Literature DB >> 25861363

A microarray study of middle cerebral occlusion rat brain with acupuncture intervention.

Chao Zhang1, Yan Wen1, Xiaonong Fan2, Sha Yang3, Guang Tian1, Xueyi Zhou4, Yaqiong Chen3, Zhihong Meng1.   

Abstract

Microarray analysis was used to investigate the changes of gene expression of ischemic stroke and acupuncture intervention in middle cerebral artery occlusion (MCAo) rat brain. Results showed that acupuncture intervention had a remarkable improvement in neural deficit score, cerebral blood flow, and cerebral infarction volume of MCAo rats. Microarray analysis showed that a total of 627 different expression genes were regulated in ischemic stroke. 417 genes were upregulated and 210 genes were downregulated. A total of 361 different expression genes were regulated after acupuncture intervention. Three genes were upregulated and 358 genes were downregulated. The expression of novel genes after acupuncture intervention, including Tph1 and Olr883, was further analyzed by Real-Time Quantitative Polymerase Chain Reaction (RT-PCR). Upregulation of Tph1 and downregulation of Olr883 indicated that the therapeutic effect of acupuncture for ischemic stroke may be closely related to the suppression of poststroke depression and regulation of olfactory transduction. In conclusion, the present study may enrich our understanding of the multiple pathological process of ischemic brain injury and indicate possible mechanisms of acupuncture on ischemic stroke.

Entities:  

Year:  2015        PMID: 25861363      PMCID: PMC4377484          DOI: 10.1155/2015/496932

Source DB:  PubMed          Journal:  Evid Based Complement Alternat Med        ISSN: 1741-427X            Impact factor:   2.629


1. Introduction

Stroke is still a worldwide disease today which causes millions of deaths and more numbers of physical disabilities every year [1, 2]. It is also the leading cause of death and long-term disability in China, where the annual stroke mortality rate is approximately 1.6 million. There are over 7 million stroke survivors in the country with 70% of them being ischemic [3, 4]. The complexity of pathological changes involved in the process of ischemic stroke, worsened by the narrow treatment window (3–6 hs) of rt-PA therapy and the risk of hemorrhage of antiplatelet therapy and anticoagulation therapy [5], has led to the unoptimistic situation of the treatment of ischemic stroke. Sequela syndromes are commonly seen in ischemic stroke patients; thus physical training (PT) and other complementary therapy are increasingly used in ischemic stroke patients. Acupuncture is a traditional Chinese medical therapy which has been proved effective in the treatment of ischemic stroke [6-9]. Researches have found that acupuncture can effectively improve the motor function of ischemic stroke patients [10], possibly due to the improvement of cerebral circulation [11-13], but the underlying biological mechanisms of acupuncture effects are still poorly understood and need to be further explored. Microarray research has been a hot topic since the last decade. Gene-chips provide the means to measure simultaneously where and when thousands of genes are expressed [14]. This technology allows detection and quantification of the differential expression of thousands of genes simultaneously in a single experiment. This technology has helped illuminate mechanisms of disease and identify disease subphenotypes, predict disease progression, assign function to previously unannotated genes, and group genes into functional pathways [15]. Thus, many researches have tried to explore the secret of stroke by using gene-chip technology [16-21] and a lot of biological processes have been found to be related to the pathological injury of ischemic stroke such as inflammation [22], apoptosis [20], and excitotoxicity [23]. So we assume that the effect of acupuncture on ischemic stroke may be acquired from the regulation of these biological processes. In the present study, gene-chip technology was used to analyze the gene expression in ischemic stroke and acupuncture intervention to find out how acupuncture regulates the gene expression of ischemia brain tissues in the model of MCAo rats and thus to reveal possible biological mechanisms of acupuncture on ischemic stroke.

2. Experimental Procedures

2.1. Experimental Groups and MCAo Model

Male Wistar rats weighing 250–300 g, aged 3 months, were selected from the Laboratory Animal Center of People's Liberation Army Academy of Military Medical Sciences, Beijing, China [License no. SCXK-(Army) 2012-0004]. Animals were acclimated to the animal quarters at least for 3 days before the experiment and were provided with a standard laboratory diet and water ad libitum. Animal treatments were performed in a manner to minimize pain or discomfort in accordance with the Guidance Suggestions for the Care and Use of Laboratory Animals, formulated by the Ministry of Science and Technology of China. Rats were randomly divided into 4 groups including model, sham, control, and acupuncture. The minimum number of animals (n = 18) was used for each group. Rats in the model, control, and acupuncture groups were subjected to MCAo surgery. The difference between the model and control groups was that rats in the model group underwent neurological function test, cerebral blood flow detection, and cerebral infarction volume measurement immediately after they recovered from anesthesia while rats in the control group received all these measurement 60 hours later together with the acupuncture group. The experimental protocols were shown in Figure 1. A modified thread ligation method invented by Longa et al. [24] was applied to duplicate the model of middle cerebral artery occlusion. Briefly, rats were fasted for 12 hours with free access to water and anesthetized by intraperitoneal injection of 10% chloral hydrate (350 mg/kg). Rats were then fixed in the dorsal position on the surgery board, neck skin and muscle were incised, and the common carotid artery, the external carotid artery, and the internal carotid artery on the left were isolated. The external carotid artery and the proximal end (near the heart) of the common carotid were ligatured with 0-suture line. A small hole was pierced with a 1 mL syringe needle at the proximal end of the common carotid. A 0.28 mm nylon thread was inserted from the hole into the internal carotid until resistance was met, with an intracranial depth of 18–20 mm. Blood flow in the left middle cerebral artery was blocked by the nylon thread. The nylon thread was then ligatured with the common carotid artery and muscle and skin were sutured. The nylon thread was not applied in rats of sham group. This intraluminal suture model of MCAo produces reliable and permanent focal cerebral ischemia.
Figure 1

Schematic diagram for methodologies: a total of 72 adult male Wistar rats were randomly divided into the sham, model, control, and acupuncture groups. Rats in the model group underwent the measurements of neurological function, cerebral blood flow (CBF), and cerebral infarction volume immediately after they regained consciousness from anesthesia while rats in other groups received the measurements 60 hours later. Six rats were randomly selected from each group for mRNA microarray and RT-PCR test and 12 others for cerebral infarction volume measurement.

