Literature DB >> 25815583

Post-transcriptional regulation of satellite cell quiescence by TTP-mediated mRNA decay.

Melissa A Hausburg1, Jason D Doles1, Sandra L Clement1, Adam B Cadwallader1, Monica N Hall1, Perry J Blackshear1, Jens Lykke-Andersen1, Bradley B Olwin1.   

Abstract

Skeletal muscle satellite cells in their niche are quiescent and upon muscle injury, exit quiescence, proliferate to repair muscle tissue, and self-renew to replenish the satellite cell population. To understand the mechanisms involved in maintaining satellite cell quiescence, we identified gene transcripts that were differentially expressed during satellite cell activation following muscle injury. Transcripts encoding RNA binding proteins were among the most significantly changed and included the mRNA decay factor Tristetraprolin. Tristetraprolin promotes the decay of MyoD mRNA, which encodes a transcriptional regulator of myogenic commitment, via binding to the MyoD mRNA 3' untranslated region. Upon satellite cell activation, p38α/β MAPK phosphorylates MAPKAP2 and inactivates Tristetraprolin, stabilizing MyoD mRNA. Satellite cell specific knockdown of Tristetraprolin precociously activates satellite cells in vivo, enabling MyoD accumulation, differentiation and cell fusion into myofibers. Regulation of mRNAs by Tristetraprolin appears to function as one of several critical post-transcriptional regulatory mechanisms controlling satellite cell homeostasis.

Entities:  

Keywords:  developmental biology; homeostasis; mouse; niche; quiescence; regeneration; skeletal muscle; stem cells

Mesh:

Substances:

Year:  2015        PMID: 25815583      PMCID: PMC4415119          DOI: 10.7554/eLife.03390

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Skeletal muscle satellite cells (SCs) are maintained as a quiescent stem cell population (Schultz, 1976) possessing minimal cytoplasm, condensed chromatin, and few ribosomes (Wakayama et al., 1979). Upon muscle injury, SCs activate and then enter S-phase to generate a proliferating myoblast population that differentiates, repairs skeletal muscle tissue, and self-renews to replenish the stem cell pool (Cornelison et al., 2001). Induction of MyoD, a myogenic regulatory transcription factor, is a critical component of this activation cascade. Prior to MyoD induction, and immediately upon satellite cell activation, the p38α/β MAPK pathway is activated, serving as a molecular switch (Jones et al., 2005). In a subset of SCs, p38α/β is asymmetrically activated during cell division to promote SC self-renewal and re-acquisition of quiescence (Troy et al., 2012). Moreover, aged SCs exhibit an intrinsic self-renewal deficit that arises in part from a failure to asymmetrically activate p38α/β MAPK (Bernet et al., 2014). Importantly, post-transcriptional gene regulatory mechanisms, including translational repression, contribute to SC activation and play a key role in the maintenance of the quiescent SC state (Crist et al., 2012). TTP (Tristetraprolin), a target of the p38α/β MAPK pathway, binds to AU-rich elements within the 3′ untranslated region (3′ UTR) of target transcripts and recruits deadenylases, initiating mRNA decay (Lai et al., 2000). Rates of mRNA decay, which fluctuate depending on cellular conditions, are controlled by specialized mRNA binding proteins (RBPs) that bind target mRNAs and activate cellular mRNA decay enzymes (Parker and Song, 2004). TTP is the best studied of the four member Tis11 gene family, which is comprised of the genes: Zfp36 (TTP), Zfp36l1, Zfp36l2 and Zfp36l3. In macrophages, TTP suppresses the inflammation response by destabilizing proinflammatory mRNAs until extracellular stimuli activate p38α/β MAPK (Stumpo et al., 2010). The p38α/β MAPK signaling pathway then phosphorylates TTP, promoting association with 14-3-3 adaptor proteins and blocking the recruitment of deadenylases, thereby stabilizing transcripts with TTP 3′ UTR binding sites (Clement et al., 2011). TTP loss-of-function has profound effects on overall organismal health and is associated with a severe inflammatory syndrome caused by chronic over-expression of Tumor Necrosis Factor (TNF)α mRNA, as loss of TNF receptor function largely rescues TTP KO phenotypes in TTP/TNFR1/2 triple knockout mice (Carballo et al., 2001). Transcripts encoding TTP family members are among the fastest declining and dynamically regulated mRNAs following SC activation, where the transcripts initially decline and then are re-expressed (Farina et al., 2012). Consistent with this observation, we identified the MyoD 3′ UTR as a TTP substrate, and show that p38α/β MAPK-mediated phosphorylation of TTP regulates MyoD mRNA decay, thereby regulating SC activation. Therefore our data, combined with recent reports of miRNA-mediated regulation of SC quiescence (Cheung et al., 2012; Crist et al., 2012), identify post-transcriptional gene regulation as an effective and potent means of maintaining SC homeostasis in adult skeletal muscle.

