Correction: Detection of MPLW515L/K mutations and determination of allele frequencies with a single-tube PCR assay.

There are errors in the first sentence of the “Targeted deep sequencing” section of the Materials and Methods. The correct sentence is: A 169-bp fragment containing the human MPL sequence (43349278 to 43349446 of NC_000001.11) was PCR-amplified from genomic or standard plasmid DNA using forward (5′- TGACCGCTCTGCATCTAGTGC -3′) and reverse (5′-GGTCACAGAGCGAACCAAGA-3′) primers (see above).

There is an error in Fig. 1. The first primer sequence in Fig. 1A is incorrect. Please view Fig. 1 here.

Fig 1

Detection of MPLW515L/K mutations using DARMS-PCR.

(A) The primers used in the DARMS-PCR assay. The two inner primers harbored sequences (underlined) that matched MPLW515L or W515K, but not the wild-type allele. Other mismatches (capital letters) were introduced into the inner primers to reduce the annealing of the mutant-specific primers to the wild-type sequence. The reverse primers were labeled with FAM (5-carboxyfluorescein hydrate) at the 5′ terminus. (B) A schematic representation of DARMS-PCR products. The two outer primers were designed to generate a 169-base-pair (bp) PCR product from all MPL alleles. The F_inner and R_inner primers annealed specifically to the MPLW515L and W515K alleles, respectively; in combination with the outer primers, they generated 84- and 128-bp PCR products, respectively. From a mutant allele, both 169-bp and 84- or 128-bp fragments were amplified, while, only the 169-bp fragment was generated from the wild-type allele. (C) Demonstration of DARMS-PCR. A capillary electropherogram of DARMS-PCR products showing three peaks derived from wild-type MPL, W515L, and W515K. This result was obtained when PCR was performed with a standard DNA mixture containing equal ratios of MPL wild-type, W515L, and W515K alleles with a total copy number of 105. The horizontal axis represents the fragment length, and the vertical axis represents the fluorescence intensity.