Literature DB >> 25821316

Effects of combination of aliskiren and pentoxyfylline on renal function in the rat remnant kidney model of chronic renal failure.

Hitesh M Soni1, Praful P Patel2, Savan Patel3, Akshyaya C Rath1, Aviseka Acharya1, Harshkant D Trivedi3, Mukul R Jain1.   

Abstract

OBJECTIVES: The aim was to investigate the nephroprotective effect of combination of aliskiren (ASK), a direct renin inhibitor and pentoxifylline (PTX), inhibitor of tumor necrotic factor-alpha (TNF-alpha), in rat remnant kidney model of chronic kidney disease (CKD).
MATERIALS AND METHODS: Nephrectomized (NPX) rats were treated with ASK (10 mg/kg, p.o.), PTX (100 mg/kg, p.o.), and combination of PTX + ASK once daily for 28 days. We have performed analysis of various renal injury parameters after 4 weeks of treatment.
RESULTS: Treatment with PTX, ASK and combination showed significant improvement in urea, creatinine and total protein in plasma when compared with vehicle treated group in NPX rats. ASK and combination of PTX + ASK elicited significant reduction in blood pressure but PTX alone did not produce blood pressure reduction. ASK treatment showed significant elevation in TNF-alpha, whereas PTX and ASK + PTX showed significant reduction in TNF-alpha in plasma. Histopathologically, the extent of the kidney injury was similar in NPX + vehicle and NPX + ASK-treated rats. PTX and ASK + PTX-treated group showed lesser extent of kidney injury. There was good correlation of mRNA expression levels of kidney injury molecule-1 and bradykinin B1 receptor data with histopathological findings in kidney samples and elevated TNF-alpha levels in plasma.
CONCLUSIONS: We conclude that combination of PTX + ASK may be better therapeutic intervention for nephroprotection in CKD patients.

Entities:  

Keywords:  Aliskiren; bradykinin B1 receptor; chronic kidney disease; kidney injury molecule-1; nephroprotection; pentoxyfylline

Mesh:

Substances:

Year:  2015        PMID: 25821316      PMCID: PMC4375824          DOI: 10.4103/0253-7613.150351

Source DB:  PubMed          Journal:  Indian J Pharmacol        ISSN: 0253-7613            Impact factor:   1.200


Introduction

Chronic kidney disease (CKD) has become a global public health problem. Hypertension is closely associated with CKD, and it has been reported that 70% of patients with higher serum creatinine, ≥1.6 mg/dL for men and ≥1.4 mg/dL for women, are hypertensive.[1] Numerous studies have demonstrated that the renin-angiotensin-aldosterone system (RAAS) plays a significant role in the progression of CKD. Nephroprotection has been addressed by dual RAAS blockade with angiotensin-converting enzyme inhibitors (ACEIs) and angiotensin II receptor blockers (ARBs) together. This strategy is currently being used by many nephrologists as it has been shown to decrease proteinuria and slow kidney disease progression more effectively than monotherapy.[2] However, such combination therapy associated with an increased risk of side-effects such as hypotension, acute renal failure, and hyperkalemia compared with monotherapy.[3] The direct renin inhibitor (DRI), aliskiren (ASK) is recently approved by USFDA for the treatment of hypertension in patients. However, when used in combination with an ACEIs in a diabetic population, hyperkalemia was more frequent.[4] Minor increases in blood urea nitrogen (BUN) or serum creatinine were observed in some patients treated with ASK alone. Subjects with significant renal dysfunction, dialysis, nephrotic syndrome or renovascular hypertension were excluded from clinical trials of ASK in hypertension thus caution is required when prescribing the drug in such patients.[5] ASK's current licensed indication is for the treatment of essential (primary) hypertension. A warning to avoid the use of ASK with ARBs or ACEIs has been added for patients with moderate to severe kidney impairment. Therefore, there is an urgent need to investigate DRIs in these special conditions. Pentoxifylline (PTX) is in use since decades in the treatment of peripheral and cerebral vascular diseases because of its potent hemorrheological and anti-inflammatory properties.[6] Based on these literature evidences, we hypothesized that the combination of ASK and PTX may provide nephroprotection by multi-factorial approach involving antihypertensive and anti-inflammatory properties. Further, we extended our work to understand the mechanism (s) of the proposed combination therapy.