Results

Transcripts encoding RNA-binding proteins decrease in activated SCs

Transitioning from a quiescent SC to an activated SC involves large-scale changes in mRNA expression as well as changes in miRNAs (Farina et al., 2012) and subsequent events that permit SCs to begin DNA synthesis and proliferate as myoblasts (Jones et al., 2005). To identify regulators involved in SC activation and myoblast commitment, we compared restricted gene expression profiles of FACS-enriched SCs isolated from uninjured muscle with expression profiles from SCs isolated 12 hr post-injury from wild type and Syndecan 4 (Sdc4) mice (Farina et al., 2012). Syndecan-4 null SCs are incapable of muscle repair, exhibit severely delayed activation, aberrant MyoD expression, poor growth kinetics, fail to self-renew (Cornelison et al., 2004; Hall et al., 2010) and thus, transcripts differentially expressed between wildtype and Sdc4 SCs may represent genes involved in SC activation and commitment. Genes unique to wild type SCs that change expression 12 hr post muscle injury but do not change in Sdc4 SC are referred to as the ‘WT-S4 gene list’ (Figure 1A, Supplemental file 1A,1B). An unexpectedly high percentage of genes in this list decreased in expression during SC activation (47%), with ‘nucleic acid binding: RNA binding,’ (GO:0003723; p-value = 8.7e-05) as the most significantly overrepresented gene ontology (GO) term (Figure 1B). Among these rapidly down-regulated transcripts are genes encoding mRNA destabilizing proteins and genes implicated in cell cycle entry of quiescent C2C12 cells following methylcellulose-induced G0 arrest (Sachidanandan et al., 2002). One of these decay factors, Zfp36, which encodes TTP, declines precipitously upon wild type SC activation (Figure 1C,D). Additionally, transcripts for two other TTP family members, Zfp36l1 and Zfp36l2, which encode Brf1 and Brf2, respectively, also decrease during SC activation (Figure 1—figure supplement 1). Among the minority of transcripts that are up-regulated upon SC activation are genes with known roles in myogenesis, including Elavl1, which encodes HuR, a MyoD mRNA-stabilizing protein (Figure 1E,F) (Figueroa et al., 2003), consistent with the induction of MyoD, which occurs as early as 3 hr following isolation of myofiber-associated SCs (Cornelison et al., 2004; Jones et al., 2005).
Figure 1.

Transcripts encoding RNA binding proteins are differentially regulated during SC activation.

(A) Venn diagram illustrating subtraction strategy used to obtain the WT-S4 gene list. A total of 5162 and 2236 unique genes changed when comparing satellite cells (SCs) isolated from uninjured muscle and muscle 12 hr post-injury in wild type and Syndecan-4 (Sdc4) null SCs, respectively. Genes common to both (1069) were subtracted from the wild type gene list yielding 4093 unique genes that changed after injury in wild type but not in Sdc4 SCs. (B) Heat map depicting transcripts filtered from the WT-S4 gene list annotated with the Molecular Function Gene Ontology (GO) term: RNA binding. Transcripts annotated as RNA binding were highly enriched in the WT-S4 gene list (p-value = 8.7e-05) and 70% decreased in wild type SCs but did not change in Sdc4 SCs 12 hr post injury. Total RNA binding genes: 152; decreased: 107 (70%). (C) The relative expression of Zfp36 decreased in wild type SCs but not in Sdc4−/− SCs during the first 12 hr post-injury. (D) Zfp36 transcripts decline rapidly following culture of freshly isolated SCs. (E) The relative expression of Elavl1 increased in wild type SCs but did not change in Sdc4 SCs during the first 12 hr post-injury. (F) Freshly isolated SCs increase Elavl1 expression upon culture. (C and E values from SCs isolated by FACS and analyzed on Affymetrix MOE430A gene chips; D and F determined by QT-PCR where one representative of two experiments is shown, n = 5 mice; * p-value < 0.01). See also Supplemental file 1A,1B.

DOI: http://dx.doi.org/10.7554/eLife.03390.003

(A) and (B) Abundance of Zfp36l1 and Zfp36l2 transcripts, which encode Brf1 and Brf2, respectively, decreased in wild type satellite cells but did not change in Sdc4−/− satellite cells. The level of gene expression as determined by microarray analysis of wild type (WT) and Sdc4−/− satellite cells isolated from uninjured muscle (UI) and muscle 12 hr post-injury (12 hr). (C) and (D) Brf1 and Brf2 mRNA decreased as satellite cells activated in culture as determined by QT-PCR analysis (means from one representative experiment out of two, each experiment contained five mice; Graphs plotted ± standard deviation. *p-value < 0.01).

DOI: http://dx.doi.org/10.7554/eLife.03390.004

Figure 1—figure supplement 1.

Transcripts encoding the RNA binding proteins Brf1 and Brf2 decrease during satellite cell activation.

(A) and (B) Abundance of Zfp36l1 and Zfp36l2 transcripts, which encode Brf1 and Brf2, respectively, decreased in wild type satellite cells but did not change in Sdc4−/− satellite cells. The level of gene expression as determined by microarray analysis of wild type (WT) and Sdc4−/− satellite cells isolated from uninjured muscle (UI) and muscle 12 hr post-injury (12 hr). (C) and (D) Brf1 and Brf2 mRNA decreased as satellite cells activated in culture as determined by QT-PCR analysis (means from one representative experiment out of two, each experiment contained five mice; Graphs plotted ± standard deviation. *p-value < 0.01).

DOI: http://dx.doi.org/10.7554/eLife.03390.004

Transcripts encoding RNA binding proteins are differentially regulated during SC activation.

(A) Venn diagram illustrating subtraction strategy used to obtain the WT-S4 gene list. A total of 5162 and 2236 unique genes changed when comparing satellite cells (SCs) isolated from uninjured muscle and muscle 12 hr post-injury in wild type and Syndecan-4 (Sdc4) null SCs, respectively. Genes common to both (1069) were subtracted from the wild type gene list yielding 4093 unique genes that changed after injury in wild type but not in Sdc4 SCs. (B) Heat map depicting transcripts filtered from the WT-S4 gene list annotated with the Molecular Function Gene Ontology (GO) term: RNA binding. Transcripts annotated as RNA binding were highly enriched in the WT-S4 gene list (p-value = 8.7e-05) and 70% decreased in wild type SCs but did not change in Sdc4 SCs 12 hr post injury. Total RNA binding genes: 152; decreased: 107 (70%). (C) The relative expression of Zfp36 decreased in wild type SCs but not in Sdc4−/− SCs during the first 12 hr post-injury. (D) Zfp36 transcripts decline rapidly following culture of freshly isolated SCs. (E) The relative expression of Elavl1 increased in wild type SCs but did not change in Sdc4 SCs during the first 12 hr post-injury. (F) Freshly isolated SCs increase Elavl1 expression upon culture. (C and E values from SCs isolated by FACS and analyzed on Affymetrix MOE430A gene chips; D and F determined by QT-PCR where one representative of two experiments is shown, n = 5 mice; * p-value < 0.01). See also Supplemental file 1A,1B. DOI: http://dx.doi.org/10.7554/eLife.03390.003

Transcripts encoding the RNA binding proteins Brf1 and Brf2 decrease during satellite cell activation.

