Literature DB >> 25823555

HMGA2 expression pattern and TERT mutations in tumors of the vulva.

Antonio Agostini1, Ioannis Panagopoulos1, Hege Kilen Andersen1, Lene Elisabeth Johannesen1, Ben Davidson2, Claes Göran Tropé3, Sverre Heim1, Francesca Micci1.   

Abstract

Malignant tumors of the vulva account for only 5% of cancers of the female genital tract in the USA. The most frequent cancers of the vulva are squamous cell carcinoma (SCC) and malignant melanoma (MM). Little is known about the genetic aberrations carried by these tumors. We report a detailed study of 25 vulva tumors [22 SCC, 2 MM, 1 atypical squamous cell hyperplasia (AH)] analyzed for expression of the high-mobility group AT-hook family member genes HMGA2 and HMGA1, for mutations in the IDH1, IDH2 and TERT genes, and for methylation of the MGMT promoter. The RT-PCR and immunohistochemistry analyses showed that HMGA2 was expressed in the great majority of analyzed samples (20 out of 24; SCC as well as MM) but not in the normal controls. HMGA1, on the other hand, was expressed in both tumors and normal tissues. Five of the 24 tumors (all SCC) showed the C228T mutation in the TERT promoter. Our results showed that HMGA2 and TERT may be of importance in the genesis and/or the progression of tumors of the vulva.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25823555      PMCID: PMC4431449          DOI: 10.3892/or.2015.3882

Source DB:  PubMed          Journal:  Oncol Rep        ISSN: 1021-335X            Impact factor:   4.136


Introduction

Malignant tumors of the vulva account for 5% of cancers of the female genital tract in the USA (1). Squamous cell carcinomas (SCC) make up 70% of all vulvar cancers. The incidence rate is much higher in older (20:100,000) than in younger (1:100,000) women (1). Little is known about the acquired genomic changes of this type of cancer as only few cases have been cytogenetically and/or molecularly analyzed (2–4). Chromosome and array-based comparative genomic hybridization (CGH) analysis (4) has shown, among other imbalances, loss of chromosomal band 3p14 leading to deregulation of the FHIT gene. Expression array analyses also identified a number of other genes whose expression profile was altered. Notable among the downregulated genes were MAL (in 2q11), KRT4 (in 12q13) and OLFM4 (in 13q14), whereas upregulated genes included SPRR2G (in 1q21.3) and S100A7A (in 1q21.3). No mutation analyses have so far been performed in this tumor type. Vulva malignant melanoma (MM), the second most common malignancy in this organ or site, is an aggressive cancer carrying poor overall prognosis (5). Only five vulvar MM cases have been cytogenetically characterized; they showed complex karyotypes with no recurrent aberration. No molecular genetic data on vulvar MM cases have been published. To gain more information on the genetics of vulvar tumors, we analyzed 22 SCC, two MM, and one atypical squamous cell hyperplasia (AH) case for expression of the high-mobility group AT-hook genes HMGA2 and HMGA1. We then searched them for mutations in the isocitrate dehydrogenase 1 (IDH1) and 2 (IDH2) and telomerase reverse transcriptase (TERT) genes, and checked them for the methylation status of the promoter of O6-methylguanine-DNA methyltransferase (MGMT). Since these genes have all been found mutated, deregulated and/or methylated in various types of cancer (6–9), they seemed to be a reasonable starting point for the characterization of the genetic profile also of vulvar cancers.

Materials and methods

Tumor material

The material consisted of fresh samples from 22 SCC, two MM and one AH, all arising in the vulva and surgically removed at The Norwegian Radium Hospital between 1998 and 2009 (Table I). The tumors have been previously characterized for chromosomal aberrations and genomic imbalances (3); a subset of them was also investigated for their expression profile (4).
Table I

Overview of the results for the vulva tumors.