2.2. Acupuncture Intervention Methods

To rats in the acupuncture group, Neiguan (PC 6) acupoint on the right forelimb was needled with twisting-rotating method in the frequency of 3 times per second for 60 seconds. According to the Acupoint Location of Commonly Used Experimental Animals in the Experimental Acupuncture Science [25], Neiguan (PC 6) acupoint was located at the forelimb, between the ulna and the radius, about 3 mm from the wrist, perpendicularly needled 2 mm in depth. Sterile disposable stainless steel needles (length: 40 mm, diameter: 0.30 mm; Hwato, Suzhou Medical Supplies Factory Co., Ltd., China) were used in this study. All the acupuncture manipulation was operated by a skilled acupuncturist. Rats were needled for the first time right after they recovered from MCAo surgery and received 5 more times of acupuncture treatment in the subsequent 60 hours, 12 hours once. To the sham and control groups, rats did not receive any acupuncture intervention but were also grabbed six times with the acupuncture group in the experimental period. To the model group, rats did not receive any acupuncture intervention. They received neurobehavioral test and cerebral blood flow (CBF) detection as soon as they recovered from anesthesia and then their brains were immediately collected for cerebral infarction volume measurement and microarray test.

2.3. Neurological Function Test

Neurological function test was performed according to Zausinger's six-point methods [26] once rats recovered from anesthesia. The standards used to obtain Zausinger's six-point score were as follows: score 0, the rat could not spontaneously walk; score 1, the rat rotated towards the side opposite to the lesion with free walking; score 2, the rat rotated towards the side opposite to the lesion when its tail was seized; score 3, the resistance to the lateral pressure was decreased in the side opposite to the lesion; score 4, the rat could not unbend front paws or entire forelimb on the side opposite to the lesion; score 5, the rat had no neurological function defect. Only rats with a score of 1–3 were considered to be successful cerebral ischemia models and rats with a score of 0, 4, or 5 were not used for further experimentation. At 60 hours after modeling, all rats were assessed for another time except for the model group.

2.4. CBF Detection

CBF was measured by laser Doppler flowmetry (DRT4, Moor Instrument, Wilmington, DE, USA). Rats were fixed on a self-made stereotaxic instrument after anesthesia. A midline incision was made on the scalp to expose the anterior fontanel. A small bone window 1 mm posterior to the anterior fontanel and 3 mm left to the midline was produced with a dental drill. The measurement probe was placed on the left cerebral hemisphere to monitor moving red blood cells. CBF was continuously measured for 1 minute for each rat. Rats in the model group were immediately measured after they recovered from anesthesia. Rats in the sham and control groups were measured 60 hours later together with the acupuncture groups.

2.5. Brain Collection and Cerebral Infarction Volume Measurement

After neurological function test and CBF detection, six rats were randomly selected from each group for microarray test and others were conducted for cerebral infarction volume measurement. All rats were euthanized with chloral hydrate and their brains were collected quickly. As to the rats for microarray test, their left hemispheres were separated and kept at a temperature of −80°C for mRNA extraction later. To other rats, their brains were placed at a temperature of −20°C for 30 minutes and each then was cut into 5 coronal sections each 3 mm thick and stained with a 2% solution of 2,3,5-triphenyltetrazolium chloride (TTC) in phosphate buffered saline (PBS) at a temperature of 37°C for 20 min, followed by 4% paraformaldehyde buffer for fixation. The stained sections were photographed by Olympus fe-240 digital camera (Pooher Photoelectric Technology Co., Ltd., Shanghai, China) and the digital images were analyzed by a computer-assisted image system with Image-Pro Plus 6.0 (Rockville, MD, USA). The infarction volume was presented as a percentage of the total ipsilateral hemispheric volume which can be calculated by following equation: [(the volume of the intact contralateral hemisphere) – (the volume of the intact ipsilateral hemisphere – the volume of infarcted tissue in the ipsilateral hemisphere)]/(the volume of the intact contralateral hemisphere) × 100%. This rectified measurement equation corrects for edema in the total infarct volume.

2.6. RNA Extraction

Total RNA was extracted from ipsilateral hemispheres of MCAo rats and the corresponding hemispheres of sham rats with TRIZOL Reagent (GibcoBRL, Rockville, MD) according to manufacturers' protocol and its quality was measured by NANODROP 2000 spectrophotometer (Thermo Scientific, USA) and 2100 Bioanalyzer (Agilent Technologies, Inc., USA). The total RNA was then purified with Qiagen RNeasy Mini Kit (Qiagen Inc., USA) and quantified by spectrophotometer and stored at −80°C for microarray analysis and Real-Time Quantitative Polymerase Chain Reaction (RT-PCR) studies.

2.7. Microarray Analysis

An equal amount of total RNA (100 ng) was used for the synthesis of cDNA and then cDNA was cleaned and used for cy3CTP, cy5CTP-labeled cRNA synthesis with T7 RNA polymerase. The labeled and fragmented cRNA was then hybridized to Agilent G4853A Gene-Chip (Agilent Technologies, Inc., USA) which contains 30,003 functional genes for 17 hours with required antisense controls. The microarray chips were then washed and scanned using Agilent Scan Control software (Agilent Technologies, Inc., USA) and data was analyzed by Agilent GeneSpring software GX10.05 (Agilent Technologies, Inc., USA). Differentially expressed genes were selected based on P value <0.05 and log⁡2⁡ (Fold Change) ≥ 1 or log⁡2⁡ (Fold Change) ≤ −1.

2.8. KEGG Pathway Analyses for mRNAs

The Kyoto Encyclopedia of Genes and Genomes (KEGG) is a knowledge base for systematic analysis of gene functions, linking genomic information with higher order function information. KEGG pathway database is supplemented by a set of ortholog group tables for the information about conserved subpathways (pathway motifs), which are often encoded by positionally coupled genes on the chromosome and are especially useful in predicting gene functions [27]. Differently expressed genes were used for KEGG pathway analysis between groups (model versus sham, control versus acupuncture). Hypergeometric Distribution method was applied to calculate the P value of each pathway and then rectified by false discovery rate (FDR) method. Possibility values of <0.05 were considered statistically significant.

2.9. Real-Time Quantitative Polymerase Chain Reaction Validation

Real-Time Quantitative Polymerase Chain Reaction (RT-PCR) was carried out for mRNA validation according to manufacturer's protocols using mRNA specific primers from Applied Biosystems (USA). Two genes, that is, Tph1 and Olr883, were chosen from all the differentially expressed genes. The complementary DNAs were synthesized by Shanghai Science & Technical Co. (Shanghai, China). All samples were normalized by Rattus norvegicus actin. The information about primers used for RT-PCR was shown in Table 1. Each sample was tested in triplicate. Relative gene expression was measured by 2−ΔΔCT method [28].
Table 1

Primer names, sequences, and PCR conditions used for RT-PCR analysis.

