Literature DB >> 25848512

Detection of virulence genes (bvfA, virB and ure) in Brucella melitensis isolated from aborted fetuses of sheep and goats.

Abdollah Derakhshandeh1, Roya Firouzi1, Ali Goudarztalejerd1.   

Abstract

BACKGROUND AND OBJECTIVES: Brucella, causative of brucellosis, has some potential virulence factors involved in Brucella replication and its strategies to circumvent the immune response. One of them is the virB gene that encodes the type IV secretion system proteins (T4SS) involved in intracellular replication of organism. Brucella virulence factor A (bvfA), and urease (ure) has also been described as being implicated in survival, and virulence in the hosts. The aim of this study was to investigate the B. melitensis virulence factor genes among Brucella isolated from aborted fetuses of sheep and goats in Fars province, southern Iran.
MATERIALS AND METHODS: A total of 42 isolates of B. melitensis isolated from aborted fetuses between 2005-2011 in Fars province of Iran was used in this study. PCR assay was performed in order to detect the virB, bvfA, and ure genes using specific primers. RESULTS AND
CONCLUSIONS: The frequency of bvfA, virB, and ure genes was 78.50%, 73.80%, and 88.09% among all isolates respectively. The results of the present study showed that most Brucella isolates from this region have virulence factors genes (virB, bvfA, ure) in their genome, and most B. melitensis had ure genes that has been hypothesized to play a role in the pathogenesis of disease.

Entities:  

Keywords:  Brucella melitensis; Fars province; Goat; Iran; Sheep; Virulence genes (bvfA; virB and ure)

Year:  2013        PMID: 25848512      PMCID: PMC4385168     

Source DB:  PubMed          Journal:  Iran J Microbiol        ISSN: 2008-3289


INTRODUCTION

Members of genus Brucella are facultative intracellular pathogens responsible for brucellosis, worldwide zoonoses (1). B.melitensis, B.abortus, and B.suis cause brucellosis in humans, leading to chronic stages of the disease that can be manifested as orchitis, spondylitis, arthritis and debililitating illness known as undulant fever (2). The pathogenesis of brucellosis is due to its ability to adapt to the environmental conditions encountered in its intracellular explicative niche including low levels of nutrients and oxygen, acidic pH and reactive oxygen intermediates (3). Smooth Brucella inhibits host cell apoptosis, favoring bacterial intracellular survival by escaping host immune surveillance, while rough Brucella mutants (B.melitensis and B.ovis are two exceptions) induce macrophages (4). Brucella uses a number of mechanisms for avoiding or suppressing bactericidal responses inside macrophages. Molecular characterization of intracellular survival process of Brucella is important as it will provide guidance for prevention and sth. control (5, 6). VirB proteins that forms the type IV secretion system (T4SS) and that are involved in intracellular replication are considered as one of Brucella ,s virulence factors (7, 1). The T4SS in Brucella is typed by the virB operon encoding 12 proteins. The mechanism of assembly of factors secreted by T4SS in Brucella is still unknown. However, the similarity with the well-studied plant pathogen Agrobacterium tumefaciens suggest that Brucella uses in it for translocation of virulence factors into mammalian cells (8-9). It is clear that VirB proteins forming the type IV secretion system are involved in Brucella virulence and intracellular replication (10-12). In addition to this secretion system, Brucella virulence factor A (bvfA) has also been described as being implicated in Brucella survival in the host. Brucella virulence factor A (bvfA) is a small 11 kDa periplasmic protein that unique to the genus Brucella (13) and suggests it may play a role in the establishment of the intracellular niche (6). Although BvfA was essential for Brucella virulence in both in vitro and in vivo, its assumed role in virulence is still unknown (13). The other Brucella virulence factor is urease (ure). The Brucella urease are interesting candidates to consider as they are important Brucella virulence factor. Urease is a virulence factor that plays a role in the resistance of Brucella to low pH conditions, both in vivo and in vitro. Brucella contains two separate urease gene clusters, ure1 and ure2. Although only ure1 codes an active urease, ure2 is also transcribed, but its contribution to Brucella biology is unknown (14). Brucella contains two urease operons, both located in chromosome I. The proposed role of Brucella urease in inhibition of phagosome acidification by ammonia release was not observed (15). The aim of this study was to investigate Brucella virulence factor genes among B.melitensis isolates from aborted fetuses of sheep and goats, in Fars province, Iran.

MATERIALS AND METHODS

Bacterial strains

A total of 42 isolates of B. melitensis (41 isolates biovar 1, One isolate biovar 2) recovered from clinical specimens from 2005 - 2011 used for the PCR assay.

DNA preparation

A loopful of colonies of each isolate on agar plate was picked and suspended in 200 μl of distilled water. After vortexing, the suspension was boiled for 5 min, and 50 μl of the supernatant was collected after spinning at 14,000 rpm for 10 min. The DNA concentration of the boiled extracts was determined with spectrophotometer. (12).