Materials and Methods

Chemicals

ASK was procured from U.S. Market and PTX from sigma chemicals (St. Louis, Mo., USA). The anesthetics ketamin (KETMIN, 50 mg, Themis Medicare Limited, Uttarakhand, India) and xylazine (20 mg, Indian Immunologicals Limited, Andhra Pradesh, India) were obtained from the local market. Rat tumor necrotic factor-alpha (TNF-alpha) estimation was performed using ELISA kit (BD Bio-sciences, CA, USA).

Animals

Male Sprague-Dawley rats (6–8 weeks) weighing 200–250 g were maintained in AAALAC accredited facility and allowed free access to food and water. All studies were carried out in accordance with the “Guide for the Care and Use of Laboratory Animals”, 8th Edition (2011). The animals were housed in quiet rooms with 12:12–h light–dark cycle (07:00 a.m. to 07:00 p.m.). The protocol for use of animals for conducting this study has been reviewed and approved by the Institutional Animal Ethics Committee.

5/6 Nephrectomy Surgical Procedure

Procedure for 5/6 nephrectomy in rats was used as reported earlier.[7] Rats were anesthetized and a ventral midline incision into the abdomen was made. A piece of suture was placed around the each pole of the kidney at its 1/3 position and gently ligated around the kidney. The 1/3 kidney on each end was excised right beyond the ligatures. Hemostatic thrombin reagent applied on the remaining kidney to stop bleeding. The abdominal incision was closed. One week after the first step, animals were anesthetized and prepared as described earlier. The renal blood vessels and the ureter were tied using surgical suture. The kidney was then removed by transecting the vessels and ureter just distal to the tied spot. The incision was closed. Animals were allowed to recover and then kept into the cages. Duration of 4 weeks has been considered for the development of CKD after performing pilot experiments. Nephrectomized (NPX) animals were randomly assigned consisting of n = 13 animals per group after 4 weeks of last surgery. Of 13 animals, 4 animals from each group were used for invasive blood pressure measurement and then kidney samples from same animals were used for gene expression studies. We found almost 25% mortality rate in 5/6 NPX rats after 4 weeks of surgery.

Experimental Protocol

Sprague-Dawley rats were divided randomly on body weight basis in to five groups as follows: Group 1: Sham control group treated with vehicle Group 2: NPX control group treated with vehicle Group 3: NPX rats treated with ASK (10 mg/kg, p.o.) Group 4: NPX rats treated with PTX (100 mg/kg, p.o.) Group 5: NPX rats treated with ASK (10 mg/kg, p.o.) +PTX (100 mg/kg, p.o.). We did pilot experiment to select dose of ASK and PTX using similar experimental protocol. We found that ASK (10 mg/kg, p.o.) was sufficient to achieve significant reduction in blood pressure whereas PTX (100 mg/kg, p.o.) was effective for significant reduction of elevated TNF-alpha in nephrectomized rats. Selected doses were also reported in published literature.[89] All animals were treated once daily for 28 days and measurement of various parameters were performed on day 29. Drugs were suspended in 0.5% methylcellulose solution and volume of oral administration was 5 ml/kg.

Assessment of Kidney Function Parameters in Plasma

To determine the extent of kidney injury, levels of urea, creatinine and total protein in rat plasma were measured by commercially available kits and Roche/Hitachi Cobas c System (Roche Diagnostics Corp. Indianapolis, IN, USA).

Estimation of Tumor Necrosis Factor-alpha in Rat Plasma

Tumor necrotic factor-alpha levels in rat plasma were detected by ELISA kit as per manufacturer's instruction (BD Biosciences, Pharmingen, Bedford, USA) and levels were calculated from the standard curve.

Blood Pressure Measurement by Invasive Method

Animals were anesthetized, and a midline cervical incision was made on the ventral side of the neck, and left carotid artery was isolated by blunt dissection. Cannulation of the left carotid artery was performed using Polyethylene tubing-PE50 and connected with the pressure transducer of BIOPAC system (Biopac-MP 100; Biopac, Santa Barbara, CA, USA). Animals were allowed to stabilize for 30 min. Mean arterial blood pressure of each animal was recorded for 10 min using acknowledge data acquisition software. A portion of the kidney of each group was dissected; snap frozen in liquid nitrogen cylinder for mRNA expression study at the end of blood pressure experiment.