GeneNCBI reference sequencePrimer sequenceTm (°C)Amplicon size (bp)
Tph1 NM_001100634.25′GGCTTTGAGGTCCTCTTTCCA3′56112
5′CCCCCTTTCTGAGGAATGGTC3′

Olr883 NM_001001358.15′GCAGGCCACTGCACTATTTG3′56123
5′ACTGCAGATTTAGGCCGAGG3′

Actin NM_031144.35′CAGCCTTCCTTCCTGGGTATG3′55247
5′TAGAGCCACCAATCCACACAG3′

2.10. Statistical Analysis

All data in our study were analyzed by SPSS 16.0 software and presented as mean ± SD except for microarray analysis. One-way analysis of variance (ANOVA) followed by the least significant difference (LSD) was used for analyzing the data. The standard statistical function of Hypergeometric Distribution, t-test, and FDR was performed for determined genes differently expressed in microarray analysis and KEGG pathways. Possibility values of <0.05 were considered statistically significant.

3. Results

3.1. Acupuncture Improved Neurological Function of MCAo Rats

Compared with the sham group, neurological deficit scores significantly decreased in the model group (P < 0.05) but improved after 60 hours in the acupuncture group (P < 0.05). No significant difference was seen between the model and control groups (P > 0.05) while the acupuncture group had an apparent improvement compared with the control group (P < 0.05) (see Figure 2).
Figure 2

Effects of acupuncture on neurological deficit scores in MCAo rats: values are mean ± SD (n = 18) and * P < 0.05 compared with the model group, # P < 0.05 compared with the control group.

3.2. Acupuncture Increased Cerebral Blood Flow (CBF) of MCAo Rats

CBF was significantly reduced in the model control group compared with the sham group (P < 0.05) and increased after 60 hours in the acupuncture group (P < 0.05). No significant difference was seen between the model and control groups (P > 0.05) while the acupuncture group had an apparent increase compared with the control group (P < 0.05) (see Figure 3).
Figure 3

Effects of acupuncture on CBF in MCAo rats: values are mean ± SD (n = 18) and * P < 0.05 compared with the model group, # P < 0.05 compared with the control group.

3.3. Acupuncture Reduced Cerebral Infarction Volume of MCAo Rats

Compared with the sham group (zero), clear cerebral infarction volume was seen in the model group (P < 0.05) and reduced in the acupuncture group (P < 0.05). No significant difference was seen between the model and control groups (P > 0.05) (see Figure 4).
Figure 4

Effects of acupuncture on infarction volume. (a) Representative coronal sections of rat brains stained by TTC from four groups. The white area is infarct region and red is normal tissue. (b) Quantitative analysis of infarction volume. Values are mean ± SD (n = 12) and * P < 0.05 compared with the model group, # P < 0.05 compared with the control group.

3.4. Changes in mRNA Expression and Pathways Involved in the Process of Ischemic Stroke

A total of 627 different expression genes were regulated during the process of ischemic stroke. 417 genes were upregulated and 210 genes were downregulated. Among the upregulated genes, Hspa1b, Ccl2, Cxcl2, Ccl3, Serpina3n, Timp1, H19, Hspb1, Ccl20, and Cxcl1 were found to demonstrate significant upregulation in pathological phase of ischemic stroke (see Table 2). 58 pathways were examined for upregulated mRNAs in this study including the regulation of Staphylococcus aureus infection, phagosome, cell adhesion molecules, cytokine-cytokine receptor interaction, hematopoietic cell lineage, Toll-like receptor signaling pathway, natural killer cell mediated cytotoxicity MAPK signaling pathway, p53 signaling pathway, VEGF signaling pathway, and TGF-beta signaling pathway (see Table 3).
Table 2

The top 10 upregulated genes of the model group versus the sham group.

Gene symbolGene descriptionlog2⁡(FC) P value P.adjust
Hspa1b Heat shock 70 kD protein 1B (mapped)6.915243.64E − 073.96E − 04
Ccl2 Chemokine (C-C motif) ligand 26.858261.72E − 061.16E − 03
Cxcl2 Chemokine (C-X-C motif) ligand 26.375627.87E − 057.37E − 03
Ccl3 Chemokine (C-C motif) ligand 35.671077.19E − 062.43E − 03
Serpina3n Serine (or cysteine) peptidase inhibitor, clade A, member 3N5.610582.11E − 054.16E − 03
Timp1 TIMP metallopeptidase inhibitor 15.601947.64E − 057.34E − 03
H19 H19, imprinted maternally expressed transcript (nonprotein coding)5.438094.25E − 061.80E − 03
Hspb1 Heat shock protein 15.415041.15E − 085.62E − 05
Ccl20 Chemokine (C-C motif) ligand 205.200953.47E − 041.51E − 02
Cxcl1 Chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)5.175904.94E − 061.91E − 03
Table 3

The enriched pathways of the up-regulated genes of the model group versus the sham group.