Case/lab no.DiagnosisIDH1IDH2TERTMGMT methylatedHMGA1HMGA2 ex1–3HMGA2 ex1–5Immunohisto-chemistry score
1/02-167SCC++>50
2/02-848SCC++1–10
3/02-869SCC+++>50
4/02-1060SCCIDH1G105+++11–50
5/02-1171SCCC254T+++>50
6/03-48AHNANANANA
7/03-830SCCC228T+NANANA>50
8/03-1011SCCC228T+++
9/03-1088SCC+NA
10/04-1190SCCC228TNANANA>50
11/06-19SCCC228T+++1–10
12/06-125SCCC228T+++11–50
13/06-709SCC+++1–10
14/09-733SCC+++11–50
15/09-818SCCNANANANA+++1–10
16/68-98SCCISNANANA>50
17/02-99MMNANANA1–10
18/00-647SCCNANANA
19/00-651SCCNANANA>50
20/00-1127MMNANANA>50
21/01-61SCCNANANA>50
22/01-99SCCNANANA
23/01-134SCCNANANA
24/01-777SCCNANANA11–50
25/01-981SCCNANANA1–10

SCC, squamous cell carcinoma; SCCIS, squamous cell carcinoma in situ; MM, malignant melanoma; AH, atypical squamous cell hyperplasia; NA, not available.

DNA and RNA extraction and cDNA synthesis

DNA extraction was performed on 24 samples (no frozen material was available for case 15). The DNA was extracted using the Maxwell 16 extractor (Promega, Madison, WI, USA) and the Maxwell 16 Tissue DNA Purification kit (Promega) according to the manufacturer’s recommendations. RNA was extracted from the 12 samples from which we had sufficient material to extract both DNA and RNA. The RNA was extracted using the miRNeasy kit (Qiagen, Hilden, Germany) and QIAcube (Qiagen). The concentration and purity of both DNA and RNA were measured with the NanoVue spectrophotometer (GE Healthcare, Pittsburgh, PA, USA). One microgram of extracted RNA was reverse-transcribed in a 20 μl reaction volume using the iScript Advanced cDNA Synthesis kit according to the manifacturer’s instructions (Bio-Rad Laboratories, Oslo, Nor way).

Molecular analyses

All primers used in the PCR reactions are listed in Table II. All PCR reactions were run on a Bio-Rad C100 Thermal Cycler (Bio-Rad Laboratories). Three microliters of the PCR products were stained with GelRed (Biotium, Hayward, CA, USA) and analyzed by electrophoresis through 1.0% agarose gel. The gel was scanned with G-Box (Syngene, Los Altos, CA, USA) and the images were acquired using GeneSnap (Syngene). The remaining 22 μl of the amplified fragments were purified using the QIAquick PCR Purification kit (Qiagen). Direct sequencing was performed using the light run sequencing service of GATC Biotech (http://www.gatc-biotech.com/en/sanger-services/lightrun-sequencing.html). The BLAST (http://blast.ncbi.nlm.nih.gov/blast.cgi) and BLAT (http://genome.ucsc.edu/cgi-bin/hgblat) programs were used for computer analysis of sequence data.
Table II

Primers used in the PCR reactions.

Primer namePrimer sequence
IDH1-rs1-86F5′-CTCCTGATGAGAAGAGGGTTGAG-3′
IDH1-rs1-321R5′-ACACATACAAGTTGGAAATTTCTGG-3′
IDH2-rs12-42F5′-CTTGGGGTTCAAATTCTGGTTGA-3′
IDH2-rs12-315R5′-GCTAGGCGAGGAGCTCCAGTC-3′
TERT-PromF25′-GCCGGGCTCCCAGTGGATTCG-3′
TERT-PromR25′-GGCTTCCCACGTGCGCAGCAG-3′
HMGA2-846F15′-CCACTTCAGCCCAGGGACAACCT-3′
HMGA2-982-F15′-CAAGAGTCCCTCTAAAGCAGCTCA-3′
HMGA2-1021R15′-CCTCTTGGCCGTTTTTCTCCAGTG-3′
HMGA2-1112R15′-CCTCTTCGGCAGACTCTTGTGAGGA-3′
HMGA1-284F15′-CAGCCATCACTCTTCCACCTGC-3′
HMGA1-648R15′-CTGTCCAGTCCCAGAAGGAAGCT-3′
ABL1-91F15′-CAGCGGCCAGTAGCATCTTGACTTTG-3′
ABL1-404R15′-CTCAGCAGATACTCAGCGGCATTGC-3′
A3RNV-RACE5′-ATCGTTGAGACTCGTACCAGCAGAGTCACGAGAGAGACTACACGGTACTGGTTTTTTTTTTTTTTT-3′
A3R1New5′-TCGTTGAGACTCGTACCAGCAGAGTCAC-3′
A3R35′-CGAGAGAGACTACACGGTACTGGT-3′
MSP-MGMT-MetF5′-TTTCGACGTTCGTAGGTTTTCGC-3′
MSP-MGMT-MetR5′-GCACTCTTCCGAAAACGAAACG-3′
MSP-MGMT-UnmetF5′-TTTGTGTTTTGATGTTTGTAGGTTTTTGT-3′
MSP-MGMT-UnmetR5′AACTCCACACTCTTCCAAAAACAAAACA3′

