UUU
A/Duck/VN/2064/13(H5N1); clade 2.3.2.1 19.8 20.8 UUU
A/Swallow/Vietnam/4696/2013(H5N1); clade 2.3.2.1 17.7 19.3 UUU
A/Ch/LaoPDR/LK001/2010(H5N1); clade 2.3.4.1 17.6 21.3 UUU
A/Ch/LaoPDR/LK002/2010(H5N1); clade 2.3.4.1 17.7 21.6 UUU
A/Duck/VN/4804/13(H5N1); clade 1.1 22.7 24.2 28.8 U44.8/U
A/Chicken/Indonesia/Subang/2007(H5N1); clade 2.1.3 23.2 24.6 30.2 UU
A/Chicken/Laos/Xaythani/26/2006(H5N1); clade 2.3.4 24.0 27.4 31.7 UU
A/Avian/Myanmar/182/2010(H5N1); clade 2.3.4.2 20.7 23.5 26.8 U42.3/U
A/duck/Lao/XBY004/2014(H5N6); clade 2.3.4.4 20.8 24.9 22.7 18.2 22.1
A/MALLARD/GURJEV/244/82(H14N6) 21.5 UUU 23.0
A/silver gull/Tasmania/349/2006(H13N6) 27.1 UUUU
A/gull/Maryland/704/1977(H13N6) 15.7 UUU40.2/U
No template (negative control)UUUUU

AI reference assays and candidate clade-specific and N6 assays were compared using selected AI strains.

U = Undetected. Results are displayed as averaged CT values of two replicates. Assay results considered positive are indicated by CT values in bold. Strain A/duck/Lao/XBY004/2014(H5N6) representative of proposed clade 2.3.4.4 is indicated in bold.

Comparison of RT-qPCR assays AI reference assays and candidate clade-specific and N6 assays were compared using selected AI strains. U = Undetected. Results are displayed as averaged CT values of two replicates. Assay results considered positive are indicated by CT values in bold. Strain A/duck/Lao/XBY004/2014(H5N6) representative of proposed clade 2.3.4.4 is indicated in bold. Laos A(H5N6) isolates were detected by the current RT-qPCR AI type A and H5 duplex assays however, only the H5 2.3.4.4-MGB RT-qPCR was able to distinguish these novel A(H5N6) viruses belonging to the proposed clade 2.3.4.4 strain from other AI viruses including A(H5N1). In contrast, the H5 2.3.4.4-BHQ1 RT-qPCR detected A/duck/Laos/XBY004/2014(H5N6) but was not able to differentiate from some other A(H5N1) clades as detailed in Table 3. The AI N6 qRT-PCT assay differentiated the Laos H5N6 subtype virus from H5N1 strains, thus providing useful rapid diagnostic differentiation from A(H5N1) that co-circulate in domestic poultry in the region (Table 3). This evaluation was based on A/duck/Laos/XBY004/2014(H5N6) that was available for testing in our laboratory. However, in silico sequence analysis indicated that other N6 and non-N6 viruses in proposed clade 2.3.4.4 were identical in the sequences of the HA primer and probe target region (Table 1), but distinguished from other A(H5N1) by at least one nucleotide change in the probe region. As experimentally proven in this study, the mismatches in the MGB probe target region were sufficient to provide the required analytical specificity for clade 2.3.4.4 virus differentiation. Accordingly, this sensitive and clade-specific assay will be of particular value for surveillance programs and in diagnostic laboratories where routine DNA sequencing is not readily performed or available.

Availability of supporting data

The data sets supporting the results of this article are included within the article.
  6 in total

1.  Basic local alignment search tool.

Authors:  S F Altschul; W Gish; W Miller; E W Myers; D J Lipman
Journal:  J Mol Biol       Date:  1990-10-05       Impact factor: 5.469

2.  Rapid detection of highly pathogenic avian influenza H5N1 virus by TaqMan reverse transcriptase-polymerase chain reaction.