KEGG IDDescription P valueGene name
5144Malaria6.08E − 14 Selp; Il6; Ccl12; Il1b; Cd36; Tnf; Tlr2; RGD1565355; Tgfb1; Itgb2; Thbs4; Icam1; Cd40; Sele; Myd88; Sdc1
5140Leishmaniasis1.15574E − 13 Ncf4; Il1b; Jun; Fcgr3a; Tnf; Tlr2; Ptpn6; Fcgr1a; Fos;  Ptgs2; Tgfb1; Itgam; Itgb2; RT1-DMa; Nfkbia; Myd88; LOC498276
5150 Staphylococcusaureus infection1.70375E − 12 Selp; C1qc; Fcgr3a; C1s; C3ar1; Fcgr1a; Itgam; Fcgr2b; Itgb2; RT1-DMa; C5ar1; Icam1; LOC498276; C1qb
5323Rheumatoid arthritis5.37292E − 11 Il6; Ccl12; Il1b; Jun; Tnf; Tlr2; Csf1; Cd86; Fos; Ccl20; Tgfb1; Itgb2; RT1-DMa; Icam1; Ccl3; Il11
4380Osteoclast differentiation5.73512E − 11 Ncf4; Il1b; Jun; Fcgr3a; Tyrobp; Tnf; Lcp2; Spi1; Csf1; Fcgr1a; Fos; Nfkb2; Tgfb1; Fcgr2b; Fosl1; Nfkbia; Socs3; Tnfrsf1a; LOC498276
4145Phagosome1.7585E − 10 Msr1; RT1-EC2; Ncf4; Fcgr3a; Cd36; RT1-A2; RT1-A1; Tap1; Tlr2; RGD1565355; Fcgr1a; Tubb6; Itga5; Cd14; Itgam; Fcgr2b; Itgb2; RT1-CE5; RT1-DMa; Thbs4; Olr1; RT1-CE2; LOC498276
4514Cell adhesion molecules (CAMs)2.37222E − 10 Ptprc; RT1-EC2; Selp; RT1-A2; RT1-A1; Cldn14; Cldn23; Cd86; Esam; Itgam; PVR; Itgb2; RT1-CE5; RT1-DMa; Cd274; Icam1; Cd40; Sele; RT1-CE2; Sdc1; Glycam1
4060Cytokine-cytokine receptor interaction1.65905E − 09 Il6; Ccl12; Il1b; Cxcl16; Tnf; Ccl4; Clcf1; Csf1; Cxcl2; Il1r2; Cxcl10; Tnfrsf12a; Tnfrsf1b; Ccl20; Il4ra; Tgfb1; Ltbr; Il13ra1; Cd40; Tnfrsf1a; Ccl3; Il11; Csf2rb
4640Hematopoietic cell lineage2.81713E − 09 Il6; Il1b; Cd36; Tnf; Csf1; RGD1565355; Fcgr1a; Itga5; Il1r2; Cd14; Il4ra; Itgam; Cd44; Il11
4620Toll-like receptor signaling pathway3.71149E − 09 Il6; Il1b; Jun; Tnf; Tlr2; Cd86; Cxcl10; Cd14; Fos; Lbp; Cd40; Nfkbia; Ccl3; Myd88; Spp1
4610Complement and coagulation cascades3.91282E − 09 Serpine1; C1qc; Fga; Kng1; Plaur; C1s; C3ar1; Serping1; A2m; C6; C5ar1; F10; C1qb
5142Chagas disease (American trypanosomiasis)1.28382E − 08 Serpine1; C1qc; Il6; Ccl12; Il1b; Jun; Tnf; Tlr2; Fos; Tgfb1; Nfkbia; Tnfrsf1a; Ccl3; Myd88; C1qb
4062Chemokine signaling pathway7.78649E − 08 Ccl2; Hck; Ccl6; Ccl7; Ccl12; Shc1; Cxcl16; Cxcl1; Ccl4; Cxcl2; Adcy4; Cxcl10; Fgr; Rac2; Ccl20; Stat3; Nfkbia; Ccl3; Jak3
5332Graft-versus-host disease5.76242E − 07 RT1-EC2; Il6; Il1b; RT1-A2; RT1-A1; Tnf; Cd86; RT1-CE5; RT1-DMa; RT1-CE2
4612Antigen processing and presentation1.07678E − 06 RT1-EC2; RT1-A2; RT1-A1; Tap1; Tnf; Ifi30; Hspa2; Lgmn; Hspa1b; RT1-CE5; RT1-DMa; RT1-CE2
4010MAPK signaling pathway1.18683E − 06 Gadd45g; Myc; Il1b; Hspb1; Jun; Flna; Tnf; Flnc; Gadd45b; Fgf2; Hspa2; Il1r2; Cd14; Rac2; Fos; Map3k6; Nfkb2; Tgfb1; Gadd45a; Hspa1b; Tnfrsf1a; Dusp5
4621NOD-like receptor signaling pathway1.44958E − 06 Il6; Ccl12; Il1b; Cxcl1; Tnf; Birc3; Cxcl2; Pycard; Nfkbia
5146Amoebiasis2.86186E − 06 Il6; Il1b; Hspb1; Tnf; Tlr2; Col4a1; Il1r2; Cd14; Col4a2; Tgfb1; Itgam; Itgb2
4512ECM-receptor interaction5.01276E − 06 Cd36; Tnc; RGD1565355; Col4a1; Itga5; Col4a2; Thbs4; Cd44; Sdc1; Spp1
5330Allograft rejection6.43761E − 06 RT1-EC2; RT1-A2; RT1-A1; Tnf; Cd86; RT1-CE5; RT1-DMa; Cd40; RT1-CE2
4920Adipocytokine signaling pathway1.72078E − 05 Cd36; Tnf; RGD1565355; Tnfrsf1b; Prkab2; Stat3; Nfkbia; Socs3; Tnfrsf1a
4940Type I diabetes mellitus1.72078E − 05 RT1-EC2; Il1b; RT1-A2; RT1-A1; Tnf; Cd86; RT1-CE5; RT1-DMa; RT1-CE2
5416Viral myocarditis1.7893E − 05 RT1-EC2; RT1-A2; RT1-A1; Cd86; Rac2; Itgb2; RT1-CE5; RT1-DMa; Icam1; Cd40; RT1-CE2
4623Cytosolic DNA-sensing pathway4.3625E − 05 Il6; Il1b; Ripk3; Ccl4; Cxcl10; Pycard; Nfkbia
5143African trypanosomiasis4.73199E − 05 Il6; Il1b; Tnf; Icam1; Sele; Myd88
5145Toxoplasmosis5.71133E − 05 Tnf; Tlr2; Birc3; Hspa2; Tgfb1; Stat3; Hspa1b; RT1-DMa; Cd40; Nfkbia; Tnfrsf1a; Myd88
5322Systemic lupus erythematosus7.24914E − 05 C1qc; Fcgr3a; Tnf; C1s; Cd86; Fcgr1a; Fcgr2b; RT1-DMa; C6; Cd40; LOC498276; C1qb
4670Leukocyte transendothelial migration7.3107E − 05 Ncf4; Mmp9; Cldn14; Msn; Cldn23; Esam; RGD1309537; Rac2; Itgam; Itgb2; Icam1
4650Natural killer cell mediated cytotoxicity0.000108813 Fcgr3a; Shc1; Tyrobp; Tnf; Lcp2; Ptpn6; Rac2; Itgb2; Icam1; Fcer1g
5320Autoimmune thyroid disease0.000149638 RT1-EC2; RT1-A2; RT1-A1; Cd86; RT1-CE5; RT1-DMa; Cd40; RT1-CE2
4672Intestinal immune network for IgA production0.000155052 Il6; Cd86; Tgfb1; RT1-DMa; Ltbr; Cd40
5310Asthma0.000428565 Tnf; RT1-DMa; Cd40; Fcer1g
5020Parkinson's disease0.000474519 C1qc; Il6; Il1b; C6; C1qb
4510Focal adhesion0.000611017 Jun; Flna; Shc1; Tnc; Birc3; Col4a1; Flnc; Itga5; RGD1309537; Rac2; Col4a2; Thbs4; Spp1
4630Jak-STAT signaling pathway0.000690892 Myc; Il6; Ptpn6; Clcf1; Il4ra; Stat3; Il13ra1; Socs3; Il11; Csf2rb; Jak3
4666Fc gamma R-mediated phagocytosis0.001026538 Ptprc; Hck; Fcgr1a; Arpc1b; Sphk1; Rac2; Fcgr2b; LOC498276
4115p53 signaling pathway0.001031142 Gadd45g; Serpine1; Igfbp3; Gadd45b; RGD1566319; Gadd45a; LOC298795
5200Pathways in cancer0.001310312 Ret; Myc; Il6; Jun; Mmp9; Runx1; Spi1; Birc3; Col4a1; Fgf2; Rac2; Fos; Col4a2; Ptgs2; Nfkb2; Tgfb1; Stat3; Nfkbia
5410Hypertrophic cardiomyopathy (HCM)0.001575221 Il6; Tnf; Tpm4; Itga5; Des; Prkab2; Tgfb1
5340Primary immunodeficiency0.002241893 Ptprc; Tap1; Cd40; Jak3
5221Acute myeloid leukemia0.003919315 Myc; Runx1; Eif4ebp1; Spi1; Stat3
4210Apoptosis0.004080222 Il1b; Tnf; Birc3; Nfkbia; Tnfrsf1a; Myd88; Csf2rb
4662B cell receptor signaling pathway0.004536991 Jun; Ptpn6; Rac2; Fos; Fcgr2b; Nfkbia
4110Cell cycle0.007661902 Gadd45g; Myc; Mcm3; Gadd45b; Tgfb1; Gadd45a; LOC298795; Mcm6
4622RIG-I-like receptor signaling pathway0.008260836 Rnf125; Tnf; Cxcl10; Trim25; Nfkbia
5222Small cell lung cancer0.008411479 Myc; Birc3; Col4a1; Col4a2; Ptgs2; Nfkbia
5160Hepatitis C0.00890146 Irf1; Cldn14; Tnf; Cldn23; Stat3; Nfkbia; Socs3; Tnfrsf1a
4660T cell receptor signaling pathway0.010477739 Ptprc; Jun; Tnf; Lcp2; Ptpn6; Fos; Nfkbia
5414Dilated cardiomyopathy0.010752535 Tnf; Tpm4; Adcy4; Itga5; Des; Tgfb1
5210Colorectal cancer0.011794184 Myc; Jun; Rac2; Fos; Tgfb1
5220Chronic myeloid leukemia0.015301029 Myc; Shc1; Runx1; Tgfb1; Nfkbia
4370VEGF signaling pathway0.017300772 Nos3; Hspb1; Sphk1; Rac2; Ptgs2
4144Endocytosis0.025647683 RT1-EC2; Ret; Ehd2; RT1-A2; RT1-A1; Hspa2; Dab2; Tgfb1; Hspa1b; RT1-CE5; RT1-CE2
4350TGF-beta signaling pathway0.030013655 Myc; Tnf; Bmp7; Tgfb1; Thbs4
4012ErbB signaling pathway0.030013655 Myc; Jun; Shc1; Eif4ebp1; Hbegf
4141Protein processing in endoplasmic reticulum0.038063498 Hspa2; Dnaja1; Hspa1b; Cryaa; Cryab; Hsph1; Sec24a; Ppp1r15a
4930Type II diabetes mellitus0.045976221 Tnf; Hk2; Socs3
5100Bacterial invasion of epithelial cells0.046356305 Shc1; Arpc1b; Itga5; Hcls1
Among the downregulated genes, Gpr88, Rgs9, Enthd1, Olr59, P2ry12, Degs2, Pde10a, Neu2, Adora2a, and Slc22a6 were found to demonstrate significant downregulation in pathological phase of ischemic stroke (see Table 4). 19 pathways of downregulated mRNAs were examined including the regulation of calcium signaling pathway, gastric acid secretion, salivary secretion, axon guidance, hypertrophic cardiomyopathy, neuroactive ligand-receptor interaction, long-term depression, axon guidance, pancreatic secretion, and sphingolipid metabolism (see Table 5).
Table 4