Assessment of Hematological Parameters

Blood samples from anaesthetized rats were collected from retro-orbital route in micro-centrifuge tubes containing 5% ethylenediaminetetraacetate as an anticoagulant. All samples were analyzed for red blood cells (RBC), hemoglobin (Hb) and hematocrit (HCT) using cell-dyn 3700 (Abbott Diagnostics, IL, USA) analyzer.

Histopathological Examination of Kidney Sections

At the end of study period, animals were sacrificed, and kidney samples were collected and fixed in 10% neutral buffered formalin. Kidney sections were stained with routine hematoxylin and eosin stain (H and E). In addition, kidney sections were also stained with periodic acid-Schiff stain (PAS) to study glomerulosclerosis, tubular atrophy, and basement membrane thickening. Images of representative fields were acquired under an Olympus Provis AX-70 microscope (Olympus, Lake Success, NY, USA) equipped with a Spot RT color digital camera. Examinations were performed in a blinded manner. The degree of sclerosis within the glomerular tuft as an index of renal damage progression was determined on PAS-stained paraffin sections, adopting the semi-quantitative scoring system proposed by El Nahas et al.[10]

Kidney Injury Molecule-1 and Bradykinin B1 Receptor mRNA Expression In Kidney

Total RNA was prepared from kidney tissues (n = 4) by the trizol reagent (Invitrogen, Carlsbad, CA, USA). Quantitation of total RNA was performed using BioPhotometer and the quality of RNA was ascertained by measuring 260/280 ratio. The cDNA synthesis was performed using high capacity Reverse Transcriptase kit (Applied Biosystem, Foster City, CA, USA). All reactions were amplified in triplicate on an Applied Biosystems real-time PCR system in a 20-μl total volume containing a 1 × concentration SYBR Green Master Mix (Applied Biosystems, Foster City, CA), 1 μl primer, and 2 μl diluted cDNA. Thermocycling conditions were initiated at 95°C for 10 min, followed by denaturation at 95°C for 10 s, and annealing at 60°C for 30 s. The reverse and forward primer for kidney injury molecule-1 (KIM-1) and bradykinin B1 receptor (BKB1R), used in the current study were chosen from previously published literature. Primers sequence used for (i) acidic ribosomal phosphoprotein (RAP), forward: CCCATCAGCACCACAGCC, reverse: CTCCAAGCAGATGCAGCAGA (ii) KIM-1, forward: GTGAGTGGACCAGGCACACA, reverse: AATCCCTTGATCCATTGTTTTCTT and (iii) BKB1R, forward: GCA GCGCTTAACCATAGCGGAAAT, reverse: CCAGTTGAAACGGTTCCCGATGTT.[111213] All samples were normalized to acidic RAP amplified from the same samples to control for variations in sample quality.

Statistical Analysis

Results were expressed as mean ± SEM and data were analyzed by one-way ANOVA followed by Tukey's multiple comparison tests. All analysis were performed using GraphPad Prism software version 5.0. (GraphPad Prism Inc., La Jolla, CA, USA) P < 0.05 was considered as statistically significant.

Results

Effects of Drug Treatment on Urea, Creatinine and Total Protein in Rat Plasma

Nephrectomized rats showed significantly higher plasma levels of urea than sham-operated control group (P < 0.05). Long-term treatment with ASK (10 mg/kg p.o.), PTX (100 mg/kg, p.o.) and ASK + PTX in NPX rats revealed significant reduction in plasma urea when measured on day 29. Similarly, there was a significant increase in creatinine in plasma of NPX rats as compared to the Sham-operated control. All drug treatment groups showed significant improvement in creatinine when compared with NPX vehicle group. We found that there was a significant reduction in total protein in plasma samples of NPX animals. Total protein in drug-treated NPX animals was significantly higher than NPX + vehicle-treated group [Table 1].
Table 1

Effects of drug treatment on urea, creatinine, total protein, tumor necrotic factor alpha (TNF alpha), mean arterial pressure and indices of glomerulosclerosis in rats after once daily treatment for 28 days

Effects of drug treatment on urea, creatinine, total protein, tumor necrotic factor alpha (TNF alpha), mean arterial pressure and indices of glomerulosclerosis in rats after once daily treatment for 28 days

Effects of Drug Treatment on Plasma Level of Tumor Necrotic Factor-alpha

Nephrectomized + vehicle-treated rats showed elevation of TNF-alpha levels when compared to sham control vehicle-treated rats (P < 0.05). Interestingly, we found that NPX rats treated with ASK showed further elevation of TNF-alpha levels as compared to NPX vehicle control (P < 0.05). Treatment with PTX once daily for 28 days resulted in a significant reduction of TNF-alpha as compared to NPX + vehicle and NPX + ASK-treated groups. Treatment with ASK + PTX showed a significant reduction of TNF-alpha levels as compared to NPX + ASK-treated group [Table 1].