Reverse transcriptase-polymerase chain reaction (RT-PCR)

cDNA equivalent to 10 ng RNA was amplified using the Takara Premix Ex Taq (Takara-Bio, Europe/SAS, Saint-Germain-en-Laye, France). The primer combination HMGA2-846F1 and HMGA2-1021R1 was used to amplify the region between exons 1 and 3, whereas the primer combination HMGA2-846F1 and HMGA2-1112R1 was used for exons 1 to 5. Expression of the housekeeping gene ABL1 was monitored as the internal control. The PCR cycling program for both HMGA2 and ABL1 was as follows: 30 sec at 94°C, followed by 35 cycles of 7 sec at 98°C and 2 min at 68°C and a final step at 68°C for 5 min. The RT-PCR products were analyzed by electrophoresis. The primers HMGA1-284F1 and HMGA1-648R1 were used to amplify the HMGA1 transcript. The PCR cycling program for HMGA1 was as follows: 30 sec at 94°C followed by 35 cycles of 7 sec at 98°C, 30 sec at 55°C, 60 sec at 72°C and a final extension for 2 min at 72°C.

3′ Rapid amplification of cDNA ends - PCR (3′RACE-PCR)

For 3′-RACE-PCR, 100 ng of total RNA were reverse-transcribed in a 20 μl reaction volume with A3RNV-RACE as a primer and using the iScript Select cDNA Synthesis kit according to the manufacturer’s instructions (Bio-Rad Laboratories). One microliter was used as a template and amplified using the outer primer combination HMGA2-846F1/A3R-1New. One microliter of the amplified products was used as template in nested PCR with the primers HMGA2-982F1 and A3R3. For both PCRs the 25 μl reaction volume contained 12.5 μl of Premix Ex Taq (Takara-Bio), template and 0.4 μM of each of the forward and reverse primers. PCR cycling consisted of an initial step of denaturation at 94°C for 30 sec followed by 35 cycles of 7 sec at 98°C, 30 sec at 55°C, 90 sec at 72°C and a final extension for 5 min at 72°C. The PCR products were analyzed by electrophoresis, purified and sequenced.

Polymerase chain reaction (PCR)

IDH1 and IDH2

DNA was first amplified in a 25 μl reaction volume using Takara Premix Ex Taq and 1 μl of the primer combination IDH1-rs1-86F and IDH1-rs1-321R for IDH1, and IDH2-rs12-42F and IDH2-rs12-315R for IDH2. The thermal cycling for IDH1 included an initial step at 94°C for 30 sec, followed by 35 cycles at 98°C for 7 sec, 55°C for 30 sec, 1 min at 77°C, followed by a final step at 68°C for 5 min. The thermal cycling for IDH2 was set to 94°C for 30 sec, followed by 35 cycles of 7 sec at 98°C, 30 sec at 58°C, 1 min at 77°C and a final step at 68°C for 5 min. The PCR products were analyzed by electrophoresis, purified, and sequenced. Mutated and wild-type plasmids for IDH1 and IDH2 were used to check the accuracy of our analyses. The mutated plasmids harbored the mutations IDH1R132 and IDH2R172 for IDH1 and IDH2, respectively. Serial dilutions up to 10% of mutated/wild-type plasmids were analyzed using the same protocol, giving informative results for all dilutions. IDH1 mutation was spotted even at the lowest concentration of the mutated plasmid (10%), whereas the IDH2 analysis showed that the mutation could be identified only at concentration >20%.

TERT

We amplified the TERT promoter region with PCR in order to detect the possible mutations −C228T and −C250T which correspond to positions 124 and 146 nt upstream of the TERT ATG start site (7), respectively. DNA was amplified in 25 μl PCR volume containing 1X PrimeSTAR GXL buffer (Takara bio), 200 μM of each dNTP, 0.4 μM of each of the primers, TERTpromF2 and the reverse primer TRETpromR2, 1.25 units of PrimeSTAR GXL DNA polymerase and 20 ng of genomic DNA. The PCR program started with an initial denaturation at 94°C for 30 sec, followed by 35 cycles of 7 sec at 98°C, 30 sec and 90 sec at 68°C and a final extension for 5 min at 68°C. The PCR products were analyzed by electrophoresis, purified and sequenced.

