| Literature DB >> 25843582 |
Elizabeth J Wade1, Chris Simon2.
Abstract
The New Zealand cicada genus Kikihia Dugdale 1971 exhibits more than 20 contact zones between species pairs that vary widely in their divergence times (between 20,000 and 2 million years) in which some level of hybridization is evident. Mitochondrial phylogenies suggest some movement of genes across species boundaries. Biparentally inherited and quickly evolving molecular markers like microsatellites are useful for assessing gene flow levels. Here, we present six polymorphic microsatellite loci that amplify DNA from seven species across the genus Kikihia; Kikihia "northwestlandica," Kikihia "southwestlandica," Kikihia muta, Kikihia angusta, Kikihia "tuta," Kikihia "nelsonensis," and Kikihia "murihikua." The markers were developed using whole-genome shotgun sequencing on the 454 pyrosequencing platform. Moderate to high levels of polymorphisms were observed with 14-47 alleles for 213 individuals from 15 populations. Observed and expected heterozygosity range from 0 to 1 and 0.129 to 0.945, respectively. These new markers will be instrumental for the assessment of gene flow across multiple contact zones in Kikihia.Entities:
Keywords: Cicadidae; codominant genetic marker; population genetics
Mesh:
Year: 2015 PMID: 25843582 PMCID: PMC4535467 DOI: 10.1093/jisesa/iev016
Source DB: PubMed Journal: J Insect Sci ISSN: 1536-2442 Impact factor: 1.857
Kikihia species and populations used for microsatellite discovery
| Species | Site Code | Lat | Long | Location description | ||
|---|---|---|---|---|---|---|
| NW | 29 | NN.KOB | −41.11 | 172.10 | 28 | Kohaihai Bluff, 16.3 km north of Karamea |
| SW | 33 | WD.OKT | −43.23 | 170.16 | 6 | Okarito, beach pulloff |
| Mur | 18 | OL.RSC | −44.50 | 168.78 | 378 | 3.4 km from Raspberry Flat/Mt. Aspiring Trailhead |
| 6 | OL.NLW | −44.48 | 169.25 | W side of Lake Hawea, SH6, north of Wanaka | ||
| Muta | 10 | MB.GRO | −41.48 | 173.96 | 15 | 2.5 km N. of Opawa River on SH1, S. of Grovestown |
| 4 | MB.WCR | −41.42 | 173.88 | 43 | Waikakaho Creek Rd 3.7 km north of Kaituna-Tuamanina Rd | |
| 7 | MB.LVR | −41.37 | 173.76 | 44 | Long Valley Road at River (Kaituna) | |
| 7 | MB.LVB | −41.37 | 173.74 | 63 | Long Valley Road at bridge | |
| 5 | MB.LVM | −41.36 | 173.73 | 64 | Long Valley Road 3 km west of Kaituna River | |
| Nel | 20 | NN.HRN | −41.00 | 172.89 | 681 | 2.6 km north of SH60 on Canaan Rd (Harwood hole road) |
| 16 | NN.WGB | −41.45 | 173.08 | 144 | 10.8 km East of Wakefield on Pig Valley Rd | |
| Tuta | 16 | NN.BES | −41.28 | 173.15 | Rabbit Island, boat launch at Best's Rd | |
| 17 | SD.TAP | −41.29 | 173.67 | 25 | Junction of SH6 and Tapps Rd at Canvastown | |
| Ang | 9 | MB.BAV | −42.16 | 172.82 | 1263 | North of Island Saddle, on the Rainbow/Hanmer Rd. |
| 16 | SC.IDN | −44.78 | 170.87 | 141 | Ritchies Rd, SOUTH of Douglas |
Species NW, K. “northwestlandica”; SW, K. “southwestlandica”; Mur, K. “murihikua”; Muta, K. muta, K. “nelsonensis,” K. “tuta,” K. angusta; N, number of specimens per population; site code, the first two letters represent New Zealand district codes and the last three letters are unique collecting location codes; Lat, latitude; long, longitude; E, elevation in meters
Characterization of the microsatellite markers
| Locus | Primer sequence (5'–3') | Label | Motif | MM | |||
|---|---|---|---|---|---|---|---|
| A553 | F | TGGAATTAGGCTATCTCACACTC | 6-FAM | (CT)10 | 76-110 | 1 | 23 |
| R | ACAAAACTCTGGCGGTTGG | ||||||
| M1010 | F | TGGCTCCTCAAGAACGACC | VIC | (AC)7 | 167-237 | 1 | 47 |
| R | CGAAGTGCGCATCCAATTTC | ||||||
| M1422 | F | GTGTCCACACGAAGCTATTTG | PET | (GAT)8 | 192-267 | 1 | 27 |
| R | AGTTTCATGCCAACGTCCC | ||||||
| A1267 | F | AAACCGCACGCACATTGAC | 6-FAM | (AC)7 | 83-125 | 2 | 14 |
| R | ACCAGACGGACTGACACAC | ||||||
| M2333 | F | TGTCTGCTTCTACTGGGATG | VIC | (AC)16 | 166-234 | 2 | 35 |
| R | AAGCTATAGGGATCGTCGC | ||||||
| K1466 | F | CACTTGCACGGCCTCTTTC | NED | (AC)9 | 196-260 | 2 | 22 |
| R | AATGTGGCTTAACAACCGTC |
F, forward primer sequence; R, reverse primer sequence; label, fluorescent label on 5’-end of forward primer; SA, amplicon size range; MM, multiplex mix; NA, total number of alleles.