Effects of Drug Treatment on Mean Arterial Pressure

Nephrectomized + vehicle-treated rats showed significant elevation of mean arterial blood pressure as compared to Sham-operated vehicle control rats (P < 0.05) while ASK-treated NPX animals showed significant reduction in blood pressure as compared to NPX + vehicle-treated rats. Similarly, NPX rats treated with a combination of ASK and PTX showed a significant reduction in blood pressure as compared to NPX + vehicle-treated group (P < 0.05) [Table 1].

Effects of Drug Treatment on Hemoglobin, Red Blood Cell Count, and Hematocrit

Significantly lower levels of Hb were noticed in NPX vehicle-treated group as compared to sham-operated control. There was a significant improvement in Hb when NPX animals were treated once daily with ASK + PTX for 28 days. Similarly, there was a significant reduction in RBC and HCT in NPX + vehicle group as compared to Sham-operated vehicle control. Treatment with PTX and ASK + PTX in NPX animals produced significant improvement in RBC and HCT as compared to NPX vehicle control [Table 2].
Table 2

Effects of drug treatment on hemoglobin (Hb), RBC count and hematocrit after once daily treatment for 28 days in rat whole blood samples

Effects of drug treatment on hemoglobin (Hb), RBC count and hematocrit after once daily treatment for 28 days in rat whole blood samples

Effects of Drug Treatment on Histopathological Changes in Kidney Samples

Sections of rat kidney stained with H and E and PAS stain [Figures 1 and 2] were examined by light microscopy. Figures 1 and 2 show changes in the kidney parenchyma and glomerular changes in different groups, respectively. Figures 1a, b and 2a show normal kidney structure in Sham control vehicle-treated rats. Tubular dilatation, atrophy of kidney tubules, interstitial inflammatory cell infiltration, fibrosis [Figures 1c and d] and glomerulosclerosis [Figure 2b] were observed in NPX vehicle control rats. In NPX + ASK-treated animals, the extent of the kidney and glomerular injury was almost similar to NPX vehicle control group [Figures 1e, f and 2c]. PTX and ASK + PTX-treated groups showed lesser degree of tubular dilatation, atrophy of tubules, interstitial inflammatory cell infiltration, basophilic tubules, fibrosis and with improvement in glomerulosclerosis when compared to Sham control vehicle-treated group [Figures 1g–j, 2d and e]. NPX + vehicle and NPX + ASK-treated group showed a significant increase in the degree of renal damage as compared to sham-operated vehicle control group in PAS-stained kidney sections. Degree of renal damage (indices of glomerulosclerosis) was significantly less in NPX + PTX and NPX + PTX + ASK treated group as compared to NPX + vehicle-treated group [Table 1].
Figure 1

Representative sections of kidney showing changes from various groups (H and E, ×100). (a and b) Normal appearance of kidney from Sham control. (c and d) Represents morphological alterations in kidney from nephrectomized (NPX) vehicle control. It represents tubular dilatation, atrophy of kidney tubules, interstitial inflammatory cell infiltration and fibrosis. (e and f) Represents morphological alterations in kidney from NPX + aliskiren (ASK) treated rats and shows similar findings as c and d. Alteration in NPX kidney from pentoxifylline (PTX) (g and h) and combination of ASK + PTX (i and j) treated groups represented. These kidney sections (g-j) show lesser degree of injury as compared to NPXand ASK-treated groups

Figure 2

Glomerular morphology in various groups (PAS-stained, 400 X). (a) represented a sham operated animal and shows normal glomeruli. Vehicle control (b) and aliskiren (ASK) treated (c) glomeruli showing moderate to severe grades of glomerulosclerosis with obliteration of glomerular space and thickening of basement membrane marked by arrow. 5/6 NPX kidney glomeruli from pentoxifylline (PTX) (d); Combination of ASK + PTX (e) treated groups represented minimal grade of glomerulosclerosis

