Literature DB >> 25816242

Proteome analysis identifies the Dpr protein of Streptococcus mutans as an important factor in the presence of early streptococcal colonizers of tooth surfaces.

Akihiro Yoshida1, Mamiko Niki2, Yuji Yamamoto3, Ai Yasunaga4, Toshihiro Ansai4.   

Abstract

Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25816242      PMCID: PMC4376698          DOI: 10.1371/journal.pone.0121176

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The development of dental caries is a complex process which is dependent on a presence of microbial biofilm known as dental plaque [1]. Of the oral bacteria which compose the oral biofilm, Streptococcus mutans has been considered as the bacterial species most closely associated with initiation of human dental caries [2]. Oral bacteria form a biofilm on the tooth surface that accumulates through the sequential and ordered colonization of more than 500 different species of bacteria [2]. Bacteria comprise early, middle, or late colonizers that undergo successive attachment of saliva-suspended species to previously attached bacteria and form multispecies communities [3, 4]. Initial colonizers bind to host-derived receptors on the salivary pellicle of the tooth enamel. Of these bacteria, the oral commensals S. gordonii and S. sanguinis are representative pioneer colonizers of the pellicle [5, 6]. In addition, S. sanguinis and S. gordonii use oxygen and hydrogen peroxide (H2O2) to compete against S. mutans [7]. Moreover, the proteases of S. gordonii interfere with subsequent colonization by S. mutans [8] and bacteriocin production by S. mutans is also inhibited by S. gordonii [9]. Clinical studies have also indicated that S. sanguinis and S. gordonii can antagonize S. mutans colonization when present in oral biofilms in high numbers [10]. S. gordonii is a key pioneer colonizer and can also affect the initial attachment of S. mutans to the tooth surface. Studies have reported that interspecies interactions are mediated through chemicals (e.g., bacteriocin, H2O2, and protease) produced by S. gordonii [8, 11–14]. However, it is not yet fully understood how interspecies interactions with early streptococcal colonizers affect S. mutans colonization. Indeed, S. mutans still exists in the oral biofilms on tooth surfaces even when exposed to potential inhibitors produced by S. gordonii. The objectives of this study were to determine the resistance mechanisms of S. mutans relative to competition with S. gordonii in the initial stages of biofilm formation.

Materials and Methods

Bacterial strains and growth conditions

The S. mutans UA159, S. mutans GS5, S. gordonii DL1 (Challis), and their derivative strains used in this study are listed in Table 1. All strains were maintained aerobically (5% CO2) or in an anaerobic chamber (90% N2, 5% CO2, and 5% H2) at 37°C in brain heart infusion (BHI) medium (Becton Dickinson, Sparks, MD), Todd-Hewitt broth (THB, Becton Dickinson), or on THB agar plates. For biofilm formation, chemically defined medium (CDM) was used [15]. The CDM contained 2.0 g l−1of L-glutamic acid, 0.2 g l-1 of L-cysteine, 0.9 g l-1 of L-leucine, 1.0 g l-1 of NH4Cl, 2.5 g l-1 of K2HPO4, 2.5 g l-1 of KH2PO4, 4.0 g l-1 of NaHCO3, 1.2 g l-1 of MgSO4·7H2O, 0.02 g l-1 of MnCl2·4H2O, 0.02 g l-1 of FeSO4·7H2O, 0.6 g l-1 of sodium pyruvate, 1.0 mg l-1 of riboflavin, 0.5 mg l-1 of thiamine HCl, 0.1 mg l-1 of D-biotin, 1.0 mg l-1 of nicotinic acid, 0.1 mg l-1 of p-aminobenzoic acid, 0.5 mg l-1 of Ca-pantothenate, 1.0 mg l-1 of pyridoxal HCl, and 0.1 mg l-1 of folic acid, adjusted to pH 7.0 with H3PO4. For antibiotic selection, cultures were supplemented with the following antibiotics: 250 μg ml-1 spectinomycin for S. mutans, 10 μg ml-1 erythromycin for S. gordonii, and 100 μg ml-1 ampicillin for Escherichia coli.
Table 1

The strains and plasmids used in this study.

Strain or plasmidRelevant characteristicsSource or reference
Strains (original name)
Streptococcus mutans
UA159WT laboratory strain, Ems a KDU f
UA159 Δdpr UA159, dpr::Emr b This study
GS5WT laboratory strain, Ems KDU
GS5 Δdpr (DES)GS5, dpr::Spcr c [20]
GS5 Δdpr+dpr dpr complementation in GS5 Δdpr, Spcr, Emr, Kmr d (GS5 Δdpr harboring pAY1301)This study
GS5 Δsod (KD251)GS5, sod::Emr [20]
GS5 ΔahpC (BEE)GS5, ahpC::Emr::nox-1 [20]
GS5 Δdpr+ Δsod (KD251-DES)GS5, dpr::Spcr, sod::Emr [20]
GS5 Δdpr+ ΔahpC (BEE-DES)GS5, dpr::Spcr, ahpC::Emr::nox-1 [20]
Escherichia coli DH5αCloning host[39]
Streptococcus gordonii
DL1/ChallisWT laboratory strain, Ems KDU
DL1 ΔspxB DL1, spxB::Emr This study
Streptococcus oralis ATCC 10557Oral commensalRIKEN g
Streptococcus mitis ATCC 49456Oral commensalRIKEN
Streptococcus salivarius HHTOral commensalRIKEN
Streptococcus sanguinis ATCC 10556Oral commensalRIKEN
Actinomyces naeslundii JCM8350Oral commensalRIKEN
Plasmids
pDL276 Streptococcus-E. coli shuttle plasmid, Kmr [21]
pResEmMCS10 Streptococcus integration plasmid, Emr, Ampr e [40]
pAY1201pResEmMCS10 harboring the upstream and downstream regions of S. mutans UA159 dpr, Emr, Ampr This study
pAY2201pResEmMCS10 harboring the upstream and downstream region of S. gordonii DL1 spxB, Emr, Ampr This study
pAY1301pDL276 harboring S. mutans GS5 dpr and PCR-generated Emr gene, Emr, Kmr This study