Authors:  H G Heine; L Trinidad; P Selleck; S Lowther
Journal:  Avian Dis       Date:  2007-03       Impact factor: 1.577

3.  Database resources of the National Center for Biotechnology Information.

Authors:  Eric W Sayers; Tanya Barrett; Dennis A Benson; Evan Bolton; Stephen H Bryant; Kathi Canese; Vyacheslav Chetvernin; Deanna M Church; Michael Dicuccio; Scott Federhen; Michael Feolo; Ian M Fingerman; Lewis Y Geer; Wolfgang Helmberg; Yuri Kapustin; Sergey Krasnov; David Landsman; David J Lipman; Zhiyong Lu; Thomas L Madden; Tom Madej; Donna R Maglott; Aron Marchler-Bauer; Vadim Miller; Ilene Karsch-Mizrachi; James Ostell; Anna Panchenko; Lon Phan; Kim D Pruitt; Gregory D Schuler; Edwin Sequeira; Stephen T Sherry; Martin Shumway; Karl Sirotkin; Douglas Slotta; Alexandre Souvorov; Grigory Starchenko; Tatiana A Tatusova; Lukas Wagner; Yanli Wang; W John Wilbur; Eugene Yaschenko; Jian Ye
Journal:  Nucleic Acids Res       Date:  2011-12-02       Impact factor: 16.971

4.  Reassortant highly pathogenic influenza A(H5N6) virus in Laos.

Authors:  Frank Y K Wong; Phouvong Phommachanh; Wantanee Kalpravidh; Chintana Chanthavisouk; Jeffrey Gilbert; John Bingham; Kelly R Davies; Julie Cooke; Debbie Eagles; Sithong Phiphakhavong; Songhua Shan; Vittoria Stevens; David T Williams; Phachone Bounma; Bounkhouang Khambounheuang; Christopher Morrissy; Bounlom Douangngeun; Subhash Morzaria
Journal:  Emerg Infect Dis       Date:  2015-03       Impact factor: 6.883

5.  Novel reassortant influenza A(H5N8) viruses, South Korea, 2014.

Authors:  Youn-Jeong Lee; Hyun-Mi Kang; Eun-Kyoung Lee; Byung-Min Song; Jipseol Jeong; Yong-Kuk Kwon; Hye-Ryoung Kim; Kyu-Jun Lee; Mi-Seon Hong; Il Jang; Kang-Seuk Choi; Ji-Ye Kim; Hyun-Jeong Lee; Min-Su Kang; Ok-Mi Jeong; Jong-Ho Baek; Yi-Seok Joo; Yong Ho Park; Hee-Soo Lee
Journal:  Emerg Infect Dis       Date:  2014-06       Impact factor: 6.883

6.  Novel variants of clade 2.3.4 highly pathogenic avian influenza A(H5N1) viruses, China.

Authors:  Min Gu; Guo Zhao; Kunkun Zhao; Lei Zhong; Junqing Huang; Hongquan Wan; Xiaoquan Wang; Wenbo Liu; Huimou Liu; Daxin Peng; Xiufan Liu
Journal:  Emerg Infect Dis       Date:  2013-12       Impact factor: 6.883

  6 in total
  15 in total

1.  Redesign and Validation of a Real-Time RT-PCR to Improve Surveillance for Avian Influenza Viruses of the H9 Subtype.

Authors:  Valentina Panzarin; Sabrina Marciano; Andrea Fortin; Irene Brian; Valeria D'Amico; Federica Gobbo; Francesco Bonfante; Elisa Palumbo; Yoshihiro Sakoda; Kien Trung Le; Duc-Huy Chu; Ismaila Shittu; Clement Meseko; Abdoul Malick Haido; Theophilus Odoom; Mame Nahé Diouf; Fidélia Djegui; Mieke Steensels; Calogero Terregino; Isabella Monne
Journal:  Viruses       Date:  2022-06-10       Impact factor: 5.818

2.  Determining highly pathogenic H5 avian influenza clade 2.3.2.1c seroprevalence in ducks, Purbalingga, Central Java, Indonesia.