Methylation-specific PCR (MSP)

Methylation analysis of the MGMT promoter was performed using the primers and PCR conditions described by Esteller et al (8) (Table II).

Immunohistochemistry

Formalin-fixed paraffin-embedded sections from 23 samples were analyzed for protein expression of HMGA2 using the FLEX+ system (DakoA/S, Glostrup, Denmark). The procedures and the scoring approach were as reported by Hetland et al (10).

Results

Results of the gene analyses

A complete overview of the results for all the gene analyses is given in Table I.

HMGA1 and HMGA2 expression

The 12 tumors from which RNA was available were tested for expression of HMGA1 and HMGA2 giving informative results for all samples (Table I). The 3 samples from the normal vulva tissue used as controls showed no expression of HMGA2 but expression of HMGA1 (Fig. 1). The HMGA1 gene was expressed both in the 12 tumors and in the controls. For the HMGA2 gene, the samples were run for two parallel PCR reactions which amplified exons 1–3 and exons 1–5, respectively. Eight cases showed expression of HMGA2. Cases 1 and 2 showed expression of a truncated HMGA2, i.e., exons 1–3. 3′-RACE PCR was performed in search of possible fusion transcripts in these two cases, and analysis of the sequences revealed the presence in both of them of transcript variant 3 of HMGA2 (accession no. NM_001300918.1) (Fig. 2A). The HMGA2 variant 3 contains alternative 3′ coding region and 3′ UTR compared to the normal transcript; this explains why the transcripts found in case 1 and 2 could not be amplified by our primers. The HMGA2 protein expression status was further investigated by immunohistochemistry in the 23 tumors from which material was available (Table I). Four tumors (cases 8, 18, 22 and 23) were negative for HMGA2 immunostaining, but in all other cases HMGA2 expression was noted. Cases 8 and 13 showed contrasting/opposite results with the two methods used, RT-PCR analysis and immunohistochemistry. More specifically, case 8 was found negative for expression of HMGA2 by immunohistochemistry but positive by RT-PCR, whereas case 13 was found positive by immunohistochemistry but negative by RT-PCR. An additional RT-PCR analysis for the latter case was performed following the same protocol, but using a higher concentration of cDNA (30 ng instead of 10 ng) since the immunohistochemistry was positive but with a low score (1–10). We then observed that HMGA2 was also expressed in case 13 in its entire length (Fig. 2B). The opposite results obtained in case 8 may be due to different part of the biopsy being used for molecular analyses and/or immunohistochemistry.
Figure 1

HMGA2 and HMGA1 expression detected in vulva tumors and normal controls. (A) RT-PCR using primers for the exon 1–3 region of HMGA2 for 12 tumors and three normal vulva tissues. Lane M, 1 kb Plus DNA ladder (GeneRuler, Fermentas); lane Ctr, positive control. (B) RT-PCR amplification using primers for exon 1–5 region of HMGA2. (C) RT-PCR for HMGA1.

Figure 2

(A) Chromatogram of the HMGA2 variant 3 found in cases 1 and 2 showing the junction between exon 4 and exon 5. (B) HMGA2 RT-PCR analyses for case 13. Lane M, 1 kb Plus DNA ladder (GeneRuler, Fermentas); lane 1, RT-PCR using primers for exon 1–3 region of HMGA2; lane 2, RT-PCR using primers for exon 1–5 region of HMGA2; lane 3: ABL1 PCR used as the control.

TERT

All of the 24 cases from which DNA was extracted were analyzed for mutations in the promoter region of TERT. Five tumors (cases 7, 8 and 10–12) showed the C228T. Case 5 showed a C254T unclassified variant.

IDH1 and IDH2 mutation

Twenty-four samples were analyzed for mutations in IDH1 and IDH2. More precisely, the following mutation sites were investigated: IDH1R100, IDH1R109 and IDH1R132 of IDH1 and IDH2R140, IDH2R149 and IDH2R172 of IDH2. All gave informative results whereas only one sample, case 4 was positive for the SNPI DH1G105.