(A) and (B) Abundance of Zfp36l1 and Zfp36l2 transcripts, which encode Brf1 and Brf2, respectively, decreased in wild type satellite cells but did not change in Sdc4−/− satellite cells. The level of gene expression as determined by microarray analysis of wild type (WT) and Sdc4−/− satellite cells isolated from uninjured muscle (UI) and muscle 12 hr post-injury (12 hr). (C) and (D) Brf1 and Brf2 mRNA decreased as satellite cells activated in culture as determined by QT-PCR analysis (means from one representative experiment out of two, each experiment contained five mice; Graphs plotted ± standard deviation. *p-value < 0.01). DOI: http://dx.doi.org/10.7554/eLife.03390.004

TTP is present in quiescent SCs and is regulated by p38α/β MAPK upon muscle injury

Unphosphorylated, active TTP protein is short-lived as TTP targets its own mRNA for rapid decay, resulting in low levels of unphosphorylated TTP that are technically challenging to detect (Brook et al., 2006). Any skeletal muscle perturbation such as induced injury or immediate dissection following sacrifice, activates SCs and p38α/β MAPK (Jones et al., 2005), which in other cell types, phosphorylates and stabilizes TTP (Tchen et al., 2004). Mice perfused with paraformaldehyde to fix the tissue in situ prior to muscle dissection revealed Sdc4-marked SCs immunoreactive for TTP (Figure 2A). Similarly, rapid dissection of the TA muscle followed by immediate fixation also revealed TTP staining in SCs (Figure 2B). Upon scoring for TTP positive SCs, we found no quantitative differences in the numbers of TTP+ SCs when the muscle was pre-fixed by perfusion or rapidly dissected (Figure 2A,B). In uninjured muscle, 50% of the Sdc4+ SCs were immunoreactive for TTP and located underneath the basal lamina (Figure 2A,B,E). Since steady-state levels of active TTP are very low and difficult to detect due to decay of TTP mRNA by active TTP, the lack of detectable immunoreactivity in all SCs is likely due to TTP protein detection limits as opposed to the absence of TTP (Brook et al., 2006).
Figure 2.

TTP positive SCs decrease 1 hr following muscle injury.

(A) Uninjured perfused TA muscle sections or (B) rapidly dissected uninjured muscle sections were stained for Sdc4 (red) and laminin (white) to identify SCs (carets) and for-TTP (green). (C) and (D) TA muscle sections 1 hr following BaCl2 induced injury were stained as in A and B. (For A–D, F–G, DAPI is blue; * denotes extralaminar Sdc4+/TTP+ cells). (E) The number of Sdc4+ and Sdc4+/TTP+ cells in uninjured TA muscle sections or TA muscle sections 1 hr following BaCl2 induced injury were plotted for two independent experiments. (F, G) TA muscle sections stained for mouse IgG (green) to assess necrotic fibers in (F) uninjured muscle or in (G) muscle 30 min following a BaCl2 induced injury. Scale bars = 50 µm (A–D), 100 µm (F, G).

DOI: http://dx.doi.org/10.7554/eLife.03390.005

(A) Uninjured TA muscle sections harvested and stained as described in Figure 3. Intraperitoneal injection of mice with the p38α/β MAPK inhibitor SB203580 and inclusion of SB203580 during SC isolation reduces TTP phosphorylation and HuR induction. (B) Experimental schematic. (C) SCs isolated from treated and untreated mice stained for phospho-TTP (p-TTP, red), HuR (white), and Sdc4 (green). (D) The normalized intensity averaged and plotted for phospho-TTP, HuR and Sdc4 in isolated SCs (Student's two-tailed t-test: phospho-TTP and HuR; p < 0.001. n = 4 independent experiments).

DOI: http://dx.doi.org/10.7554/eLife.03390.006

Myofiber-associated SCs isolated from wildtype mice were fixed for immunofluorescence at 0, 3, 6, 12, and 24 hr post isolation. The 0 hr timepoint corresponds to ∼1 hr 50 min post-hindlimb dissection. Myofiber-associated SCs were subsequently stained for Pax7 to mark SCs (green), phospho-TTP (red), and DAPI (blue) to mark nuclei. The white dotted lines highlight the myofiber. Scale bars = 20 µm.

DOI: http://dx.doi.org/10.7554/eLife.03390.007

TTP positive SCs decrease 1 hr following muscle injury.

(A) Uninjured perfused TA muscle sections or (B) rapidly dissected uninjured muscle sections were stained for Sdc4 (red) and laminin (white) to identify SCs (carets) and for-TTP (green). (C) and (D) TA muscle sections 1 hr following BaCl2 induced injury were stained as in A and B. (For A–D, F–G, DAPI is blue; * denotes extralaminar Sdc4+/TTP+ cells). (E) The number of Sdc4+ and Sdc4+/TTP+ cells in uninjured TA muscle sections or TA muscle sections 1 hr following BaCl2 induced injury were plotted for two independent experiments. (F, G) TA muscle sections stained for mouse IgG (green) to assess necrotic fibers in (F) uninjured muscle or in (G) muscle 30 min following a BaCl2 induced injury. Scale bars = 50 µm (A–D), 100 µm (F, G). DOI: http://dx.doi.org/10.7554/eLife.03390.005

p38α/β MAPK inhibition prevents TTP phosphorylation and reduces HuR protein levels.