Ems, erythromycin-sensitive.

Emr, erythromycin-resistant.

Spcr, spectinomycin-resistant.

Kmr, kanamycin-resistant.

Ampr, ampicillin-resistant

. KDU, Culture collection of the Division of Community Oral Health Science, Kyushu Dental University, Kitakyushu, Japan.

RIKEN, Microbe Division/Japan Collection of Microorganisms, RIKEN BioResource Center, Wako, Japan.

Ems, erythromycin-sensitive. Emr, erythromycin-resistant. Spcr, spectinomycin-resistant. Kmr, kanamycin-resistant. Ampr, ampicillin-resistant . KDU, Culture collection of the Division of Community Oral Health Science, Kyushu Dental University, Kitakyushu, Japan. RIKEN, Microbe Division/Japan Collection of Microorganisms, RIKEN BioResource Center, Wako, Japan.

DNA manipulations

Routine molecular biology techniques were basically performed as previously described [16]. PCR products were purified using a QIAquick PCR purification kit (QIAGEN, Valencia, CA). Chromosomal DNA was isolated from the bacteria listed in Table 1 using a Puregene DNA isolation kit (Gentra Systems, Minneapolis, MN). Nucleotide sequence information for S. mutans and S. gordonii were obtained from the Oral Pathogen Sequence Database (Los Alamos National Laboratory, http://www.oralgen.lanl.gov/).

Biofilm formation

S. mutans UA159 was inoculated with S. gordonii DL1 using a two-compartment system [17, 18] with a slight modification. Briefly, each well of a six-well polystyrene plate (Corning Inc., Corning, NY) was separated into two compartments using Nunc 25-mm Tissue Culture Inserts with 0.2-μl Anopore membranes (Nunc, Roskilde, Denmark). Each compartment contained CDM supplemented with 0.5% sucrose. S. gordonii DL1 was inoculated in the upper compartment, and S. mutans UA159 was inoculated in the lower layer. As controls, S. mutans was inoculated in both the upper and lower compartments. Each overnight culture was added to 3 ml CDM (culture:CDM = 1:30) and incubated at 37°C under anaerobic conditions for 24 h. The S. mutans biofilm in the lower compartment was then collected for analysis.

S. mutans whole-cell lysates

Samples to be subjected to two-dimensional gel electrophoresis (2-DE) were prepared using both chemical and mechanical extraction to ensure high yield and optimum solubility of whole-cell proteins. Biofilm cells on a six-well polystyrene plate (Corning) were harvested with a cell scraper (Asahi Glass, Tokyo, Japan) and washed four times with distilled water. The bacterial biofilm was suspended with 1.0 ml distilled water and disrupted using a Mini-Bead Beater (Biospec Products, Bartlesville, OK) with a 2 ml tube containing 0.1-mm-diameter silica sphere beads (Lysing Matrix B; MP Biomedicals LLC, Solon, OH) at 4800 rpm for 30 s. After disruption, the samples were cooled on ice for 3 min. This procedure was repeated five times. The aliquots were transferred to 1.5 mL tubes and centrifuged at 15,000 rpm for 5 min. The protein concentrations of the supernatant were measured (Quick Start Bradford Dye Reagent 1×; Bio-Rad, Hercules, CA) and the supernatant was subjected to acetone precipitation. A total of 200 μg protein per 1.5 ml tube was precipitated with 1.0 ml acetone and incubated at −30°C for more than 10 min. The samples were centrifuged at 15,000 rpm for 5 min, and the acetone was removed. Sample preparation was also performed with a 2-D Clean-Up Kit (GE Healthcare Bio-Sciences AB, Uppsala, Sweden), according to the manufacturer’s instructions.