Representative sections of kidney showing changes from various groups (H and E, ×100). (a and b) Normal appearance of kidney from Sham control. (c and d) Represents morphological alterations in kidney from nephrectomized (NPX) vehicle control. It represents tubular dilatation, atrophy of kidney tubules, interstitial inflammatory cell infiltration and fibrosis. (e and f) Represents morphological alterations in kidney from NPX + aliskiren (ASK) treated rats and shows similar findings as c and d. Alteration in NPX kidney from pentoxifylline (PTX) (g and h) and combination of ASK + PTX (i and j) treated groups represented. These kidney sections (g-j) show lesser degree of injury as compared to NPXand ASK-treated groups Glomerular morphology in various groups (PAS-stained, 400 X). (a) represented a sham operated animal and shows normal glomeruli. Vehicle control (b) and aliskiren (ASK) treated (c) glomeruli showing moderate to severe grades of glomerulosclerosis with obliteration of glomerular space and thickening of basement membrane marked by arrow. 5/6 NPX kidney glomeruli from pentoxifylline (PTX) (d); Combination of ASK + PTX (e) treated groups represented minimal grade of glomerulosclerosis

Effects of Drug Treatment on mRNA Expressions of Kidney Injury Molecule-1 and Bradykinin B1 Receptor

We observed that NPX + vehicle group lead to significant fold increase in KIM-1 mRNA expression as compared to Sham-operated vehicle control (4.5 ± 1.1, n = 4 vs. 1.05 ± 0.15, n = 4, P < 0.05). NPX + ASK-treated group showed significantly higher fold of KIM-1 mRNA as compared to NPX + vehicle group (8.2 ± 0.5, n = 4 vs. 4.5 ± 1.1, n = 4, P < 0.05). Treatment with PTX showed significant reduction in KIM-1 when compared to NPX vehicle control rats. Combination of ASK + PTX elicited significant reduction of KIM-1 as compared to ASK-treated group in NPX rats. We also found that there was significant increase in BKB1R mRNA expression in NPX + Vehicle-treated rats as compared to Sham-operated vehicle control (2.8 ± 0.25, n = 4 vs. 1.2 ± 0.2, n = 4, P < 0.05). NPX + ASK-treated group showed further increase in BKB1R expression when compared to NPX + vehicle-treated group (4.6 ± 0.6, n = 4 vs. 2.8 ± 0.25, n = 4, P < 0.05). NPX rats treated with PTX and PTX + ASK showed significant reduction in BKB1R expression levels as compared to ASK-treated group. There was a trend of reduction in BKB1R expression in NPX + PTX and NPX + ASK + PTX groups as compared to NPX + vehicle-treated group but did not reach to statistically significant level [Figure 3].
Figure 3

Effects of drug treatment on mRNA expression of kidney injury molecule-1 and BKB1R. Values are normalized by using rat ribosomal acidic protein as internal reference standard. All values are expressed as mean ± SEM (n = 4). a indicates P < 0.05 as compared to Sham control vehicle-treated rats, b indicates P < 0.05 as compared to NPX + vehicle control group, c indicates P < 0.05 as compared to NPX + ASK group. NPX = Nephrectomized, ASK = Aliskiren, PTX = Pentoxifylline

Effects of drug treatment on mRNA expression of kidney injury molecule-1 and BKB1R. Values are normalized by using rat ribosomal acidic protein as internal reference standard. All values are expressed as mean ± SEM (n = 4). a indicates P < 0.05 as compared to Sham control vehicle-treated rats, b indicates P < 0.05 as compared to NPX + vehicle control group, c indicates P < 0.05 as compared to NPX + ASK group. NPX = Nephrectomized, ASK = Aliskiren, PTX = Pentoxifylline