The top 10 downregulated genes of the model group versus the sham group.

Gene symbolGene descriptionlog2⁡(FC) P value P.adjust
Gpr88 G-protein coupled receptor 88−2.249070.001630.02984
Rgs9 Regulator of G-protein signaling 9−2.170740.000350.01507
Enthd1 ENTH domain containing 1−1.957210.000050.00606
Olr59 Olfactory receptor 59−1.907290.002380.03558
P2ry12 Purinergic receptor P2Y, G-protein coupled, 12−1.854410.001160.02520
Degs2 Delta(4)-desaturase, sphingolipid 2−1.850940.001980.03247
Pde10a Phosphodiesterase 10A−1.783730.000000.00012
Neu2 Sialidase 2 (cytosolic sialidase)−1.782450.001700.03040
Adora2a Adenosine A2a receptor−1.762370.000030.00478
Slc22a6 Solute carrier family 22 (organic anion transporter), member 6−1.748660.000020.00416
Table 5

The enriched pathways of the downregulated genes of the model group versus the sham group.

KEGG IDDescription P valueGene name
4260Cardiac muscle contraction1.19216E − 07 Tnnt2; Myh7; Myh6; Atp1a1; Atp1a2; Tnni3; Cox8b; Cacng3
4020Calcium signaling pathway2.71115E − 07 Plcb1; Cckbr; Drd1a; Tacr3; Slc8a2; Camk4; Adra1d; Atp2b2; Itpr1; Pde1b; Adora2a
4971Gastric acid secretion8.46439E − 06 Plcb1; Cckbr; Kcnk2; Atp1a1; Atp1a2; Itpr1
4970Salivary secretion1.20354E − 05 Plcb1; Adra1d; Atp2b2; Atp1a1; Atp1a2; Itpr1
5410Hypertrophic cardiomyopathy (HCM)1.42423E − 05 Tnnt2; Itgb6; Myh7; Myh6; Tnni3; Cacng3
4080Neuroactive ligand-receptor interaction2.28164E − 05 Cckbr; Drd2; Drd1a; Grm3; Tacr3; Adra1d; Chrm4; Gria3; Htr1d; Adora2a; Adora3
5414Dilated cardiomyopathy2.66995E − 05 Tnnt2; Itgb6; Myh7; Myh6; Tnni3; Cacng3
4360Axon guidance0.000275226 Cxcl12; Ephb3; Robo2; Ngef; Lrrc4c; Epha4
4972Pancreatic secretion0.000605555 Plcb1; Atp2b2; Atp1a1; Atp1a2; Itpr1
600Sphingolipid metabolism0.000811033 Smpd3; Degs2; Neu2
4976Bile secretion0.000867651 Slc22a8; Slco1a2; Atp1a1; Atp1a2
4974Protein digestion and absorption0.001102164 Slc8a2; Col11a2; Atp1a1; Atp1a2
4270Vascular smooth muscle contraction0.001284378 Plcb1; Ramp1; Adra1d; Itpr1; Adora2a
4540Gap junction0.001989051 Plcb1; Drd2; Drd1a; Itpr1
4720Long-term potentiation0.005104314 Plcb1; Camk4; Itpr1
4730Long-term depression0.005650817 Plcb1; Itpr1; Gria3
4070Phosphatidylinositol signaling system0.007185071 Plcb1; Dgkb; Itpr1
4062Chemokine signaling pathway0.009027556 Cxcl12; Plcb1; Rasgrp2; Gng7; Cx3cl1
4530Tight junction0.045528155 Cldn10; Myh7; Myh6