2-DE. (i) Isoelectric focusing

Rehydration of Immobiline DryStrips (pH 4–7, 7 cm for preparative gels and 18 cm for analysis gels; GE Healthcare) and isoelectric focusing (IEF; first dimension) separation of proteins were performed using an Ettan IPGphor 3 system (GE Healthcare). The protein samples (120 μg for 7 cm and 300 μg for 18 cm) in DeStreak Rehydration Solution (130 μl for 7 cm and 320 μl for 18 cm, GE Healthcare) with IPG Buffer (pH 4–7, final 0.5% [vol/vol]; GE Healthcare) were loaded onto the strips. The strips were rehydrated and run in an Ettan IPGphor 3 instrument with an adequate length of strip holders (Ettan IPGphor 3 fixed-length strip holders, GE Healthcare). Rehydration was performed overnight at room temperature. The IEF parameters for 7-cm strips were as follows: (i) 0.5 h at 300 V (step and hold), (ii) 0.5 h at 1000 V (gradient), (iii) 5000 V for 1.5 h (gradient), and (iv) 5000 V for 36 min (step and hold). The IEF parameters for 18-cm strips were as follows: (i) 1 h at 500 V (step and hold), (ii) 1 h at 1000 V (gradient), (iii) 8000 V for 3 h (gradient), and (iv) 8000 V for 2 h 40 min (step and hold). All steps were performed at 20°C. (ii) SDS-PAGE. After IEF, the strips were initially equilibrated for 10 min with 10 ml SDS Equilibration buffer (50 mM Tris-HCl [pH 6.8]), 6 M urea, 30% [vol/vol] glycerol, 1% [wt/vol] SDS) containing 100 mg of dithiothreitol (threo-1,4-dimercapto-2,3-butanediol; DTT). Next, the strips were equilibrated for 10 min with 10 mL SDS Equilibration buffer containing 250 mg of iodoacetamide and 0.002% [wt/vol] bromophenol blue. Separation in the second dimension was carried out by standard SDS-PAGE by laying strips on 12.5% polyacrylamide gels (9 cm long × 1 mm wide × 8 cm high for 7-cm strips, and 20 cm long × 1.5 mm wide × 20 cm high for 18-cm strips) [19] for electrophoresis. The gels were stained with Coomassie brilliant blue G-250 (0.04% [wt/vol] Coomassie brilliant blue G-250, 3.5% [wt/vol] perchloric acid). Quantification of protein changes across triplicates of the two conditions analyzed were captured via image analysis using Progenesis/SameSpot image analysis software (Nonlinear Dynamics, Newcastle upon Tyne, UK), and the average data of each spot were compared between two conditions. The spots in which the Norm volume was more than 1.5-fold and the differences were significant (P < 0.05, ANOVA) were selected for comparison analysis. Definition of the Norm volume was as follows: Norm volume = (volume of each spot) / (volumes of all spots)] × 100.

MS analysis

Spots from the 2-DE analyses were submitted to in-gel proteolysis and LC-MS/MS (APRO Science, Tokushima, Japan). The gel pieces were washed twice and the proteins were dehydrated in the gel with acetonitrile, rehydrated with 10% acetonitrile in 10 mM Tris-HCl (pH 8.0) containing trypsin, and incubated at 35°C for 20 h. Tryptic peptides were resolved by reverse-phase chromatography on 0.1- × 50-mm fused silica capillaries (L-column ODS; Chemicals Evaluation and Research Institute [CERI], Tokyo, Japan). The peptides were eluted with linear gradients of 2% to 95% acetonitrile with 0.1% formic acid in water at flow rates of 0.5 μl/min. Mass spectroscopy (MS) was performed with an ion-trap mass spectrometer (Q-Tof2; Waters, Milford, MA) in positive mode using repetitive full MS scanning followed by collision-induced dissociation of the three most dominant ions selected from the first MS scan. Spot analysis was performed by LC-MS/MS combined with a search of the NCBInr database with Mascot software (Matrix Science Inc., Boston, MA).

Plasmid construction

The S. mutans dpr gene was identified in the database (Oral Pathogen Sequence Database), and the promoter information was obtained from a previous investigation [20]. For the complementation analysis of the S. mutans dpr strain, PCR products generated using the primers dprF-Sal (pDL276) and dprR-Bam (pDL276) were inserted into pDL276 at SalI and BamHI sites (Table 1, 2) [21]. To generate an erythromycin resistance gene, an erythromycin cassette was produced by PCR using the primer pair AM1 and AM3 [22]. The erythromycin cassette was ligated into pDL276 with the dpr fragment at the SmaI site; the resultant plasmid was designated pAY1301. To delete the S. mutans UA159 dpr gene, the plasmid was prepared as follows: Two fragments, up- and downstream of the dpr gene, were generated by PCR with the primers dprUF-Sal/dprUR-Pst and dprDF-Sac/dprDR-Kpn, respectively (Table 2). These products were cleaved with SalI/PstI and SacI/KpnI, respectively, and ligated into pResEmMCS10, resulting in pAY1201 (Table 1). To delete the S. gordonii DL1 spxB gene, which encodes the pyruvate oxidase SpxB protein, a plasmid was prepared as follows: two fragments, up- and downstream from the spxB gene, were generated by PCR with the primers spxBUF-Sal/spxBUR-Pst and spxBDF-Sac/spxBDR-Kpn, respectively (Table 2). These products were cleaved with SalI/PstI and SacI/KpnI, respectively, and ligated into pResEmMCS10, resulting in pAY2201 (Table 1).
Table 2

Primers used in this study.