Discussion

Chronic activation of the RAAS is a key factor in the pathophysiology of hypertension and cardio-renal diseases. Inhibition of the RAAS system with ACEIs and ARBs has been shown to lower blood pressure effectively, and improve cardio-renal outcomes in patients with hypertension, heart failure, post myocardial infarction, diabetes and nephropathies. ASK targets the RAAS at the point of activation and thereby, reduces plasma renin activity (PRA), whereas ARBs and ACEI stimulate large reactive rises in PRA.[14] Tumor necrotic factor-alpha is also an important cytokine participating in damage and inflammation in both animal and human renal diseases.[15] TNF-alpha production can be reduced by administration of PTX in CKD patients. In experimental models, PTX has also been shown to reduce interleukin-6 expression.[16] PTX can significantly reduce renal TNF-alpha expression, synthesis, and excretion during experimental diabetes.[17] PTX by itself does not have an impact on blood pressure or glomerular filtration rate; therefore, an antihypertensive agent may be useful to control blood pressure.[5] This makes PTX combined with a DRI ASK, a good candidate. To our knowledge, there are no published data regarding the renoprotective effects of combination of ASK and PTX in CKD condition. We found that the combination of ASK and PTX substantially improved renal injury in NPX rats. Unexpectedly, TNF-alpha levels in plasma was elevated in ASK alone treated NPX rats. According to a recent report, ASK is effective in a reduction of blood pressure, but has no effect on renal function in the rat model of chronic allograft injury.[18] It has been reported that Etanercept, a TNF-alpha inhibitor, showed renoprotection and recovery of serum BUN and creatinine levels in the mouse model of hepatic steatosis.[19] Treatment with a combination of ASK + PTX in nephrectomized rats showed a significant reduction in TNF-alpha as compared to NPX + ASK treated rats. People with CKD and those on dialysis due to end stage renal disease are more prone to develop renal anemia and therefore there is a need to raise Hb. ACEIs and ARBs may reduce Hb concentration in pediatric, renal transplant and hemodialysis populations.[20] It has been reported that elevation of Hb in anemic patients has been associated with decreased TNF-alpha concentration.[6] We found that NPX + vehicle-treated animals showed a reduction in Hb, that has been elevated in PTX and PTX + ASK-treated groups. Kidney injury molecule-1 represents a promising biomarker for the early diagnosis of acute kidney injury and its clinical outcomes.[21] We also found that KIM-1 has been significantly elevated in NPX + ASK treated group as compared to NPX + vehicle group, which was also in support with the data of TNF-alpha and histopathological changes in ASK alone group. Treatment with PTX and PTX + ASK showed reduction in KIM-1 mRNA expression as compared to ASK alone group. In contrast to the results of our present study, ASK has been reported to protect from diabetic nephropathy both in animal studies and in the clinical settings.[18] However, there are differences in molecular mechanisms of renal damage in diabetic nephropathy and CKD conditions. Very recently, Yamauchi et al. reported a clinical case of acute kidney injury caused by ASK and suggested that careful monitoring is necessary when ASK is used in patients with CKD, especially when there is a concomitant use of other RAAS inhibitors.[22] Venzim et al. have also reported a clinical case of ASK treatment associated with hyperkalemia.[23] It has been reported by Campbell et al. that ASK treatment lead to increase in bradykinin and kallikrein levels independent of renin inhibition.[24] Activity of bradykinin is dependent on two G-protein-coupled receptors, the BKB1R and BKB2R receptors. BKB2R is constitutive, expressed in most tissues and responsible for biological activity. On the other hand, BKB1R is inducible and overexpressed in inflammatory conditions.[25] We found that there was a significant increase in BKB1R mRNA levels in kidney samples of NPX + vehicle-treated and NPX + ASK-treated rats. Recently, it has been reported that inhibition of BKB1R is protective in animal models of acute and CKD.[26] Combination of PTX with ASK possibly controls the inflammatory conditions and lead to a reduction of detrimental BKB1R expression which may be responsible for renoprotective effect. However, there are few limitations of our study. We did not measure RAAS activity in our experiments. We have not studied our hypothesis in more advanced transgenic rats overexpressing human renin and human angiotensin. Therefore, we conclude that the combination of PTX and ASK may be a better therapeutic intervention in CKD patients as it has a considerable impact in reducing the elevated blood pressure and improvement in renal function. Therapeutic intervention should be based on either the discovery of better molecular targets for development of new drugs or on therapy optimization through drug combinations, such as a combination of PTX + ASK. We found that ASK alone causes more renal damage, and BKB1R overexpression may be responsible for this effect. Therefore, we also propose that the combination of ASK and BKB1R blocker may help to reduce renal damage in CKD condition. However, this argument needs further investigation. Safety and efficacy of PTX has been established since decades in patients, therefore, we strongly propose the combination of ASK + PTX for CKD patients in clinical settings.
  25 in total

1.  Delayed blockade of the kinin B1 receptor reduces renal inflammation and fibrosis in obstructive nephropathy.

Authors:  J Klein; J Gonzalez; J Duchene; L Esposito; J P Pradère; E Neau; C Delage; D Calise; A Ahluwalia; P Carayon; J B Pesquero; M Bader; J P Schanstra; J L Bascands
Journal:  FASEB J       Date:  2008-09-22       Impact factor: 5.191

2.  Aliskiren increases bradykinin and tissue kallikrein mRNA levels in the heart.

Authors:  Duncan J Campbell; Yuan Zhang; Darren J Kelly; Richard E Gilbert; Davis J McCarthy; Wei Shi; Gordon K Smyth
Journal:  Clin Exp Pharmacol Physiol       Date:  2011-09       Impact factor: 2.557

3.  Angiotensin II suppression in humans by the orally active renin inhibitor Aliskiren (SPP100): comparison with enalapril.