Characterization of microsatellite markers for each population
| Loci | Populations | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| NN.KOB | WD.OKT | OL.RSC | ||||||||||
| HO | HE | HO | HE | HO | HE | |||||||
| A553 | 6 | 1 | 0.461 | 0.617 | 7 | 1 | 0.786 | 0.733 | 4 | 0 | 0.688 | 0.528 |
| M1010 | 9 | 1 | 0.500 | 0.753 | 6 | 0 | 0.697 | 0.778 | 7 | 0 | 0.765 | 0.799 |
| M1422 | 7 | 3 | 0.567 | 0.801 | 4 | 0 | 0.606 | 0.672 | 2 | 0 | 0.133 | 0.129 |
| A1267 | 5 | 3 | 0.233 | 0.219 | 5 | 1 | 0.060 | 0.174 | 4 | 1 | 0.333 | 0.602 |
| M2333 | 8 | 0 | 0.055 | 0.849 | 10 | 1 | 0.625 | 0.835 | 7 | 3 | 0.444 | 0.740 |
| K1466 | 8 | 1 | 0.533 | 0.837 | 10 | 3 | 0.818 | 0.794 | 5 | 1 | 0.000 | 0.589 |
OL.NLW | MB.GRO | MB.WCR | ||||||||||
| HO | HE | HO | HE | HO | HE | |||||||
| A553 | 5 | 0 | 1.000 | 0.822 | 5 | 0 | 0.600 | 0.695 | 4 | 1 | 1.000 | 0.750 |
| M1010 | 5 | 0 | 0.833 | 0.803 | 5 | 0 | 0.000 | 0.800 | 4 | 0 | 0.000 | 0.857 |
| M1422 | 2 | 0 | 0.167 | 0.167 | 5 | 0 | 0.500 | 0.653 | 2 | 0 | 0.000 | 0.429 |
| A1267 | X | 0 | X | X | 3 | 0 | 0.400 | 0.484 | 3 | 0 | 0.500 | 0.464 |
| M2333 | X | 0 | X | X | 9 | 3 | 0.800 | 0.863 | 5 | 0 | 0.750 | 0.857 |
| K1466 | X | 0 | X | X | 3 | 0 | 0.400 | 0.353 | 3 | 1 | 0.500 | 0.464 |
MB.LVR | MB.LVB | MB.LVM | ||||||||||
| HO | HE | HO | HE | HO | HE | |||||||
| A553 | 5 | 2 | 0.714 | 0.769 | 4 | 0 | 0.714 | 0.780 | 3 | 0 | 0.400 | 0.378 |
| M1010 | 5 | 0 | 0.429 | 0.780 | 8 | 1 | 0.286 | 0.923 | 6 | 2 | 0.600 | 0.889 |
| M1422 | 4 | 0 | 0.333 | 0.636 | 7 | 3 | 0.429 | 0.879 | 6 | 2 | 0.800 | 0.844 |
| A1267 | 2 | 0 | 0.500 | 0.429 | 2 | 0 | 0.400 | 0.356 | 3 | 1 | 0.500 | 0.833 |
| M2333 | 4 | 0 | 0.667 | 0.636 | 8 | 1 | 0.667 | 0.924 | 5 | 0 | 1.000 | 0.867 |
| K1466 | X | X | X | X | 3 | 0 | 0.500 | 0.439 | X | X | X | X |
NN.HRN | NN.WGB | NN.BES | ||||||||||
| HO | HE | HO | HE | HO | HE | |||||||
| A553 | 10 | 1 | 0.842 | 0.838 | 5 | 0 | 0.688 | 0.784 | 7 | 0 | 0.938 | 0.766 |
| M1010 | 16 | 3 | 0.789 | 0.871 | 8 | 2 | 0.375 | 0.603 | 15 | 6 | 0.875 | 0.921 |
| M1422 | 7 | 0 | 0.500 | 0.800 | 7 | 1 | 0.533 | 0.795 | 5 | 0 | 0.286 | 0.725 |
| A1267 | 4 | 0 | 0.667 | 0.608 | 3 | 0 | 0.267 | 0.343 | 2 | 0 | 0.357 | 0.452 |
| M2333 | 9 | 0 | 0.556 | 0.882 | 16 | 3 | 0.733 | 0.945 | 7 | 0 | 0.667 | 0.826 |
| K1466 | 6 | 2 | 0.222 | 0.765 | 3 | 0 | 0.143 | 0.670 | 3 | 0 | 0.357 | 0.320 |
SD.TAP | MB.BAV | SC.IDN | ||||||||||
| HO | HE | HO | HE | HO | HE | |||||||
| A553 | 6 | 0 | 0.813 | 0.782 | 4 | 0 | 0.923 | 0.692 | 4 | 1 | 0.750 | 0.567 |
| M1010 | 13 | 2 | 0.765 | 0.868 | X | X | X | X | 2 | 1 | 0.188 | 0.272 |
| M1422 | 6 | 0 | 0.667 | 0.844 | 5 | 1 | 0.769 | 0.671 | 9 | 0 | 0.938 | 0.857 |
| A1267 | 4 | 1 | 0.529 | 0.594 | X | X | X | X | X | X | X | X |
| M2333 | 9 | 0 | 0.647 | 0.818 | X | X | X | X | X | X | X | X |
| K1466 | 6 | 1 | 0.563 | 0.782 | X | X | X | X | X | X | X | X |
NA, number of alleles; NP, number of private alleles; HO, observed heterozygosity; HE, expected heterozygosity; X, missing data. HE cells colored gray represent loci that violate HWE.