(A) Uninjured TA muscle sections harvested and stained as described in Figure 3. Intraperitoneal injection of mice with the p38α/β MAPK inhibitor SB203580 and inclusion of SB203580 during SC isolation reduces TTP phosphorylation and HuR induction. (B) Experimental schematic. (C) SCs isolated from treated and untreated mice stained for phospho-TTP (p-TTP, red), HuR (white), and Sdc4 (green). (D) The normalized intensity averaged and plotted for phospho-TTP, HuR and Sdc4 in isolated SCs (Student's two-tailed t-test: phospho-TTP and HuR; p < 0.001. n = 4 independent experiments).
Figure 3.

TTP is phosphorylated by p38α/β MAPK and regulates MyoD expression in primary SCs.

(A) TA muscle sections harvested 30 min following BaCl2 injury from either vehicle injected or SB203580 injected mice were stained with anti-Sdc4 antibodies (green) and anti-Laminin antibodies (white) to identify SCs (carets) and anti-phospho-MK2 antibodies (red; * denotes myonuclei positive for p-MK2). (B) Percentage of phospho-MK2 positive SCs was decreased in the presence of SB203580 following injury. (± SEM * p-value < 0.01 for n = 3). (C) PLA in primary, 24 hr cultured SCs using an anti-phospho-MK2 antibody and either an anti-TTP antibody (left column), an anti-HuR antibody (middle column), or an anti-CUGBP1 antibody (right column). (D) Box-and-whisker plots depicting cumulative PLA results from three independent experiments in primary SCs and in the MM14 myoblast cell line (* p-value < 0.01 compared to CUGBP1). (E) Myofiber-associated SCs were cultured in the presence of 10 μM MK2 inhibitor III (MK2i) or a vehicle control (DMSO) for 24 hr, fixed and stained for Sdc4 to mark SCs (red), phospho-TTP (green), and MyoD (white). (F–H) Myofiber-associated SCs transfected 6 hr post isolation with an eGFP plasmid as a transfection marker and either a control plasmid or a plasmid expressing TTP-AA-myc. Explanted SCs were cultured for an additional 24 hr, fixed and stained for Sdc4 (red), eGFP (green), and MyoD (white). (H) The percentage of transfected SCs scored for MyoD plotted for three independent experiments from a minimum 25 myofibers per condition. Scale bars = 10 µm (A), 4 µm (C), 30 µm (E), and 10 µm (F, G).

DOI: http://dx.doi.org/10.7554/eLife.03390.008

Myofiber-associated SCs transfected 6 hr post isolation with a plasmid expressing ß-galactosidase as a transfection marker and either a control plasmid (A) or a plasmid expressing TTP-AA-myc (B) were cultured for an additional 24 hr, fixed and stained for Sdc4 (red), ß-galactosidase (green), and HuR (white). (C) The percentage of transfected SCs scored for HuR plotted for two independent experiments from a minimum of 25 myofibers per condition. Scale bar = 5 µm.

DOI: http://dx.doi.org/10.7554/eLife.03390.009

DOI: http://dx.doi.org/10.7554/eLife.03390.006

phospho-TTP expression in myofiber-associated satellite cells.

Myofiber-associated SCs isolated from wildtype mice were fixed for immunofluorescence at 0, 3, 6, 12, and 24 hr post isolation. The 0 hr timepoint corresponds to ∼1 hr 50 min post-hindlimb dissection. Myofiber-associated SCs were subsequently stained for Pax7 to mark SCs (green), phospho-TTP (red), and DAPI (blue) to mark nuclei. The white dotted lines highlight the myofiber. Scale bars = 20 µm. DOI: http://dx.doi.org/10.7554/eLife.03390.007 In contrast to the uninjured state, 1 hr post-injury we found the majority of TTP+/Syndecan-4+ cells were located outside of the basal lamina or encased within the basal lamina (Figure 2C,E) with a minority present in the SC niche underneath the basal lamina (Figure 2D,E). This observation is consistent with substantial muscle damage, as evidenced by serum IgG permeable necrotic myofibers, observed in injured tissue 30 min following a BaCl2 induced injury (Weller et al., 1990) (Figure 2F,G). Upon TTP phosphorylation by p38α/β MAPK, TTP accumulates rapidly as a result of increased TTP message and protein stability arising from TTP inactivation (Tchen et al., 2004). Therefore, following an induced muscle injury we expect the majority of TTP to be phosphorylated. Unfortunately, the anti-phospho-TTP antibody proved unreliable for detection of phospho-TTP in muscle sections (not shown) and thus, we queried SCs in injured muscle for a direct target of p38α/β MAPK phosphorylation, MAPKAPK2 (MK2), which phosphorylates TTP (Brooks and Blackshear, 2013). 30 min post-injury, 45% of the Syndecan-4+ SCs were phospho-MK2 immunoreactive (Figure 3A,B), while uninjured muscle SCs were phospho-MK2 negative (Figure 2—figure supplement 1A). Consistent with MK2 activation by p38α/β MAPK, phospho-MK2 was significantly reduced if mice were pre-treated with an intraperitoneal (IP) injection of SB203580, a p38α/β MAPK inhibitor (Figure 3A,B).
Figure 2—figure supplement 1.

p38α/β MAPK inhibition prevents TTP phosphorylation and reduces HuR protein levels.