Authors:  Juerg Nussberger; Grégoire Wuerzner; Chris Jensen; Hans R Brunner
Journal:  Hypertension       Date:  2002-01       Impact factor: 10.190

4.  Bradykinin receptor 1 activation exacerbates experimental focal and segmental glomerulosclerosis.

Authors:  Rafael L Pereira; Bruna N Buscariollo; Matheus Corrêa-Costa; Patricia Semedo; Cassiano D Oliveira; Vanessa O Reis; Edgar Maquigussa; Ronaldo C Araújo; Tárcio T Braga; Maria F Soares; Ivan C Moura; Denise M A C Malheiros; Alvaro Pacheco-Silva Filho; Alexandre C Keller; Niels O S Câmara
Journal:  Kidney Int       Date:  2011-03-16       Impact factor: 10.612

5.  Kinin B1 receptor enhances the oxidative stress in a rat model of insulin resistance: outcome in hypertension, allodynia and metabolic complications.

Authors:  Jenny Pena Dias; Sébastien Talbot; Jacques Sénécal; Pierre Carayon; Réjean Couture
Journal:  PLoS One       Date:  2010-09-07       Impact factor: 3.240

6.  Aliskiren-associated acute renal failure with hyperkalemia.

Authors:  R M Venzin; C D Cohen; M Maggiorini; R P Wüthrich
Journal:  Clin Nephrol       Date:  2009-03       Impact factor: 0.975

7.  A rapid urine test for early detection of kidney injury.

Authors:  Vishal S Vaidya; Glen M Ford; Sushrut S Waikar; Yizhuo Wang; Matthew B Clement; Victoria Ramirez; Warren E Glaab; Sean P Troth; Frank D Sistare; Walter C Prozialeck; Joshua R Edwards; Norma A Bobadilla; Stephen C Mefferd; Joseph V Bonventre
Journal:  Kidney Int       Date:  2009-04-22       Impact factor: 10.612

8.  The effect of losartan on hemoglobin concentration and renal outcome in diabetic nephropathy of type 2 diabetes.

Authors:  A Mohanram; Z Zhang; S Shahinfar; P A Lyle; R D Toto
Journal:  Kidney Int       Date:  2007-12-19       Impact factor: 10.612

9.  Effects of aliskiren on blood pressure, albuminuria, and (pro)renin receptor expression in diabetic TG(mRen-2)27 rats.

Authors:  David L Feldman; Liang Jin; Hong Xuan; Aurelie Contrepas; Yinong Zhou; Randy L Webb; Dominik N Mueller; Sandra Feldt; Frederick Cumin; Wieslawa Maniara; Elke Persohn; Helmut Schuetz; A H Jan Danser; Genevieve Nguyen
Journal:  Hypertension       Date:  2008-05-19       Impact factor: 10.190

Review 10.  Present and future drug treatments for chronic kidney diseases: evolving targets in renoprotection.

Authors:  Norberto Perico; Ariela Benigni; Giuseppe Remuzzi
Journal:  Nat Rev Drug Discov       Date:  2008-10-10       Impact factor: 84.694

View more
  2 in total

1.  Liraglutide promotes autophagy by regulating the AMPK/mTOR pathway in a rat remnant kidney model of chronic renal failure.

Authors:  Lingyu Xue; Zhanglei Pan; Qiao Yin; Peng Zhang; Jing Zhang; Wenwen Qi
Journal:  Int Urol Nephrol       Date:  2019-09-17       Impact factor: 2.370

2.  Pentoxifylline plus ACEIs/ARBs for proteinuria and kidney function in chronic kidney disease: a meta-analysis.

Authors:  Dong Liu; Li-Na Wang; Hong-Xia Li; Ping Huang; Liang-Bo Qu; Fei-Yan Chen
Journal:  J Int Med Res       Date:  2017-01-01       Impact factor: 1.671

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.