PCR assay

PCR amplifications were performed in a final volume of 25 μL in PCR tubes. The reaction mixtures consisted of 2 μL of the DNA template, 2.5 μL 10x PCR buffer (75 mM Tris-HCl, pH 9.0, 2 mM MgCl2, 50 mM KCl, 20 mM (NH4)2SO4, 1 μL dNTPs (50 μM), 1 μL (1U Ampli Taq DNA polymerase), 1 μL (25 pmol) of forward and reverse primers, (Table 1) and the volume of the reaction mixture was completed up to 25 μL using distilled deionized water. PCR program for amplification of bvfA consisted of initial denaturation at 95°C for 4min, 32 cycles of application with denaturation at 95°C for 1min, annealing at 65°C for 1min, extension at 72°C for 1.30 min and final extension of the incompletely synthesized DNA at 72°C for 10 min in the BioRad thermal cycler (MJ Mini, BioRad, USA).This procedure was carried out for amplification of virB and ure genes with annealing temperatures described in Table 1. The PCR products were analyzed in 2.0% agarose gels containing 0.5μg /ml of ethidium bromide and subjected to electrophoresis in a 1X TAE buffer. Gels were visualized under UV light and documented using Uvitec System DOC-008.XD (EEC). A molecular weight Marker with 100 bp increments (100 bp plus ladder, Vivantis, Malaysia) was used as a DNA standard.
Table 1

Oligonucleotide primers used in the PCR assay.

genesPrimer sequences (5’ - 3’)annealing temperatureReference
bvfAF: ACCCTTCGTCGATGTGCTGA65°C(13)
R: CCGCGCTGATTTCATCGCTG
virBF: CGCTGATCTATAATTAAGGCTA54°C(12,19)
R: TGCGACTGCCTCCTATCGTC
UreF: GCTTGCCCTTGAATTCCTTTGTGG65°C(15)
R: ATCTGCGAATTTGCCGGACTCTAT

RESULTS AND DISCUSSION

DNA was successfully extracted from all 42 B.melitensis isolates. As expected the bvfA, virB and ure genes assays produced amplicons of 1282, 881 and 2100 bp respectively, (Fig 1). Of 42 B.melitensis isolates; 33 (78.5%) isolates had bvfA genes, 31(73.8%) isolates had virB genes and 37 (88.09) isolates had ure genes.
Fig 1

Agarose gel electrophoresis of PCR product of three brucella virulence genes. Lane M, 100 bp ladder, lanes 1- 3: PCR product of ure gene: 9-PCR product of virB gene, lanes 7: 6-product of bvfA gene, lane N, Negative control, lanes 4

The pathogenicity of Brucellae is due to its amazing ability to adapt to the environmental conditions encountered intracellularly. Brucella has evolved to avoid induction of immune system, interfere with intracellular trafficking, resist respiratory burst and adapt to oxygen-limited conditions encountered inside macrophages (6). In many regions of Iran B. abortus biovar 3 still remains the dominant biotype (16), however, B. melitensis biotype 1 is the predominant infective biotype in sheep and goats in Iran (17). The results of the present study showed that most B.melitensis isolates from Iran have virulence factors genes (virB, bvfA, ure) in their genome, and most B.melitensis isolates had ure genes that has been hypothesized to play a role in the pathogenesis of disease. Other studies show most Brucella isolates exhibit potent urease activity that has been hypothesized to play a role in the pathogenesis of disease (18). Furthermore, some isolates, such as the well-known laboratory strain B. abortus, are urease negative, while they seem to retain most of their pathogenic potential (15). Whole-genome sequencing revealed the presence of a second urease operon (ure2) with all the genes potentially active in B. suis and B. melitensis. On the other hand, B. abortus had two frameshift deletions in ureE2, and B. ovis had deletions in ureG2 and ureT (15). These data support our results that 88.09% of B.melitensis had ure gene. Our results show that 73.8% isolates had virB genes. This is in accordance with other studies; O’Callaghan et al. (1990), described the presence of a virB region of B. suis containing 11 genes highly similar to the 11 virB genes of Agrobacterium tumefaciens and an extra ORF 12 that shares homology with an adhesion of Pseudomonas fluorescens (12). Sieria et al. (2000) suggested that putative effector molecules secreted by this T4SS determine routing of B. abortus to an endoplasmic reticulum-related replication compartment. The requirement of an active virB operon for intracellular survival of Brucellae may have two possible explanations: (i) the virB operon is essential to reach a competent intracellular replication niche or (ii) the virB operon is needed for replication once the intracellular replication niche has been established (19). Delrue et al. (2004) reported that the T4SS of Brucella encoded by the virB operon is a major virulence factor (20). In this investigation we found that 78.5% isolates of B.melitensis had bvfA genes which is similar to other studies; Lavigne et al. (2005) reported that Brucella virulence factor A (bvfA) is a small 11 kDa periplasmic protein unique to the genus Brucella with no homologues in GenBank and no conserved domains or structural features was reported (13). It is suggested that it may play a role in the establishment of the intracellular niche (6). Although bvfA was essential for Brucella virulence in both in vitro and in vivo, its assumed role in virulence is still unknown (13). It is concluded from the study most B.melitensis isolates from Iran have virulence factors genes (virB, bvfA, ure) in their genome, and most B.melitensis isolates had ure genes that has been hypothesized to play a role in the pathogenesis of disease.
  18 in total