(A) Uninjured TA muscle sections harvested and stained as described in Figure 3. Intraperitoneal injection of mice with the p38α/β MAPK inhibitor SB203580 and inclusion of SB203580 during SC isolation reduces TTP phosphorylation and HuR induction. (B) Experimental schematic. (C) SCs isolated from treated and untreated mice stained for phospho-TTP (p-TTP, red), HuR (white), and Sdc4 (green). (D) The normalized intensity averaged and plotted for phospho-TTP, HuR and Sdc4 in isolated SCs (Student's two-tailed t-test: phospho-TTP and HuR; p < 0.001. n = 4 independent experiments).

DOI: http://dx.doi.org/10.7554/eLife.03390.006

TTP is phosphorylated by p38α/β MAPK and regulates MyoD expression in primary SCs.

(A) TA muscle sections harvested 30 min following BaCl2 injury from either vehicle injected or SB203580 injected mice were stained with anti-Sdc4 antibodies (green) and anti-Laminin antibodies (white) to identify SCs (carets) and anti-phospho-MK2 antibodies (red; * denotes myonuclei positive for p-MK2). (B) Percentage of phospho-MK2 positive SCs was decreased in the presence of SB203580 following injury. (± SEM * p-value < 0.01 for n = 3). (C) PLA in primary, 24 hr cultured SCs using an anti-phospho-MK2 antibody and either an anti-TTP antibody (left column), an anti-HuR antibody (middle column), or an anti-CUGBP1 antibody (right column). (D) Box-and-whisker plots depicting cumulative PLA results from three independent experiments in primary SCs and in the MM14 myoblast cell line (* p-value < 0.01 compared to CUGBP1). (E) Myofiber-associated SCs were cultured in the presence of 10 μM MK2 inhibitor III (MK2i) or a vehicle control (DMSO) for 24 hr, fixed and stained for Sdc4 to mark SCs (red), phospho-TTP (green), and MyoD (white). (F–H) Myofiber-associated SCs transfected 6 hr post isolation with an eGFP plasmid as a transfection marker and either a control plasmid or a plasmid expressing TTP-AA-myc. Explanted SCs were cultured for an additional 24 hr, fixed and stained for Sdc4 (red), eGFP (green), and MyoD (white). (H) The percentage of transfected SCs scored for MyoD plotted for three independent experiments from a minimum 25 myofibers per condition. Scale bars = 10 µm (A), 4 µm (C), 30 µm (E), and 10 µm (F, G). DOI: http://dx.doi.org/10.7554/eLife.03390.008

TTP over-expression does not affect HuR protein levels.

Myofiber-associated SCs transfected 6 hr post isolation with a plasmid expressing ß-galactosidase as a transfection marker and either a control plasmid (A) or a plasmid expressing TTP-AA-myc (B) were cultured for an additional 24 hr, fixed and stained for Sdc4 (red), ß-galactosidase (green), and HuR (white). (C) The percentage of transfected SCs scored for HuR plotted for two independent experiments from a minimum of 25 myofibers per condition. Scale bar = 5 µm. DOI: http://dx.doi.org/10.7554/eLife.03390.009 Dissection of SCs from whole muscle activates p38α/β MAPK (Jones et al., 2005) and as expected, SCs are phospho-TTP+ following isolation (Figure 2—figure supplement 1B,C; Figure 2—figure supplement 2). If TTP phosphorylation is mediated via the p38α/β MAPK pathway, then inhibition of p38α/β MAPK should prevent TTP phosphorylation. To test this hypothesis, we injected SB203580 intraperitoneally (IP), isolated SCs in the presence of SB203580, and examined isolated SCs for phospho-TTP to identify activated SCs and examined SCs for HuR induction, which occurs rapidly upon SC activation (Figure 1—figure supplement 1B,C). Phospho-TTP and HuR were significantly reduced in SCs isolated from SB203580 treated mice compared to SCs isolated in the absence of the p38α/β MAPK inhibitor, while Syndecan-4 staining remained constant (Figure 2—figure supplement 1C,D). Thus, in SCs, TTP appears to be a p38α/β MAPK target and pretreating skeletal muscle with a p38α/β MAPK inhibitor reduces TTP phosphorylation.
Figure 2—figure supplement 2.

phospho-TTP expression in myofiber-associated satellite cells.

Myofiber-associated SCs isolated from wildtype mice were fixed for immunofluorescence at 0, 3, 6, 12, and 24 hr post isolation. The 0 hr timepoint corresponds to ∼1 hr 50 min post-hindlimb dissection. Myofiber-associated SCs were subsequently stained for Pax7 to mark SCs (green), phospho-TTP (red), and DAPI (blue) to mark nuclei. The white dotted lines highlight the myofiber. Scale bars = 20 µm.