Authors:  Imas Yuyun; Hendra Wibawa; Gunawan Setiaji; Tri Anggraeni Kusumastuti; Widagdo Sri Nugroho
Journal:  Vet World       Date:  2020-06-18

3.  Development of a duplex TaqMan real-time RT-PCR assay for simultaneous detection of newly emerged H5N6 influenza viruses.

Authors:  Lin Liu; Ying Zhang; Pengfei Cui; Congcong Wang; Xianying Zeng; Guohua Deng; Xiurong Wang
Journal:  Virol J       Date:  2019-10-22       Impact factor: 4.099

4.  A universal RT-qPCR assay for "One Health" detection of influenza A viruses.

Authors:  Alexander Nagy; Lenka Černíková; Kateřina Kunteová; Zuzana Dirbáková; Saumya S Thomas; Marek J Slomka; Ádám Dán; Tünde Varga; Martina Máté; Helena Jiřincová; Ian H Brown
Journal:  PLoS One       Date:  2021-01-20       Impact factor: 3.240

5.  Potential risk factors of avian influenza virus infection in asymptomatic commercial chicken flocks in selected areas of Bangladesh during 2019.

Authors:  Md Zulfekar Ali; Mahmudul Hasan; Md Giasuddin
Journal:  J Adv Vet Anim Res       Date:  2021-03-05

6.  Simultaneous detection of four different neuraminidase types of avian influenza A H5 viruses by multiplex reverse transcription PCR using a GeXP analyser.

Authors:  Meng Li; Zhixun Xie; Zhiqin Xie; Jiabo Liu; Liji Xie; Xianwen Deng; Sisi Luo; Qing Fan; Li Huang; Jiaoling Huang; Yanfang Zhang; Tingting Zeng; Jiaxun Feng
Journal:  Influenza Other Respir Viruses       Date:  2016-03       Impact factor: 4.380

7.  Multiplex one-step Real-time PCR by Taqman-MGB method for rapid detection of pan and H5 subtype avian influenza viruses.

Authors:  Zhujun Zhang; Dong Liu; Wenqiang Sun; Jing Liu; Lihong He; Jiao Hu; Min Gu; Xiaoquan Wang; Xiaowen Liu; Shunlin Hu; Sujuan Chen; Daxin Peng; Xiufan Liu
Journal:  PLoS One       Date:  2017-06-02       Impact factor: 3.240

8.  Prevalence of Avian Influenza A(H5) and A(H9) Viruses in Live Bird Markets, Bangladesh.

Authors:  Younjung Kim; Paritosh K Biswas; Mohammad Giasuddin; Mahmudul Hasan; Rashed Mahmud; Yu-Mei Chang; Steve Essen; Mohammed A Samad; Nicola S Lewis; Ian H Brown; Natalie Moyen; Md Ahasanul Hoque; Nitish C Debnath; Dirk U Pfeiffer; Guillaume Fournié
Journal:  Emerg Infect Dis       Date:  2018-12       Impact factor: 6.883

9.  Highly Pathogenic Avian Influenza A(H5N1) Outbreaks in West Java Indonesia 2015-2016: Clinical Manifestation and Associated Risk Factors.

Authors:  Desniwaty Karo-Karo; Eko Sugeng Pribadi; Fransiscus Xaverius Sudirman; Sussi Widi Kurniasih; Iin Indasari; David Handojo Muljono; Guus Koch; Jan Arend Stegeman
Journal:  Microorganisms       Date:  2019-09-06

10.  Development of a Multiplex RT-qPCR for the Detection of Different Clades of Avian Influenza in Poultry.

Authors:  Tran Bac Le; Hye Kwon Kim; Woonsung Na; Van Phan Le; Min-Suk Song; Daesub Song; Dae Gwin Jeong; Sun-Woo Yoon
Journal:  Viruses       Date:  2020-01-15       Impact factor: 5.048

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.