Literature DB >> 2588000

1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene.

N A Morrison1, J Shine, J C Fragonas, V Verkest, M L McMenemy, J A Eisman.   

Abstract

The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.

Entities:  

Mesh：

Substances：

Year:  1989        PMID： 2588000     DOI： 10.1126/science.2588000

Source DB:  PubMed          Journal:  Science        ISSN： 0036-8075            Impact factor:   47.728


  69 in total

1.  On the mechanism for efficient repression of the interleukin-6 promoter by glucocorticoids: enhancer, TATA box, and RNA start site (Inr motif) occlusion.

Authors:  A Ray; K S LaForge; P B Sehgal
Journal:  Mol Cell Biol       Date:  1990-11       Impact factor: 4.272

2.  p53 and MDM2 are involved in the regulation of osteocalcin gene expression.

Authors:  Hankui Chen; Kevin Kolman; Natalie Lanciloti; Michael Nerney; Emily Hays; Chet Robson; Nalini Chandar
Journal:  Exp Cell Res       Date:  2012-03-03       Impact factor: 3.905

3.  The glucocorticoid receptor binds to a sequence overlapping the TATA box of the human osteocalcin promoter: a potential mechanism for negative regulation.

Authors:  P E Strömstedt; L Poellinger; J A Gustafsson; J Carlstedt-Duke
Journal:  Mol Cell Biol       Date:  1991-06       Impact factor: 4.272

4.  Gene-modified adult stem cells regenerate vertebral bone defect in a rat model.

Authors:  Dmitriy Sheyn; Ilan Kallai; Wafa Tawackoli; Doron Cohn Yakubovich; Anthony Oh; Susan Su; Xiaoyu Da; Amir Lavi; Nadav Kimelman-Bleich; Yoram Zilberman; Ning Li; Hyun Bae; Zulma Gazit; Gadi Pelled; Dan Gazit
Journal:  Mol Pharm       Date:  2011-09-13       Impact factor: 4.939

Review 5.  Glucocorticoid-Induced Osteoporosis.

Authors:  Baruch Frenkel; Wendy White; Jan Tuckermann
Journal:  Adv Exp Med Biol       Date:  2015       Impact factor: 2.622

6.  Vitamin K2 promotes 1alpha,25(OH)2 vitamin D3-induced mineralization in human periosteal osteoblasts.

Authors:  Y Koshihara; K Hoshi; H Ishibashi; M Shiraki
Journal:  Calcif Tissue Int       Date:  1996-12       Impact factor: 4.333

7.  1,25-dihydroxyvitamin D3 modulates growth of vascular smooth muscle cells.

Authors:  T Mitsuhashi; R C Morris; H E Ives
Journal:  J Clin Invest       Date:  1991-06       Impact factor: 14.808

8.  Identification of a 1,25-dihydroxyvitamin D3-response element in the 5'-flanking region of the rat calbindin D-9k gene.

Authors:  H M Darwish; H F DeLuca
Journal:  Proc Natl Acad Sci U S A       Date:  1992-01-15       Impact factor: 11.205

9.  Prolactin blocks nuclear translocation of VDR by regulating its interaction with BRCA1 in osteosarcoma cells.

Authors:  Changhui Deng; Eric Ueda; Kuanhui E Chen; Craig Bula; Anthony W Norman; Richard A Luben; Ameae M Walker
Journal:  Mol Endocrinol       Date:  2008-12-12

10.  Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

Authors:  H M Hoffmann; K M Catron; A J van Wijnen; L R McCabe; J B Lian; G S Stein; J L Stein
Journal:  Proc Natl Acad Sci U S A       Date:  1994-12-20       Impact factor: 11.205
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.