PrimerSequence a (5’→3’)Gene targeted
dprUF-SalGGGGGGGTCGACGAGGATTTGTCTACGCTG S. mutans dpr
dprUR-PstGGGGGGCTGCAGCCTGATTAAGTACAGCC
dprDF-SacGGGGGGGAGCTCATGTTGCAGGCAGAGCTT S. mutans dpr
dprDR-KpnGGGGGGGGTACCGTTCCTACCTCTTGGGTA
dprF-Sal (pDL276)GGGGGGGTCGACAATCAGTCCGCAGAGTAA S. mutans dpr
dprR-Bam (pDL276)GGGGGGGGATCCTTATAAACCGGGAGCTTG
spxBUF-SalCCCCCCGTCGACGTGATTGGCTTGATTGCC S. gordonii spxB
spxBUR-Pst b CTGATGGGATACCGTAGA
spxBDF-SacGGGGGGGAGCTCGCCTCTTCTTGGAAGAAG S. gordonii spxB
spxBDR-KpnGGGGGGGGTACCACACGCTACCATCTTCTG
AM1 (Sma)CCCCCCGGGGAAGGAGTGATTACATGAACErythromycin cassette
AM3 (Sma)CCCCCCGGGAGCGACTCATAGAATTATTTC
RT-qPCR
dprFGTTCACCAAGTCCATTGG S. mutans dpr
dprRAAGGTTGAAAACGGAGCG
sodFTGGAACAAATTCCAGCGG S. mutans sod
sodRGCAGCTGTAAAAGCTGCT
ahpCFCGTGTGTCCTACTGAGTT S. mutans ahpC
ahpCRTGAGAAGGATCCCCAATC
gyrAFATTGTTGCTCGGGCTCTTCCAG S. mutans gryA
gyrARATGCGGCTTGTCAGGAGTAACC

Endonuclease restriction sites are underlined.

Restriction sites were not included.

Endonuclease restriction sites are underlined. Restriction sites were not included.

Transformation of S. mutans and S. gordonii

The S. mutans UA159 Δdpr strain was constructed by allelic exchange via insertion of an erythromycin resistance determinant into the gene. The plasmid pAY1201 (Table 1), used for disruption of the dpr gene, was prepared as previously described. S. mutans Δdpr strains containing pAY1301 were obtained by electrotransformation (Table 1) [23]. Genetic transformation of S. gordonii with linearized pAY2201 and synthetic CSP was performed as previously described (Table 1) [23]. The amino acid sequence of synthetic S. gordonii competence stimulating peptide (CSP) is DVRSNKIRLWWENIFFNKK (SIGMA Life Science, Ishikari, Japan) [24].

Western blot analysis

Proteins from various extracts were resuspended in 5× Laemmli sample buffer [19]. Protein samples were separated by SDS-PAGE and electrotransferred to a polyvinylidene difluoride membrane. The membrane was blocked with TBS with 1% nonfat milk, reacted with a rabbit anti-S. mutans Dpr antibody, and subsequently developed with goat anti-rabbit IgG antibody conjugated to alkaline phosphatase [25]. The anti-Dpr antibodies were prepared from a rabbit immunized with the S. mutans Dpr preparation [25]. For the quantification of specific protein expression, total protein measurement was performed [26, 27].

Competition assays on agar plates

Competition assays were basically performed as previously described with some modifications [7, 28]. Briefly, 5 μl of an overnight culture of either species adjusted to an optical density at 595 nm (OD595) of 0.5 in BHI was spotted on THB agar plates as the early colonizer. After overnight inoculation, 5 μl samples of S. mutans strains (3.5 × 106 CFU) were spotted adjacent to the early colonizer strains, or both strains were simultaneously inoculated beside each other. The distance between the centers of the spots was 8 mm. The plates were further incubated at 37°C in anaerobic or aerobic (with or without 5% CO2, respectively) chambers.

H2O2 sensitivity assay on agar plates

Various concentrations of 5 μl H2O2 were spotted on the THB agar plate, and 5 μl S. mutans strains (3.5 × 106 CFU) were spotted adjacent to the H2O2. The distance between the centers of the spots was 8 mm.

Transcriptional analysis by qPCR

S. mutans biofilm was collected and served for transcriptional analysis. Total RNA was extracted from S. mutans cells using by Isogen (Nippon Gene, Co. Ltd., Tokyo, Japan) according to manufacturer’s protocol. Reverse transcriptase reactions were performed by using ReverTra Ace (MMLV Reverse Transcriptase RNaseH-; Toyobo Co., Ltd., Osaka, Japan). The primer pairs used are listed in Table 2. The DNA gyrase A subunit (gyrA) was stably expressed and used as the internal control. Data were analyzed for statistically significant differences from the S. mutans alone control.

S. mutans viability assay

To examine the viability of S. mutans strains after co-inoculation with S. gordonii, we inoculated pure cultures of S. gordonii overnight. A total of 10 ml overnight pure culture (OD595 = 0.8) was centrifuged, the supernatant was removed, and 9 ml fresh BHI medium were added to the bacterial pellet and the pellet was resuspended. A total of 1 ml of cultured S. mutans strains (2 × 108 CFU/ml) was inoculated into the pre-existing S. gordonii medium and cultured at 37°C under anaerobic conditions for 48 h for subsequent colony counting.

Statistical analysis

Student’s t-test, two-way ANOVA, and Bonferroni’s test were used to determine statistical significance. A difference was deemed significant at P < 0.05.