MGMT

We assessed MGMT promoter methylation using MSP of the 24 samples from which DNA was extracted. All of the tumors gave informative results; however, only one tumor, case 7, was found to have MGMT promoter methylation.

Discussion

The high-mobilty group AT-hook proteins are non-histone proteins involved in a wide variety of nuclear processes from chromatin dynamics to gene regulation; there are two proteins belonging to this group, HMGA1 and HMGA2. The HMGA family genes are expressed during embryonic development (11) but are largely unexpressed in adult normal tissues (12). However, high expression levels of HMGA2 have been noted in different benign tumors such as lipomas (9), pleiomorphic adenomas of the salivary gland (13), uterine leiomyomas (14) and lung hamartomas (15). In these tumors, HMGA2 was found disrupted due to rearrangement of chromosome arm 12q. The alterations involve exon 3 and cause deletion of downstream regions leading to a truncated transcript that can evade gene silencing. Alternatively, chromosomal rearrangement of 12q13–15 may lead to formation of a fusion gene. In order to detect a truncated transcript of HMGA2, if present, we used two sets of primers for parallel amplification of our samples, one for exons 1–3 and one for exons 1–5. We found a truncated gene in cases 1 and 2 leading to the expression of exons 1–3. We further characterized these transcripts by 3′RACE-PCR searching for possible fusion partners. The karyotypic data on both tumors were normal, so possibly a cryptic rearrangement involving chromosome 12 may be present; alternatively, the cells carrying the chromosomal aberration of interest did not divide in vitro. Sequence analysis of the transcripts showed the HMGA2 splicing variant 3 in both cases. Moreover, immunohistochemistry analysis revealed that HMGA2 was expressed in the majority of tumors, SCC as well as MM (Fig. 3).
Figure 3

Immunohistochemistry of HMGA2 in vulva tumors. (A) HMGA2 immunostaining of case 5, an SCC (x50, magnification). (B) HMGA2 immunostaining of case 20, a vulvar MM (x50, magnification). Inset shows immunohistochemistry at a higher magnification (x200). SCC, squamous cell carcinoma; MM, malignant melanoma.

This is the first time that expression of the HMGA2 gene has been assessed in tumors of the vulva. The finding that the entire transcript is expressed in 83% of the samples (including the two cases with the variant form of the gene) give a hint that the gene may be involved in tumorigenesis or tumor progression. Expression of HMGA2 has hitherto mostly been noted in benign tumors with only sparse or anecdotal information on expression in malignant ones (16). The finding of 20 out of 24 malignant vulvar tumors, both SCC and MM, showing HMGA2 expression therefore was unexpected. Unfortunately, we did not have sufficient material to investigate for HMGA2 expression in the only premalignant lesion, the AH, of the present series. TERT is the gene for the telomerase reverse transcriptase. Its involvement in cancer is well known and many studies have shown that mutations in the promoter region can increase telomerase expression (7). We focused on the most frequent mutations, i.e., C228T and C250T, which have been noted in a large number of tumors of different types (17). These mutations introduce a new binding site (TTCCGG) for members of the E-twenty-six/ternary complex factor (Ets/TCF) transcription factor family (17). The C228T mutation was found in 5 of the 6 cases with mutation (out of 24 tumors analyzed). Despite the low frequency of the TERT mutation in tumors of the vulva, 25%, it may be important in a subset of SCC. Notably, a single nucleotide variant, C254T, was identified in case 5. This variant/mutation has not been previously reported. Its location is close to the C228T mutation; however, it is not involved in the formation of a new binding site for Ets/TCF. Unfortunately, we did not have material from either normal tissue or blood from this patient and so we could not establish whether the variant was a germ line polymorphism, a rare normal trait or a new cancer-associated mutation. The IDH1 and IDH2 genes express two forms of isocitrate dehydrogenase. Mutations in one of these genes can lead to an enzyme that produces 2-hydroxyglutarate. This metabolite is an inhibitor of α-ketoglutarate-dependent oxygenases, whose impaired activity can cause genome-wide methylations that have an impact on the expression of various genes. Mutations in IDH1 and/or IDH2 have been identified in gliomas (6) as well as in hematological malignancies (18). Our analyses showed no mutations of these genes in vulva tumors. SNP IDH1G105, an adverse prognostic factor in CN-AML (19), was present in only a single tumor (case 4). IDH1 and IDH2 are probably not involved in vulvar tumorigenesis. MGMT encodes O6-methylguanine DNA methyltranferase, a DNA repair enzyme that removes alkyl adducts from the O6-position of guanine. Expression of this gene can lead to resistance against alkylating cytostatics. Methylation of the MGMT promoter makes the cells more sensitive to alkylating drugs as was demonstrated in different type of cancer, not least gliomas (20). Due to its efficacy as a prognostic and predictive tumor marker, the assessment of MGMT promoter methylation status has become one of the most requested analyses for gliomas (21). Our analysis found this gene altered in only a single sample, suggesting that methylation of the MGMT promoter of is not a frequent event in vulvar tumorigenesis.
  21 in total