DOI: http://dx.doi.org/10.7554/eLife.03390.007

Disruption of the MK2/TTP signaling axis antagonizes MyoD expression

MAPKAPK2 (MK2) is a downstream p38α/β MAPK target regulating TTP in murine macrophage cells (Mahtani et al., 2001; Tiedje et al., 2012; Brooks and Blackshear, 2013). We employed a Duolink in situ proximity ligation assay (PLA) (Pisconti et al., 2010; Troy et al., 2012) to determine if phospho-MK2 was associated with TTP. As a positive control, we performed PLA using phospho-MK2 and HuR primary antibodies as HuR is a well-established p38/MK2 target (Kim et al., 2010). Duolink signals detected in phospho-MK2::HuR samples (Figure 3C), were significantly greater than phospho-MK2 PLA using an unrelated RNA binding protein (CUGBP1) antibody where ≤3 complexes per cell were observed (Figure 3C) above background. A robust signal for phospho-MK2::TTP association using PLA was observed (Figure 3C) and when quantified, was significant compared to contols (Figure 3D), indicating that TTP is a bona-fide p38/MK2 target in SCs and MM14 cells. If TTP is a functional target of MK2, then inhibition of MK2 should reduce or eliminate phospho-TTP expression. Primary myofiber-associated SCs were cultured for 24 hr in the presence or absence of an MK2 inhibitor (MK2 Inhibitor III, CAS: 1186648-22-5) then fixed, stained and scored for Syndecan-4, phospo-TTP, and MyoD. Wild-type, vehicle treated myofiber-associated SCs (Syndecan 4+) uniformly expressed MyoD and were phospho-TTP positive at 24 hr post-isolation, while phospho-TTP was barely detectable in the presence of 10uM MK2 inhibitor III (MK2i, Figure 3E). We observed concurrent downregulation of MyoD in the MK2i treated SCs, suggesting that TTP may play a role in p38α/β MAPK-mediated MyoD regulation. The rapid p38α/β MAPK-dependent phosphorylation (inactivation) of TTP upon SC activation suggests that TTP plays a role in maintaining SC quiescence. Furthermore, TTP inactivation preceding MyoD up-regulation is consistent with the hypothesis that TTP actively suppresses pro-myogenic mRNA targets. We therefore transfected myofiber-associated SCs with a constitutively active TTP mutant, TTPS52AS178A (TTP-AA-myc), to determine if direct manipulation of TTP influenced MyoD protein levels. TTP-AA-myc is unresponsive to p38α/β MAPK signaling, binds target transcripts, recruits mRNA decay factors, and reduces target mRNA stability (Stoecklin et al., 2004). Myofiber-associated SCs transfected with either a control (pcDNA3.1) or a TTP-AA-myc expression plasmid immediately following explant were fixed and scored for Syndecan-4 and MyoD immunoreactivity after 30 hr in culture. The majority (70%) of control transfected cells were MyoD immunoreactive (Figure 3F,H), while only 30% of the TTP-AA-myc transfected cells were MyoD immunoreactive (Figure 3G,H), demonstrating that TTP reduces myogenic commitment. Importantly, 15% of SCs were MyoD immunoreactive on a subset of myofibers removed immediately following transfection at 6 hr post-explant (dotted line, Figure 3H). Thus, ectopic expression of TTP-AA-myc blocked virtually all cells from inducing MyoD post-transfection (Figure 3H). MyoD mRNA in skeletal muscle cell lines is stabilized by HuR (van der Giessen et al., 2003) and induction in SCs is concomitant with the loss of TTP (see Figure 1). Moreover, TTP may regulate HuR since a polyadenylation variant of HuR mRNA contains an AU-rich element (Al-Ahmadi et al., 2009) and blocking p38α/β MAPK signaling prevents HuR induction (Figure 2—figure supplement 1C,D). Therefore, HuR is a potential TTP target that may stabilize MyoD mRNA in activated SCs promoting MyoD induction. If correct, HuR expression should be reduced by the TTP-AA-myc mutant similar or to a greater extent then that observed for MyoD. To test this, SCs on intact myofibers were transfected with either a control or TTP-AA-myc mutant plasmid, fixed (as described above) 30 hr post explant and then stained for Syndecan-4 (to identify SCs) and HuR (Figure 3—figure supplement 1A,B). Scoring the percentage of Syndecan-4+ cells that were HuR immunoreactive showed that there were no detectable differences in HuR protein expression in control transfected SCs as compared to TTP-AA-myc transfected SCs (Figure 3—figure supplement 1C). Thus, it is unlikely that HuR represents a primary TTP target mRNA in activating SCs and may function to control mRNA stability via an alternative signaling pathway.
Figure 3—figure supplement 1.

TTP over-expression does not affect HuR protein levels.

Myofiber-associated SCs transfected 6 hr post isolation with a plasmid expressing ß-galactosidase as a transfection marker and either a control plasmid (A) or a plasmid expressing TTP-AA-myc (B) were cultured for an additional 24 hr, fixed and stained for Sdc4 (red), ß-galactosidase (green), and HuR (white). (C) The percentage of transfected SCs scored for HuR plotted for two independent experiments from a minimum of 25 myofibers per condition. Scale bar = 5 µm.

DOI: http://dx.doi.org/10.7554/eLife.03390.009

TTP binds the MyoD 3′ UTR and regulates MyoD mRNA stability

TTP does not appear to regulate MyoD mRNA by preventing HuR induction and thus, we asked if TTP directly regulated MyoD transcript stability. Bioinformatic analysis of the MyoD 3′ UTR identified a highly conserved TTP binding site (Figure 4—figure supplement 1A). To verify TTP binding to the MyoD 3′ UTR, we inserted the full length MyoD 3′ UTR into a Tet-Off β-Globin reporter (referred to as β-MyoD) and performed RNA-immunoprecipitation assays. HEK293T cells were co-transfected with the ß-MyoD construct and a negative control ß-globin sequence that does not bind TTP (β-GAP), along with wild type TTP or an RNA binding-deficient TTP mutant (F126N) (Lai et al., 2002), both containing a flag epitope tag. Following transfection, cell lysates were immunoprecipitated with an anti-flag epitope tag antibody. Immunoprecipitation of wild type flag-TTP efficiently co-immunoprecipitated β-MyoD when compared with the negative control β-globin reporter (β-GAP) (Figure 4A, lane 1), whereas immunoprecipitation of the flag-TTPF162N mutant failed to co-immunoprecipitate β-MyoD (Figure 4A, lane 2). As an internal positive control, wild type flag-TTP co-immunoprecipitated a known target of TTP, the 3′ UTR sequence of Granulocyte Macrophage Colony Stimulating Factor (GM-CSF), (Figure 4A, lane 1) that was not co-immunoprecipitated with the flag-TTPF126N mutant (Figure 4A, lane 2). Anti-flag immunoprecipitation of cell extracts expressing an unrelated RNA binding protein, the MS2 viral coat protein, failed to co-immunoprecipate any of the reporter RNAs (Figure 4A, lane 3). These data demonstrate that wild type TTP directly binds the MyoD 3′ UTR.
Figure 4—figure supplement 1.