Results

2-DE

Comparison of CBB-R250-stained gels for the S. mutans UA159 biofilms with or without S. gordonii DL1 indicated that 46 protein spots of S. mutans were upregulated more than 1.5-fold when co-cultured with S. gordonii (P < 0.05), whereas only one protein spot was downregulated more than 1.5-fold in S. mutans cultured without S. gordonii (P < 0.05) (Fig. 1A, B). Additional protein spots were observed when co-cultured with S. gordonii. Of the 1209 detected protein spots for S. mutans biofilms, 1162 spots were not altered in the presence of S. gordonii. Of the 46 upregulated spots, the most upregulated spot was No. 3633 protein (4.3-fold) (Fig. 1C). LC-MS/MS indicated that spot No. 3633 was S. mutans Dpr, a peroxide resistance protein.
Fig 1

CBB-R250-stained 2-DE protein profiles of S. mutans UA159 biofilms on polystyrene plate co-cultured without (A) and with S. gordonii DL1 (B).

The circled spot(s) are S. mutans UA159 monoculture biofilms proteins upregulated more than 1.5-fold compared to the S. mutans UA159 biofilms co-cultured with S. gordonii DL1 (A) or vice versa (B). The number of up-regulated protein was only one in S. mutans monoculture biofilm (A), whereas 46 protein spots were up-regulated in S. mutans co-cultured with S. gordonii (B). (C) The protein spot upregulated the most was No. 3633 (circled). The No. 3633 protein is indicated by arrowhead (B). Triplicate independent analysis for each sample were performed.

CBB-R250-stained 2-DE protein profiles of S. mutans UA159 biofilms on polystyrene plate co-cultured without (A) and with S. gordonii DL1 (B).

The circled spot(s) are S. mutans UA159 monoculture biofilms proteins upregulated more than 1.5-fold compared to the S. mutans UA159 biofilms co-cultured with S. gordonii DL1 (A) or vice versa (B). The number of up-regulated protein was only one in S. mutans monoculture biofilm (A), whereas 46 protein spots were up-regulated in S. mutans co-cultured with S. gordonii (B). (C) The protein spot upregulated the most was No. 3633 (circled). The No. 3633 protein is indicated by arrowhead (B). Triplicate independent analysis for each sample were performed.

Construction of S. mutans dpr-defective mutant and Western blotting analysis

To analyze the role of S. mutans Dpr when co-cultured with S. gordonii, the dpr gene (GenBank: SMU.540) of S. mutans UA159 was inactivated by allelic exchange mutagenesis. The resulting S. mutans UA159 Δdpr grew very slowly under both aerobic and anaerobic conditions (S1 Fig.). Therefore, we used a S. mutans GS-5 dpr mutant to analyze Dpr [20]. For the complementation analysis, pAY1301, which contains the dpr gene, was transformed into the S. mutans GS5 Δdpr strain by electroporation-mediated transformation. The expression of Dpr protein was confirmed by Western blotting. S. mutans GS5 and GS5 Δdpr+dpr strains showed Dpr expression, but the GS5 Δdpr strain did not (S2 Fig.).

Competition between S. mutans and initial colonizers

Competition between S. mutans and initial colonizers was analyzed using two assays described by Kreth et al. [7]: (i) initial colonizer strains were inoculated and allowed to grow for 24 h before S. mutans strains were inoculated nearby, and (ii) both species were inoculated simultaneously. As shown in Fig. 2A, S. gordonii inhibited the growth of the S. mutans dpr-defective mutant in both conditions. No growth inhibition was observed in any S. mutans strains in the presence of the S. gordonii spxB-defective mutant in all conditions. In addition, the mutants encoding inactivated alkyl hydroperoxide reductase (AhpC) and superoxide dismutase (SOD) were analyzed (Fig. 2B). The growth of these mutants was not affected by S. gordonii, whereas double mutants (Δdpr plus ΔahpC and Δdpr plus Δsod) were inhibited more. The growth of dpr- ahpC and sod double mutants were more inhibited by S. gordonii compared to ΔahpC and Δsod strains, while slight or no inhibition was observed in ΔahpC and Δsod strains (Fig. 2B). The strains defective in ΔahpC, Δsod, Δdpr plus ΔahpC, and Δdpr plus Δsod were not inhibited by S. gordonii spxB-defective mutant in all conditions (S3 Fig.).
Fig 2

Inhibition of the growth of S. mutans strains by S. gordonii.

(A) Inhibition of the growth of S. mutans dpr-deficient strains by S. gordonii DL1 and spxB-deficient strain. S. gordonii strains were inoculated first and grown for 24 h at 37°C in an aerobic atmosphere. Then, S. mutans strains were inoculated next to these colonizers, and the plates were incubated for 24 h (upper lane). S. gordonii and S. mutans were inoculated simultaneously on the plate and incubated for 24 h at 37°C under aerobic conditions (lower lane). (B) Inhibition of the growth of S. mutans sod-, ahpC-, dpr- ahpC, and sod double mutants by S. gordonii DL1. The culture conditions were the same as in (A).

Inhibition of the growth of S. mutans strains by S. gordonii.