Review 1.  TERT promoter mutations in cancer development.

Authors:  Barbara Heidenreich; P Sivaramakrishna Rachakonda; Kari Hemminki; Rajiv Kumar
Journal:  Curr Opin Genet Dev       Date:  2013-12-20       Impact factor: 5.578

2.  Clinicopathologic study of 85 cases of melanoma of the female genitalia.

Authors:  Win J Tcheung; Maria A Selim; James E Herndon; Amy P Abernethy; Kelly C Nelson
Journal:  J Am Acad Dermatol       Date:  2012-01-13       Impact factor: 11.527

3.  HMGI-C expression patterns in human tissues. Implications for the genesis of frequent mesenchymal tumors.

Authors:  P Rogalla; K Drechsler; G Frey; Y Hennig; B Helmke; U Bonk; J Bullerdiek
Journal:  Am J Pathol       Date:  1996-09       Impact factor: 4.307

4.  Gene fusion involving HMGIC is a frequent aberration in uterine leiomyomas.

Authors:  N Mine; K Kurose; H Nagai; D Doi; Y Ota; K Yoneyama; H Konishi; T Araki; M Emi
Journal:  J Hum Genet       Date:  2001       Impact factor: 3.172

Review 5.  O6-alkylguanine-DNA alkyltransferase: role in carcinogenesis and chemotherapy.

Authors:  Geoffrey P Margison; Mauro F Santibáñez-Koref
Journal:  Bioessays       Date:  2002-03       Impact factor: 4.345

6.  TERT promoter mutations occur frequently in gliomas and a subset of tumors derived from cells with low rates of self-renewal.

Authors:  Patrick J Killela; Zachary J Reitman; Yuchen Jiao; Chetan Bettegowda; Nishant Agrawal; Luis A Diaz; Allan H Friedman; Henry Friedman; Gary L Gallia; Beppino C Giovanella; Arthur P Grollman; Tong-Chuan He; Yiping He; Ralph H Hruban; George I Jallo; Nils Mandahl; Alan K Meeker; Fredrik Mertens; George J Netto; B Ahmed Rasheed; Gregory J Riggins; Thomas A Rosenquist; Mark Schiffman; Ie-Ming Shih; Dan Theodorescu; Michael S Torbenson; Victor E Velculescu; Tian-Li Wang; Nicolas Wentzensen; Laura D Wood; Ming Zhang; Roger E McLendon; Darell D Bigner; Kenneth W Kinzler; Bert Vogelstein; Nickolas Papadopoulos; Hai Yan
Journal:  Proc Natl Acad Sci U S A       Date:  2013-03-25       Impact factor: 11.205

7.  Cancer statistics, 2013.

Authors:  Rebecca Siegel; Deepa Naishadham; Ahmedin Jemal
Journal:  CA Cancer J Clin       Date:  2013-01-17       Impact factor: 508.702

8.  Cytogenetic characterization of tumors of the vulva and vagina.

Authors:  Francesca Micci; Manuel R Teixeira; Marit Scheistrøen; Vera M Abeler; Sverre Heim
Journal:  Genes Chromosomes Cancer       Date:  2003-10       Impact factor: 5.006

9.  Genomic aberration patterns and expression profiles of squamous cell carcinomas of the vulva.

Authors:  Francesca Micci; Ioannis Panagopoulos; Lisbeth Haugom; Hanne-Sofie S Dahlback; Maria E Pretorius; Ben Davidson; Vera M Abeler; Claes G Tropé; Håvard E Danielsen; Sverre Heim
Journal:  Genes Chromosomes Cancer       Date:  2013-02-12       Impact factor: 5.006