3.5. Changes in mRNA Expression and Pathways Involved in Acupuncture Intervention

A total of 361 different expression genes were regulated during the process of acupuncture intervention. Three genes were upregulated and 358 genes were downregulated. The three upregulated genes were Tph1, Loc684158, and Ccdc19 (see Table 6). No pathway was found among the 3 upregulated mRNAs, so pathway annotation was adopted and two pathways were involved, that is, tryptophan metabolism and metabolism (see Table 7).
Table 6

The upregulated genes of the acupuncture group versus the control group.

Gene symbolGene descriptionlog2⁡(FC) P value P.adjust
Tph1 Tryptophan hydroxylase 13.711890.046270.43944
Loc684158 Similar to chromosome 1 open reading frame 361.443770.008920.43944
Ccdc19 Coiled-coil domain containing 191.015080.036120.43944
Table 7

Pathway annotation of the upregulated genes of the acupuncture group versus the control group.

Gene IDGene nameKEGG IDKEGG pathways
24848 Tph1 380Tryptophan metabolism
24848 Tph1 1100Metabolism
Among the downregulated genes, Gpr88, Rgs9, Enthd1, Olr59, P2ry12, Degs2, Pde10a, Neu2, Adora2a, and Slc22a6 were found to demonstrate significant downregulation in pathological phase of ischemic stroke (see Table 8). The pathway of acupuncture intervention for downregulated mRNAs examined in this study is olfactory transduction (see Table 9).
Table 8

The top 10 downregulated genes of the acupuncture group versus the control group.

Gene symbolGene descriptionlog2⁡(FC) P value P.adjust
Slpil3 Antileukoproteinase-like 3−7.314390.015330.43944
Cyp2c6v1 Cytochrome P450, family 2, subfamily C, polypeptide 6, variant 1−7.223490.025090.43944
Dmrt2 Doublesex and mab-3 related transcription factor 2−7.006990.032100.43944
Rgd1565502 Rgd1565502 −7.000100.024720.43944
Olr1376 Olfactory receptor 1376−6.875250.027250.43944
Loc680428 Hypothetical protein Loc680428 −6.846980.021020.43944
Rgd1559709 Similar to F-box protein 47−6.599860.030600.43944
Olr883 Olfactory receptor 883−6.505280.036260.43944
Loc683282 Similar to developmental pluripotency-associated 2−6.476400.035460.43944
Olr469 Olfactory receptor 469−6.443180.023940.43944
Table 9

The enriched pathways of the downregulated genes of the acupuncture group versus the control group.

KEGG IDDescription P valueGene name
4740Olfactory transduction0 Olr851; Olr1029; Olr883; Olr1507; Olr377; Olr1641; Olr259; Olr1652; Olr722; Olr690; Olr1455; Olr1670; Olr807; Olr1616; Olr419; Olr1384; Olr1240; Olr1204; Olr424; Olr415; Olr404; Olr1535; Olr606; Olr1146; Olr1643; Olr447; Olr469; Olr502; Olr1394; Olr1529; Olr1530; Olr135; Olr344; Olr731; Olr639; Olr1314; Olr1311; Olr610; Olr607; Olr1326; Olr575; Olr1365; Olr1376; Olr1549; Olr1588; Olr1600; Olr20; Olr85; Olr80; Olr47; Olr219; Olr171; Olr170; Olr180; Olr121; Olr886; Olr1482; Olr1749; Olr1714; Olr533; Olr695; Olr737; Olr1060; Olr1389; Olr750; Olr758; Olr792

3.6. Verification of Gene Expression By RT-PCR

RT-PCR results of Tph1 and Olr883 showed that directional changes of mRNA levels were in agreement with microarray analysis results. mRNA expression of Tph1 was reduced in the model group and increased in the acupuncture group (P < 0.05). No difference was seen between the control and model groups (P > 0.05) (see Figure 5(a)). mRNA expression of Olr883 was increased in the model group and reduced in the acupuncture group (P < 0.05). No difference was seen between the control and model groups (P > 0.05) (see Figure 5(b)).
Figure 5

Analysis of mRNA expression of Tph1 and Olr883 by RT-PCR. (a) mRNA expression of Tph1 in the sham, model, control, and acupuncture groups. (b) mRNA expression of Olr883 in the sham, model, control, and acupuncture groups. Values are mean ± SD (n = 6) and * P < 0.05 compared with the model group, # P < 0.05 compared with the control group.