(A) Inhibition of the growth of S. mutans dpr-deficient strains by S. gordonii DL1 and spxB-deficient strain. S. gordonii strains were inoculated first and grown for 24 h at 37°C in an aerobic atmosphere. Then, S. mutans strains were inoculated next to these colonizers, and the plates were incubated for 24 h (upper lane). S. gordonii and S. mutans were inoculated simultaneously on the plate and incubated for 24 h at 37°C under aerobic conditions (lower lane). (B) Inhibition of the growth of S. mutans sod-, ahpC-, dpr- ahpC, and sod double mutants by S. gordonii DL1. The culture conditions were the same as in (A). In addition, similar experiments were performed using S. mitis and S. sanguinis. Under anaerobic conditions, S. mitis and S. sanguinis inhibited all of the Δdpr mutants (Δdpr, Δdpr plus ΔahpC, and Δdpr plus Δsod) but not other strains. Under aerobic conditions, when S. mitis was inoculated first, almost all strains were inhibited (Fig. 3A), while all of the Δdpr and its derivertive mutants were more inhibited compared to the ΔahpC and Δsod mutants (Fig. 3A). When S. sanguinis was inoculated first, dpr-related mutants were more inhibited compared to ΔahpC and Δsod (Fig. 3B). In addition, simultaneous inoculation of S. mutans strains with initial colonizers led to less growth inhibition in all non-dpr mutant S. mutans strains, and all dpr-related mutants were more inhibited (Fig. 3AB). Furthermore, when strains were inoculated adjacent to various concentrations of H2O2, only S. mutans Δdpr-defective strains were inhibited (at H2O2 concentrations of 0.025% to 0.3%) (S4 Fig.).
Fig 3

Inhibition of the growth of S. mutans strains by (A) S. mitis and (B) S. sanguinis.

S. mitis or S. sanguinis was inoculated first and grown for 24 h at 37°C in an anaerobic (anaerobic S. mit/S. san first) or aerobic (aerobic S. mit/S. san first) atmosphere. Then, S. mutans strains were inoculated next to these colonizers, and the plates were incubated for 24 h. The S. mitis or S. sanguinis strain and S. mutans were inoculated simultaneously on the plate and incubated for 24 h at 37°C under aerobic conditions (simultaneous aerobic). S. m, S. mutans; S. mit, S. mitis; S. san, S. sanguinis.

Inhibition of the growth of S. mutans strains by (A) S. mitis and (B) S. sanguinis.

S. mitis or S. sanguinis was inoculated first and grown for 24 h at 37°C in an anaerobic (anaerobic S. mit/S. san first) or aerobic (aerobic S. mit/S. san first) atmosphere. Then, S. mutans strains were inoculated next to these colonizers, and the plates were incubated for 24 h. The S. mitis or S. sanguinis strain and S. mutans were inoculated simultaneously on the plate and incubated for 24 h at 37°C under aerobic conditions (simultaneous aerobic). S. m, S. mutans; S. mit, S. mitis; S. san, S. sanguinis.

Transcriptional analysis of the genes responsible for resistance to oxidative stress

Of the genes responsible for resistance to oxidative stress, we investigated the expression levels of ahpC, sod, and dpr in S. mutans with or without S. gordonii. The expression level of dpr in S. mutans with S. gordonii was increased 3.2-fold compared to S. mutans alone, while transcriptional levels of ahpC and sod in S. mutans with S. gordonii were similar to that of S. mutans without S. gordonii (Fig. 4).
Fig 4

The relative quantities of S. mutans sod, ahpC, and dpr genes when co-cultured with S. gordonii.

Fold expressions were shown as the ratio of S. mutans co-cultured with S. gordonii to S. mutans cultured without S. gordonii. All gene expressions were normalized to gryA. The data are expressed as the means and SDs of three experiments.

The relative quantities of S. mutans sod, ahpC, and dpr genes when co-cultured with S. gordonii.

Fold expressions were shown as the ratio of S. mutans co-cultured with S. gordonii to S. mutans cultured without S. gordonii. All gene expressions were normalized to gryA. The data are expressed as the means and SDs of three experiments.

Dpr expression in biofilm and planktonic phase

Western blot analysis of S. mutans Dpr expression with/without S. gordonii was performed. In planktonic cells, all protein expressions were almost same (Fig. 5A), while in S. mutans biofilm, Dpr expression was most increased when co-inoculated with S. gordonii compared to inoculated S. mutans alone and/or with S. gordonii ΔspxB (Fig. 5B).
Fig 5

S. mutans Dpr expression by Western blotting analysis.

(A) Planktonic cells. (B) Biofilm. Lane M, molecular mass markers; lane 1, S. mutans without S. gordonii; lane 2, S. mutans co-cultured with S. gordonii DL1; lane 3, S. mutans co-cultured with S. gordonii ΔspxB.

S. mutans Dpr expression by Western blotting analysis.

(A) Planktonic cells. (B) Biofilm. Lane M, molecular mass markers; lane 1, S. mutans without S. gordonii; lane 2, S. mutans co-cultured with S. gordonii DL1; lane 3, S. mutans co-cultured with S. gordonii ΔspxB.

Viability assay of S. mutans strains after co-inoculation with S. gordonii

The viability of the S. mutans Δdpr mutant with S. gordonii was attenuated compared to GS5 viability with S. gordonii (P < 0.05, Fig. 6A), whereas that of the S. mutans dpr-complemented strain was similar to that of the wild-type GS5 strain (Fig. 6B).
Fig 6

Viability assay of S. mutans strains after co-inoculation with S. gordonii.

S. mutans strains were inoculated into S. gordonii pre-existing BHI medium and additionally inoculated at 37°C under anaerobic conditions for 48 h. S. mutans CFU on MS agar plates supplemented with bacitracin were counted and adjusted to CFU/well. Data are shown as the means of triplicate platings from one of two reproducible experiments. *P < 0.05.