1.  Identification of a new virulence factor, BvfA, in Brucella suis.

Authors:  Jean-Philippe Lavigne; Gilles Patey; Felix J Sangari; Gisèle Bourg; Michel Ramuz; David O'Callaghan; Sylvie Michaux-Charachon
Journal:  Infect Immun       Date:  2005-09       Impact factor: 3.441

2.  Brucella abortus rough mutants induce macrophage oncosis that requires bacterial protein synthesis and direct interaction with the macrophage.

Authors:  Jianwu Pei; Joshua E Turse; Qingmin Wu; Thomas A Ficht
Journal:  Infect Immun       Date:  2006-05       Impact factor: 3.441

Review 3.  Brucella: a pathogen without classic virulence genes.

Authors:  Mohamed N Seleem; Stephen M Boyle; Nammalwar Sriranganathan
Journal:  Vet Microbiol       Date:  2007-11-29       Impact factor: 3.293

Review 4.  Pathogenesis of Brucella.

Authors:  L D Smith; T A Ficht
Journal:  Crit Rev Microbiol       Date:  1990       Impact factor: 7.624

5.  Essential role of the VirB machinery in the maturation of the Brucella abortus-containing vacuole.

Authors:  D J Comerci; M J Martínez-Lorenzo; R Sieira; J P Gorvel; R A Ugalde
Journal:  Cell Microbiol       Date:  2001-03       Impact factor: 3.715

6.  Identification of Brucella suis genes affecting intracellular survival in an in vitro human macrophage infection model by signature-tagged transposon mutagenesis.

Authors:  V Foulongne; G Bourg; C Cazevieille; S Michaux-Charachon; D O'Callaghan
Journal:  Infect Immun       Date:  2000-03       Impact factor: 3.441

7.  Characterization of Brucella abortus lipopolysaccharide macrodomains as mega rafts.

Authors:  Nicolas Lapaque; Frédérique Forquet; Chantal de Chastellier; Zohair Mishal; Gilles Jolly; Edgardo Moreno; Ignacio Moriyon; John E Heuser; Hai-Tao He; Jean-Pierre Gorvel
Journal:  Cell Microbiol       Date:  2006-02       Impact factor: 3.715

Review 8.  Brucella pathogenesis, genes identified from random large-scale screens.

Authors:  Rose-May Delrue; Pascal Lestrate; Anne Tibor; Jean-Jacques Letesson; Xavier De Bolle
Journal:  FEMS Microbiol Lett       Date:  2004-02-09       Impact factor: 2.742

9.  Brucella abortus ure2 region contains an acid-activated urea transporter and a nickel transport system.

Authors:  Félix J Sangari; Ana M Cayón; Asunción Seoane; Juan M García-Lobo
Journal:  BMC Microbiol       Date:  2010-04-10       Impact factor: 3.605

10.  Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum.

Authors:  Jean Celli; Chantal de Chastellier; Don-Marc Franchini; Javier Pizarro-Cerda; Edgardo Moreno; Jean-Pierre Gorvel
Journal:  J Exp Med       Date:  2003-08-18       Impact factor: 14.307

View more
  3 in total

1.  Prevalence of the Most Common Virulence-Associated Genes among Brucella Melitensis Isolates from Human Blood Cultures in Hamadan Province, West of Iran.

Authors:  Zahra Naseri; Mohammad Yousef Alikhani; Seyed Hamid Hashemi; Farideh Kamarehei; Mohammad Reza Arabestani
Journal:  Iran J Med Sci       Date:  2016-09

2.  Detection of virulence-associated genes in Brucella melitensis biovar 3, the prevalent field strain in different animal species in Egypt.

Authors:  Mahmoud E R Hamdy; Hoda M Zaki
Journal:  Open Vet J       Date:  2018-03-28

3.  Antibiogram Screening and Detection of Virulence-Associated Genes in Brucella Species Acquired from Cattle in South Africa's Eastern Cape Province.

Authors:  Rudzani P Manafe; Nolwazi L Bhembe-Magadaza; Ezekiel Green
Journal:  Int J Environ Res Public Health       Date:  2022-02-28       Impact factor: 3.390

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.