4. Discussion

To better understand the mechanisms of the therapeutic effect of acupuncture on ischemic stroke, we used microarray analysis in rat brain to examine the genomic response to ischemic stroke and acupuncture intervention. To the best of our knowledge, this is the first report using an mRNA microarray to survey global differential gene expression after manual acupuncture treatment in ischemic stroke animal models. The microarray analysis performed during the period of ischemic stroke confirmed the bidirectional expressions of many genes. The gene expression of ischaemic stroke is characterised by differential expressions of a great number of genes involved in inflammation, apoptosis, protein turnover, transcription, signal transduction, ion-channel regulation, and metabolism which suggests that ischemic stroke is a multiple pathological process and it can trigger a multifaceted cascade of physiologic and biochemical events. These events are mediated in part by alterations of molecular transcriptional and translational activities. Our microarray findings are in accordance with previous studies of individual genes and pathways proposed to be associated with ischaemic brain injury [29, 30]. Most of the differential genes were upregulated including heat shock protein (Hsp) genes and chemokine ligand genes. The upregulation of Hsp 70 genes such as Hspa1b and Hspa1 after ischemic stroke in the present study is consistent with other studies [29, 31]. As we all know, apoptosis-related genes are induced after focal ischemia, and they may contribute to cell death in the core and the selective cell death adjacent to an infarct [32], whereas heat shock proteins have been shown to play an important protective role in vivo as they have the ability to protect cultured cells from apoptosis and thus to protect brain against ischaemia [33]. Similar to heat shock proteins, an increase in mRNA expression of chemokines (Ccl2, Ccl3, Cxcl2, and Ccl20) was observed in the present study and this result is also consistent with other studies [31, 34]. Members of the CC and CXC chemokines are induced in the rat brain after focal cerebral ischemia and they are believed to contribute to secondary neuronal damage [29] through modulating crucial processes such as inflammatory cell recruitment and activation, neuronal survival, and neoangiogenesis. On the other hand, CXC (Cxcl2, Cxcl3) chemokines could also modulate stem cell homing, thus favouring tissue repair [35]. Therefore chemokine receptors were potential targets for therapeutic intervention in stroke [36]. Upregulated chemokines in the ischemic brain may reduce inflammatory cell migration to the brain in early stroke. Inhibition of inflammatory cell accumulation in the brain at the early stage of stroke may lead to amelioration of ischemic neurodegeneration [37, 38]. Compared with upregulated genes of ischemic stroke, information on downregulated genes seems relatively limited. Among the genes that were downregulated, G-protein genes were found to be closely related to ischemic injury. The signal transduction system mediated by G-protein is the most common way of signaling in cells. According to our microarray results, G-protein genes such as Gpr88 and Rgs9 were downregulated. Gpr88 may play a role in the fundamental functions of striatum such as the control of motor behavior [39]. A recent study reported that, in Gpr88 knockout mice, basal extracellular dopamine levels in the striatum were lower, while amphetamine-induced dopamine release was normal, and these mice also displayed increased apomorphine-induced stereotypy and amphetamine-stimulated locomotor activity [40]. These results suggest that Gpr88 plays a role in the regulation of dopamine signaling in the striatum and it may be a new target for treatments for psychiatric disorders after ischemic stroke. The Rgs9 gene gives rise to two splice forms Rgs9-1 and Rgs9-2. Rgs9-1 is expressed exclusively in retina, while Rgs9-2 is highly enriched in striatal regions of the brain. Rgs9 plays a role in striatal dopamine-mediated behavior [41] and has been shown to be a critical negative regulator of opiate action in vivo [42]. Rgs9 knockout rats exhibit normal locomotor activity, anxiety-like behavior, cued and contextual fear conditioning, startle threshold, and prepulse inhibition which suggest that Rgs9-2 is a potential therapeutic target for disorders involving motor or cognitive dysfunction [43]. Among all the different expression genes in the process of ischemic stroke, some may aggravate the obstruction of blood flow, death of ischemic neurons, and dysfunction of subsequent neurological behavior that had led to the early and ultimate pathological injury of ischemic stroke and some may play an important protective role as the spontaneous anti-injury response in the pathological process of ischemic stroke. The microarray results also showed that ischemic stroke had a widespread influence on the whole body rather than a specific change in the brain; therefore therapeutic strategy aiming at the remedy of single pathological change might not obtain optimistic result. According to previous researches, spontaneous recovery plays an important role in the pathological process of ischemic stroke [44]. In the present study, we observed the spontaneous recovery in 60 hours after modeling in MCAo rats; however, results did not show any sound outcomes. On the other hand, acupuncture intervention could effectively improve the neurological function and CBF and reduce the infarction volume of MCAo rats (see Figures 2, 3, and 4). Different patterns of gene expression occurred in the control and acupuncture groups. Our microarray analysis showed that most gene expression levels were downregulated following acupuncture treatment which suggests that the therapeutic effect of acupuncture on ischemic stroke may mainly depend on strategies to suppress the pathological progress of ischemic stroke instead of facilitating the repair of ischemic stroke injury. KEGG pathway analysis showed that the only pathway of the downregulated genes was olfactory transduction. Olfactory ensheathing cells (OECs) express adhesion molecules on their plasma membranes to help neural cells attach, and they also secrete a variety of trophic factors to facilitate neural regeneration and axon outgrowth. Intracerebral transplantation of OECs/olfactory nerve fibroblasts (ONFs), which secrete trophic factors including stromal cell-derived factor-1a (SDF-1a), effectively leads to the recovery of the damaged cerebral tissue in murine models of stroke, thereby promoting the reversal of neurological deficit [45]. Transplantation of OECs has been shown to protect the white matter from ischemic injury [46], leading to improving neurological function in rats. Although there is relatively limited research of olfactory transduction in ischemia stroke, our result suggests that olfactory transduction might play an important role in ischemic stroke recovery and the therapeutic effect of acupuncture on ischemic stroke is closely related to the regulation of olfactory transduction. Three genes were found upregulated after acupuncture intervention including Tph1, Loc684158, and Ccdc19. Pathway annotation showed tryptophan metabolism was concerned. Tph1 is a subtype of tryptophan hydroxylase (TPH) and TPH plays an important role in the biosynthesis of 5-hydroxytryptamine (5-HT). Cerebral ischemia disturbs the normal metabolism of amine and decreases the bioavailability of amine in brain tissues which causes the hyposecretion of 5-hydroxytryptamine (5-HT), norepinephrine (NE), dopamine, and other neurotransmitters [47]. This kind of amine metabolism closely related to the mechanism of poststroke depression. At least 1/3 stroke survivors have varying degrees of emotional symptoms [48, 49]. Depression is the most common symptom which increases the mortality, recurrence rate, and mobility of stroke patients [50-53]. TPH starts the synthesis process by catalyzing L-tryptophan into 5-HT and also acts as the rate limiting enzyme in the whole process. Therefore the activity of TPH directly influences the level and function of 5-HT. Our result of microarray analysis and RT-PCR result showed that the expression of Tph1 was increased after acupuncture treatment which indicated that acupuncture had a potential effect on poststroke depression by promoting the level of 5-HT in brain. In conclusion, the present study discovered several characteristics of cerebral ischemia-induced gene expression and they may enrich our understanding of the multiple pathological process of ischemic brain injury. Meanwhile we also discovered therapeutic candidates stimulated or inhibited by acupuncture in ischemic stroke, and two genes were especially investigated. Upregulation of Tph1 and downregulation of Olr883 after acupuncture treatment indicate that the therapeutic effect of acupuncture for ischemic stroke may be closely related to the suppression of poststroke depression and regulation of olfactory transduction. These results may be useful in pursuing further studies on the possible mechanisms of acupuncture on ischemic stroke. Considering the difference between rats and human beings [54], subsequent clinical researches are also needed to further approve the findings of the current study. Supplementary figure 1 shows the different expression genes of the model group versus the sham group. Supplementary figure 2 presents the enriched pathways of the upregulated genes of the model group versus the sham group. Supplementary figure 3 presents the enriched pathways of the downregulated genes of the model group versus the sham group. Supplementary figure 4 shows the different expression genes of the acupuncture group versus the control group. Supplementary figure 5 presents the enriched pathways of the downregulated genes of the acupuncture group versus the control group. Supplementary figure 6 gives the melting curves of Tph1 and Olr883 in RT-PCR experiment: (a) Melting curve of Tph1. (b) Melting curve of Olr883.
  52 in total