The MyoD 3′ UTR TTP binding site is conserved and stabilized by constitutive MAPKAPK-2 signaling.

(A) The MyoD 3′ UTR TTP binding sequence (TATTTAT) is identical in seven mammals as depicted in the UCSC genome browser. (B) TTP reduces the half-life of a WTß-MyoD reporter mRNA but is stabilized in the presence of constitutively active MAPKAPK-2. Tet-off Hela cells transfected with pcTET2-β-MyoD and CMV-β-Globin, a tetracycline unresponsive loading and transfection control, were subjected to pulse-chase mRNA decay assays and extracts separated by Northern blotting were probed with radioactive anti-sense β-globin probes in the presence of an empty vector control, TTP, or TTP and a constitutively active MK2 (TTP+MK2-EE). The calculated β-MyoD mRNA half-life was determined from the average ± SEM plotted of at least 3 independent experiments. Student's two-tailed t-test; * β-MyoD + TTP, p = 0.012; β-MyoD + TTP + MK2EE compared to empty vector control p < 0.01.

DOI: http://dx.doi.org/10.7554/eLife.03390.011

Figure 4.

TTP binds and regulates the 3′ UTR of MyoD mRNA.

(A) Northern blots of co-immunoprecipitation assays show TTP binding to the MyoD 3′ UTR in HEK293T cells. Assays were performed with cells co-expressing FLAG-tagged wild type TTP (WT, lanes 1 and 4), an RNA binding mutant of TTP (F126N, lanes 2 and 5), or an unrelated non-RNA binding protein, (MS2, lanes 3 and 6) together with the reporter β-globin mRNA containing the MyoD 3′ UTR (β-MyoD) or the GM-CSF 3′ UTR (β-GM-CSF). Cells were extracted, immunoprecipitated with the indicated flag-tagged protein and associated mRNAs detected by Northern Blot with radioactive anti-sense β-globin probes. A β-globin reporter with no putative TTP binding sites served as an internal negative control (β-GAP). Pellet (lanes 1–3) and 10% input (lanes 4–6) fractions were loaded as indicated. Percentage bound normalized to input RNA indicated (ND-not detectable). (B) A schematic of the tetracycline responsive (TRE) β-globin reporter constructs containing the 684 bp MyoD 3′ untranslated region (UTR). Shown are the U-rich HuR binding sites, the putative TTP binding sequence (WTß-MyoD, bold), and the mutated sequence (MUTß-MyoD, bold). (C) TTP reduces the half-life of a WTß-MyoD reporter mRNA. Tet-off Hela cells transfected with either pcTET2-WTß-MyoD or pcTET2-MUTß-MyoD and CMV-β-Globin, a tetracycline unresponsive loading and transfection control, were subjected to pulse-chase mRNA decay assays and extracts separated by Northern blotting and probed with radioactive anti-sense β-globin probes in the presence of an empty vector control (–) or TTP. (D) The calculated β-MyoD mRNA half-life determined from the average ± SEM plotted from at least three independent experiments. Student's two-tailed t-test; * β-MyoD + TTP, p = 0.012.

DOI: http://dx.doi.org/10.7554/eLife.03390.010

(A) The MyoD 3′ UTR TTP binding sequence (TATTTAT) is identical in seven mammals as depicted in the UCSC genome browser. (B) TTP reduces the half-life of a WTß-MyoD reporter mRNA but is stabilized in the presence of constitutively active MAPKAPK-2. Tet-off Hela cells transfected with pcTET2-β-MyoD and CMV-β-Globin, a tetracycline unresponsive loading and transfection control, were subjected to pulse-chase mRNA decay assays and extracts separated by Northern blotting were probed with radioactive anti-sense β-globin probes in the presence of an empty vector control, TTP, or TTP and a constitutively active MK2 (TTP+MK2-EE). The calculated β-MyoD mRNA half-life was determined from the average ± SEM plotted of at least 3 independent experiments. Student's two-tailed t-test; * β-MyoD + TTP, p = 0.012; β-MyoD + TTP + MK2EE compared to empty vector control p < 0.01.

DOI: http://dx.doi.org/10.7554/eLife.03390.011

TTP binds and regulates the 3′ UTR of MyoD mRNA.

(A) Northern blots of co-immunoprecipitation assays show TTP binding to the MyoD 3′ UTR in HEK293T cells. Assays were performed with cells co-expressing FLAG-tagged wild type TTP (WT, lanes 1 and 4), an RNA binding mutant of TTP (F126N, lanes 2 and 5), or an unrelated non-RNA binding protein, (MS2, lanes 3 and 6) together with the reporter β-globin mRNA containing the MyoD 3′ UTR (β-MyoD) or the GM-CSF 3′ UTR (β-GM-CSF). Cells were extracted, immunoprecipitated with the indicated flag-tagged protein and associated mRNAs detected by Northern Blot with radioactive anti-sense β-globin probes. A β-globin reporter with no putative TTP binding sites served as an internal negative control (β-GAP). Pellet (lanes 1–3) and 10% input (lanes 4–6) fractions were loaded as indicated. Percentage bound normalized to input RNA indicated (ND-not detectable). (B) A schematic of the tetracycline responsive (TRE) β-globin reporter constructs containing the 684 bp MyoD 3′ untranslated region (UTR). Shown are the U-rich HuR binding sites, the putative TTP binding sequence (WTß-MyoD, bold), and the mutated sequence (MUTß-MyoD, bold). (C) TTP reduces the half-life of a WTß-MyoD reporter mRNA. Tet-off Hela cells transfected with either pcTET2-WTß-MyoD or pcTET2-MUTß-MyoD and CMV-β-Globin, a tetracycline unresponsive loading and transfection control, were subjected to pulse-chase mRNA decay assays and extracts separated by Northern blotting and probed with radioactive anti-sense β-globin probes in the presence of an empty vector control (–) or TTP. (D) The calculated β-MyoD mRNA half-life determined from the average ± SEM plotted from at least three independent experiments. Student's two-tailed t-test; * β-MyoD + TTP, p = 0.012. DOI: http://dx.doi.org/10.7554/eLife.03390.010