Viability assay of S. mutans strains after co-inoculation with S. gordonii.

S. mutans strains were inoculated into S. gordonii pre-existing BHI medium and additionally inoculated at 37°C under anaerobic conditions for 48 h. S. mutans CFU on MS agar plates supplemented with bacitracin were counted and adjusted to CFU/well. Data are shown as the means of triplicate platings from one of two reproducible experiments. *P < 0.05.

Discussion

Oral biofilm formation on the tooth surface is considered to be a sequential process involving oral bacteria. Initially, the tooth surface is colonized by a group of bacteria called “pioneer colonizers,” which are mostly composed of mitis group streptococci (e.g., S. gordonii, S. sanguinis, and S. mitis). Previous investigation reported some S. gordonii species appears in more mature plques while S. sanginis and S. oralis appear in the more initial plaques [4]. Early colonizers such as S. mutans subsequently adhere to these pioneer colonizers [3, 4]. The growth of these early colonizers modifies the local environment and allows for growth of late colonizers [29]. In this context, several investigations of the interactions between mitis group streptococci and S. mutans have been reported [29]. In this study, we focused on the interactions between S. mutans and S. gordonii. To analyze the proteins upregulated when S. mutans interacts with S. gordonii, we performed 2-DE analysis with LC-MS/MS. Proteomic analysis revealed that the most upregulated S. mutans protein was Dpr, a peroxide resistance protein. In addition, Western blotting analysis revealed that Dpr expression in S. mutans biofilms was increased when co-cultured with S. gordonii compared to S. mutans monoculture (S4 Fig.). Dpr was previously identified as a ferritin-like peroxide resistance protein that incorporates iron ions [30-32]. However, the role of this molecule in the context of the ecological system of oral biofilms has not been reported. In this study, S. mutans Dpr was the most upregulated protein in biofilms co-cultured with S. gordonii. In addition, previous studies have reported that some strains and/or species of S. sanguinis and S. gordonii antagonize the growth of S. mutans by the production of H2O2 [7]. In this regard, upregulation of Dpr in S. mutans when co-cultured with S. gordonii is not unexpected. Based on these results, to analyze the role of S. mutans Dpr protein when encountering pioneer colonizers, we constructed a dpr-mutant of S. mutans UA159 before starting the competition assays. To minimize the effects of growth differences, the growth of all S. mutans strains was analyzed. Growth of the dpr-defective mutant of the S. mutans UA159 strain was very slow (S1 Fig.). Therefore, we used the dpr-defective mutant of S. mutans GS5 for further analysis; the growth of this strain was almost identical to that of GS5. The competition assay revealed that growth of the Δdpr mutant was more inhibited by initial colonizers compared to the growth of the wild-type GS5 strain. Previous investigations have reported that aerobic conditions increase H2O2 production of pioneer colonizers [7]. Under aerobic conditions, inhibition of the S. mutans strains by pioneer colonizers was more enhanced in this study. We additionally analyzed the effects of the mutation in other oxidative stress genes, ahpC and sod, in S. mutans. As shown in Fig. 7, H2O2 produced by Nox-1 (H2O2 forming NADH oxidase) can be reduced to H2O by AhpC [33], while SOD dismutates superoxide (O2 -) to molecular oxygen (O2) and H2O2 [34] (Fig. 7). The mutants in ahpC or sod gene in S. mutans were not inhibited by pioneer colonizers, while dpr mutant were inhibited. These results showed that the most crucial antioxidant protein of S. mutans in the protection against initial colonizers was Dpr. Recent investigation reported that the dpr and sod mutants showed almost no growth against S. sanguinis [35]. As the result of competition assay using 0.35% H2O2, the dpr mutant showed almost no growth, while the sod mutant displayed slight growth compared with that of dpr mutant. In addition, in a quantitative assay using Trypticase soy broth containing 0.04% H2O2, the UA159 strain demonstrated almost 50% survival after 30 min of incubation, while the dpr and sod mutants showed 0% and 1% survival, respectively. From these results, they concluded that Dpr and SOD are involved in H2O2 resistance in S. mutans [35]. Our results showed that dpr inactivation resulted in more sensitive than sod inactivation. As shown in Fig. 7, SOD mediates the conversion of O2 - to H2O2 and O2 - derived SOD deficiency enhances the Fenton reaction by releasing Fe2+ from iron containing proteins [36, 37]. Sutton and Winterbourn described that the rate-determining step of the oxygen metabolism is: H2O2 + Fe2+ →Fe3++OH. +OH- [38]. This investigation supports that our finding, the dpr mutant is more sensitive than the sod mutant. To elucidate this finding, we analyzed the transcriptional levels of sod, ahpC, and dpr genes of S. mutans when co-cultured with S. gordonii. The dpr gene was up-regulated for 3.2-fold compared to S. mutans alone, while sod and ahpC genes were not up-regulated.
Fig 7

Linkage among iron, Dpr, and oxygen metabolism in S. mutans [41].

We further analyzed whether Dpr expression is depending on the bacterial phase or not. Western blotting analysis showed the Dpr expression is specific to biofilm status in this investigation (Fig. 5). To elucidate this phenomenon, H2O2 concentration in both planktonic and biofilm should be monitored. We finally examined the role of S. mutans Dpr protein for survival when cultured with S. gordonii. The survival of dpr-defective mutant was significantly attenuated compared to parental strain. This result shows Dpr is essential for survival when co-exist with S. gordonii. In conclusion, we confirmed that Dpr is involved in protecting S. mutans from H2O2 produced by oral streptococci. The survival mechanisms of this organism in the presence of H2O2 producing bacteria might be important factor for the cariogenic property of this organism.