10.  Sequencing IDH1/2 glioma mutation hotspots in gliomas and malignant peripheral nerve sheath tumors.

Authors:  Annette B Håvik; Guro E Lind; Hilde Honne; Torstein R Meling; David Scheie; Kirsten S Hall; Eva van den Berg; Fredrik Mertens; Piero Picci; Ragnhild A Lothe; Sverre Heim; Petter Brandal
Journal:  Neuro Oncol       Date:  2013-12-04       Impact factor: 13.029

View more
  10 in total

1.  A novel truncated form of HMGA2 in tumors of the ovaries.

Authors:  Antonio Agostini; Ioannis Panagopoulos; Ben Davidson; Claes Goran Trope; Sverre Heim; Francesca Micci
Journal:  Oncol Lett       Date:  2016-06-29       Impact factor: 2.967

2.  Molecular characterization of the t(4;12)(q27~28;q14~15) chromosomal rearrangement in lipoma.

Authors:  Antonio Agostini; Ludmila Gorunova; Bodil Bjerkehagen; Ingvild Lobmaier; Sverre Heim; Ioannis Panagopoulos
Journal:  Oncol Lett       Date:  2016-07-08       Impact factor: 2.967

3.  Expressions of miR-30c and let-7a are inversely correlated with HMGA2 expression in squamous cell carcinoma of the vulva.

Authors:  Antonio Agostini; Marta Brunetti; Ben Davidson; Claes G Trope; Sverre Heim; Ioannis Panagopoulos; Francesca Micci
Journal:  Oncotarget       Date:  2016-12-20

4.  Recurrent fusion transcripts in squamous cell carcinomas of the vulva.

Authors:  Marta Brunetti; Antonio Agostini; Ben Davidson; Claes G Tropé; Sverre Heim; Ioannis Panagopoulos; Francesca Micci
Journal:  Oncotarget       Date:  2017-03-07

5.  YAP1 Promotes Tumor Invasion and Metastasis in Nasopharyngeal Carcinoma with Hepatitis B Virus Infection.

Authors:  Zeli Huang; Bojin Su; Fang Liu; Ning Zhang; Yilong Ye; Yang Zhang; Zhenghe Zhen; Shaoqiang Liang; Shaobo Liang; Lushi Chen; Weijun Luo; François X Claret; Ying Huang; Tao Xu
Journal:  Onco Targets Ther       Date:  2020-06-17       Impact factor: 4.147

6.  Synergistic interactions between Cajal bodies and the miRNA processing machinery.

Authors:  Madelyn K Logan; Douglas M McLaurin; Michael D Hebert
Journal:  Mol Biol Cell       Date:  2020-05-20       Impact factor: 4.138

7.  DNA methylation markers for cancer risk prediction of vulvar intraepithelial neoplasia.

Authors:  Nikki B Thuijs; Johannes Berkhof; Müjde Özer; Sylvia Duin; Annina P van Splunter; Barbara C Snoek; Daniëlle A M Heideman; Marc van Beurden; Renske D M Steenbergen; Maaike C G Bleeker
Journal:  Int J Cancer       Date:  2021-01-10       Impact factor: 7.396

8.  Involvement of DPP9 in gene fusions in serous ovarian carcinoma.

Authors:  Marianne Lislerud Smebye; Antonio Agostini; Bjarne Johannessen; Jim Thorsen; Ben Davidson; Claes Göran Tropé; Sverre Heim; Rolf Inge Skotheim; Francesca Micci
Journal:  BMC Cancer       Date:  2017-09-11       Impact factor: 4.430

9.  Hepatitis B virus X protein promotes epithelial-mesenchymal transition and metastasis in hepatocellular carcinoma cell line HCCLM3 by targeting HMGA2.

Authors:  Yong Zha; Qian Yao; Jin-Sheng Liu; Yuan-Yuan Wang; Wei-Ming Sun
Journal:  Oncol Lett       Date:  2018-08-23       Impact factor: 2.967

10.  Modelling TERT regulation across 19 different cancer types based on the MIPRIP 2.0 gene regulatory network approach.

Authors:  Alexandra M Poos; Theresa Kordaß; Amol Kolte; Volker Ast; Marcus Oswald; Karsten Rippe; Rainer König
Journal:  BMC Bioinformatics       Date:  2019-12-30       Impact factor: 3.169

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.