1.  KEGG: kyoto encyclopedia of genes and genomes.

Authors:  M Kanehisa; S Goto
Journal:  Nucleic Acids Res       Date:  2000-01-01       Impact factor: 16.971

2.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 3.  Acupuncture in poststroke rehabilitation: a systematic review and meta-analysis of randomized trials.

Authors:  Ping Wu; Edward Mills; David Moher; Dugald Seely
Journal:  Stroke       Date:  2010-02-18       Impact factor: 7.914

Review 4.  The science of stroke: mechanisms in search of treatments.

Authors:  Michael A Moskowitz; Eng H Lo; Costantino Iadecola
Journal:  Neuron       Date:  2010-07-29       Impact factor: 17.173

5.  Relation between depression after stroke, antidepressant therapy, and functional recovery.

Authors:  G Gainotti; G Antonucci; C Marra; S Paolucci
Journal:  J Neurol Neurosurg Psychiatry       Date:  2001-08       Impact factor: 10.154

6.  Implantation of olfactory ensheathing cells promotes neuroplasticity in murine models of stroke.

Authors:  Woei-Cherng Shyu; Demeral David Liu; Shinn-Zong Lin; Wen-Wen Li; Ching-Yuan Su; Ying-Chen Chang; Hsiao-Jung Wang; Hsing-Won Wang; Chang-Hai Tsai; Hung Li
Journal:  J Clin Invest       Date:  2008-07       Impact factor: 14.808

7.  Chemokine ligand 2 (CCL2) induces migration and differentiation of subventricular zone cells after stroke.

Authors:  Xian Shuang Liu; Zheng Gang Zhang; Rui Lan Zhang; Sara R Gregg; Lei Wang; Toh Yier; Michael Chopp
Journal:  J Neurosci Res       Date:  2007-08-01       Impact factor: 4.164

8.  A long-term observation of olfactory ensheathing cells transplantation to repair white matter and functional recovery in a focal ischemia model in rat.

Authors:  Xianzhong Shi; Yali Kang; Qin Hu; Chunhua Chen; Lei Yang; Ke Wang; Lin Chen; Hongyun Huang; Changman Zhou
Journal:  Brain Res       Date:  2010-01-04       Impact factor: 3.252

9.  Reversible middle cerebral artery occlusion without craniectomy in rats.

Authors:  E Z Longa; P R Weinstein; S Carlson; R Cummins
Journal:  Stroke       Date:  1989-01       Impact factor: 7.914

10.  Chemokines and neurodegeneration in the early stage of experimental ischemic stroke.

Authors:  Pawel Wolinski; Andrzej Glabinski
Journal:  Mediators Inflamm       Date:  2013-11-11       Impact factor: 4.711

View more
  7 in total

1.  Effects of "nourishing liver and kidney" acupuncture therapy on expression of brain derived neurotrophic factor and synaptophysin after cerebral ischemia reperfusion in rats.

Authors:  Wen-Guang Xia; Chan-Juan Zheng; Xuan Zhang; Juan Wang
Journal:  J Huazhong Univ Sci Technolog Med Sci       Date:  2017-04-11

2.  Expression of Slit and Robo during remodeling of corticospinal tract in cervical spinal cord in middle cerebral artery occlusion rats.

Authors:  Zhenhao Ying; Junxuan Wu; Wenjun Jiang; Guoli Zhang; Weiming Zhu; Xin Li; Xueyun Pang; Wei Liu
Journal:  Mol Biol Rep       Date:  2021-10-15       Impact factor: 2.316

3.  Electroacupuncture improves cognitive ability following cerebral ischemia reperfusion injury via CaM-CaMKIV-CREB signaling in the rat hippocampus.

Authors:  Yun Zhang; Ruhui Lin; Jing Tao; Yunan Wu; Bin Chen; Kunqiang Yu; Jixiang Chen; Xiaojie Li; Li-Dian Chen
Journal:  Exp Ther Med       Date:  2016-06-06       Impact factor: 2.447

4.  Electroacupuncture induces acute changes in cerebral cortical miRNA profile, improves cerebral blood flow and alleviates neurological deficits in a rat model of stroke.

Authors:  Hai-Zhen Zheng; Wei Jiang; Xiao-Feng Zhao; Jing Du; Pan-Gong Liu; Li-Dan Chang; Wen-Bo Li; Han-Tong Hu; Xue-Min Shi
Journal:  Neural Regen Res       Date:  2016-12       Impact factor: 5.135

5.  Comprehensive evaluation of gene expression signatures in response to electroacupuncture stimulation at Zusanli (ST36) acupoint by transcriptomic analysis.

Authors:  Jing-Shan Wu; Hsin-Yi Lo; Chia-Cheng Li; Feng-Yuan Chen; Chien-Yun Hsiang; Tin-Yun Ho
Journal:  BMC Complement Altern Med       Date:  2017-08-15       Impact factor: 3.659

6.  The Effect of Acupuncture on the Motor Function and White Matter Microstructure in Ischemic Stroke Patients.

Authors:  Yongxin Li; Ya Wang; Heye Zhang; Ping Wu; Wenhua Huang
Journal:  Evid Based Complement Alternat Med       Date:  2015-10-20       Impact factor: 2.629

7.  Acupuncture for balance dysfunction in patients with stroke: A systematic review protocol.

Authors:  Lei Xu; YouKang Dong; Min Wang; LiQiu Chen; ZeRong Zhang; DongSheng Su; Feng Zhang; Zhen Lei; WeiYong Xu; Kuete Kamtsop Christian Didier; YuanHao Du
Journal:  Medicine (Baltimore)       Date:  2018-08       Impact factor: 1.817

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.