Growth curve of Streptococcus mutans and its mutants.

The strains UA 159 (open triangles), UA 159 Δdpr (closed squares), GS5 (closed triangles), GS5 Δdpr (open circles), and GS5 Δdpr+dpr (dpr complement strain, open squares) were inoculated, and the OD595 was monitored. (TIF) Click here for additional data file.

Western blotting analysis for confirmation of Dpr expression in S. mutans mutants.

After washing the overnight cultures, samples were extracted for immunoblotting. M, size marker; 1, S. mutans GS5; 2, S. mutans GS5 Δdpr; 3, S. mutans GS5 Δdpr+dpr. (TIF) Click here for additional data file.

Inhibition of the growth of S. mutans sod-, ahpC-, dpr- ahpC, and sod double mutants by S. gordonii DL1 spxB-deficient mutant.

The culture conditions were the same as in Fig. 2. (TIF) Click here for additional data file.

Competition assay with H2O2.

Various concentrations of H2O2 were spotted on THB agar plate adjacent to S. mutans strains. Both H2O2 and S. mutans strains were spotted nearby at the same time and incubated for 24 h. (TIF) Click here for additional data file.
  38 in total

1.  Competence-dependent bacteriocin production by Streptococcus gordonii DL1 (Challis).

Authors:  Nicholas C K Heng; John R Tagg; Geoffrey R Tompkins
Journal:  J Bacteriol       Date:  2006-09-29       Impact factor: 3.490

2.  Comparison of Stain-Free gels with traditional immunoblot loading control methodology.

Authors:  Alex D Colella; Nusha Chegenii; Melinda N Tea; Ian L Gibbins; Keryn A Williams; Tim K Chataway
Journal:  Anal Biochem       Date:  2012-08-26       Impact factor: 3.365

3.  Microbiology of the early colonization of human enamel and root surfaces in vivo.

Authors:  B Nyvad; M Kilian
Journal:  Scand J Dent Res       Date:  1987-10

4.  Cleavage of structural proteins during the assembly of the head of bacteriophage T4.

Authors:  U K Laemmli
Journal:  Nature       Date:  1970-08-15       Impact factor: 49.962

5.  Molecular characterization of subject-specific oral microflora during initial colonization of enamel.

Authors:  Patricia I Diaz; Natalia I Chalmers; Alexander H Rickard; Colin Kong; Craig L Milburn; Robert J Palmer; Paul E Kolenbrander
Journal:  Appl Environ Microbiol       Date:  2006-04       Impact factor: 4.792

6.  Comparison of the initial streptococcal microflora on dental enamel in caries-active and in caries-inactive individuals.

Authors:  B Nyvad; M Kilian
Journal:  Caries Res       Date:  1990       Impact factor: 4.056

7.  Molecular biology of oxygen tolerance in lactic acid bacteria: Functions of NADH oxidases and Dpr in oxidative stress.

Authors:  M Higuchi; Y Yamamoto; Y Kamio
Journal:  J Biosci Bioeng       Date:  2000       Impact factor: 2.894

8.  Streptococcal antagonism in oral biofilms: Streptococcus sanguinis and Streptococcus gordonii interference with Streptococcus mutans.

Authors:  Jens Kreth; Yongshu Zhang; Mark C Herzberg
Journal:  J Bacteriol       Date:  2008-04-25       Impact factor: 3.490

9.  Improved electroporation and cloning vector system for gram-positive bacteria.

Authors:  G M Dunny; L N Lee; D J LeBlanc
Journal:  Appl Environ Microbiol       Date:  1991-04       Impact factor: 4.792

10.  Studies on transformation of Escherichia coli with plasmids.

Authors:  D Hanahan
Journal:  J Mol Biol       Date:  1983-06-05       Impact factor: 5.469

View more
  3 in total

1.  Preventive Effects of Houttuynia cordata Extract for Oral Infectious Diseases.

Authors:  Yasuko Sekita; Keiji Murakami; Hiromichi Yumoto; Takashi Amoh; Natsumi Fujiwara; Shohei Ogata; Takashi Matsuo; Yoichiro Miyake; Yoshiki Kashiwada
Journal:  Biomed Res Int       Date:  2016-06-20       Impact factor: 3.411

2.  Antibiofilm and Anti-Inflammatory Activities of Houttuynia cordata Decoction for Oral Care.

Authors:  Yasuko Sekita; Keiji Murakami; Hiromichi Yumoto; Kouji Hirao; Takashi Amoh; Natsumi Fujiwara; Katsuhiko Hirota; Hideki Fujii; Takashi Matsuo; Yoichiro Miyake; Yoshiki Kashiwada
Journal:  Evid Based Complement Alternat Med       Date:  2017-10-16       Impact factor: 2.629

Review 3.  Streptococcus sanguinis biofilm formation & interaction with oral pathogens.

Authors:  Bin Zhu; Lorna C Macleod; Todd Kitten; Ping Xu
Journal:  Future Microbiol       Date:  2018-06-08       Impact factor: 3.165

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.