The MyoD 3′ UTR TTP binding site is conserved and stabilized by constitutive MAPKAPK-2 signaling.

(A) The MyoD 3′ UTR TTP binding sequence (TATTTAT) is identical in seven mammals as depicted in the UCSC genome browser. (B) TTP reduces the half-life of a WTß-MyoD reporter mRNA but is stabilized in the presence of constitutively active MAPKAPK-2. Tet-off Hela cells transfected with pcTET2-β-MyoD and CMV-β-Globin, a tetracycline unresponsive loading and transfection control, were subjected to pulse-chase mRNA decay assays and extracts separated by Northern blotting were probed with radioactive anti-sense β-globin probes in the presence of an empty vector control, TTP, or TTP and a constitutively active MK2 (TTP+MK2-EE). The calculated β-MyoD mRNA half-life was determined from the average ± SEM plotted of at least 3 independent experiments. Student's two-tailed t-test; * β-MyoD + TTP, p = 0.012; β-MyoD + TTP + MK2EE compared to empty vector control p < 0.01. DOI: http://dx.doi.org/10.7554/eLife.03390.011 Active TTP may regulate SC activation by targeting mRNAs for rapid decay, similar to TTP-mediated regulation of inflammation via targeting of proinflammatory mRNAs in macrophages (Stumpo et al., 2010). To test whether TTP regulates MyoD mRNA stability, we utilized a Hela cell line stably transfected with the Tetracycline trans-repressor (Tet-Off Hela) to express a β-Globin-MyoD 3′ UTR construct (referred to as β-MyoD) containing a tetracycline responsive element (TRE) upstream of the promoter (Figure 4B). β-MyoD transcription is constitutive until tetracycline addition terminates transcription. At various time points post-chase (following transcription termination), β-MyoD mRNA was quantified and the half-life calculated (Clement and Lykke-Andersen, 2008). WTß-MyoD mRNA half-life was 250 min when expressed in Tet-Off Hela cells (Figure 4C,D), and co-transfection of a construct expressing TTP destabilized the WTß-MyoD mRNA, decreasing mRNA half-life by nearly twofold (Figure 4C,D). Furthermore, TTP-mediated decay of the ß-MyoD mRNA was sensitive to p38α/β MAPK signaling as co-transfection of the TTP construct with a constitutively active MK2 kinase (MK2-EE) increased β-MyoD mRNA stability to ≥350 min (Figure 4—figure supplement 1B). MyoD mRNA decay was dependent on the predicted TTP binding sequence as mutation of the putative TTP binding sequence (MUTβ-MyoD; Figure 4B) rendered TTP incapable of destabilizing MUTβ-MyoD mRNA (Figure 4C,D).

In vivo TTP loss-of-function disrupts muscle homeostasis

TTP may be required for SC quiescence as (1) TTP is present in quiescent SCs, (2) TTP is rapidly inhibited by p38α/β MAPK signaling within minutes of SC activation, and (3) active TTP reduces the half-life of MyoD mRNA. Therefore, loss of TTP from skeletal muscle tissue should precociously activate SCs, promoting inappropriate MyoD expression, and aberrant cell cycle entry. To test this prediction, we analyzed whole tibialis anterior (TA) muscle tissue from uninjured TTP-knockout mice (Taylor et al., 1996) and from uninjured TTP/TNFR1/2 triple knockout mice (3KO) (Carballo et al., 2001). The triple knockout mice were included to rule out potential muscle phenotypes arising as a secondary consequence of increased inflammation due to systemic stabilization of TNFα mRNA in the absence of TTP (Stumpo et al., 2010). Neither the TTP knockout mice nor 3KO mice exhibited any detectable gross morphological differences in muscle sections immunostained with laminin (Figure 5A). Moreover, we did not observe Pax7+ cells outside of the basal lamina (Figure 5—figure supplement 1A) nor any significant quantitative differences in Pax7+ SCs between wild type and knock out muscle sections when scoring for Pax7 immunoreactivity (Figure 5—figure supplement 1B; additional quantification in Supplementary file 2A). In contrast, extralaminar and sublaminar Ki67+ cells were increased in TTP knockout mice and 3KO mice, suggesting that SCs exit the quiescent G0 state in the absence of TTP (Figure 5—figure supplement 1C). Some sublaminar Ki67+ cells are Pax7 negative, suggesting these cells are myoblasts committed to myogenesis and undergoing terminal differentiation (Figure 5—figure supplement 1A). Consistent with increased myogenic commitment of SCs, we observe twofold greater numbers of sublaminar MyoD+ cells in TTP knockout mice and in 3KO muscle compared to wild type mice (Figure 5A,B). More centrally located nuclei (CLN) that are indicative of SC fusion into myofibers and a hallmark of muscle injury and repair, were present in TTP knockout mice and 3KO mice compared to controls (Figure 5C). Thus, global loss of TTP appears sufficient to drive a low-level injury response in skeletal muscle in the absence of an overt physical or chemical insult.
Figure 5.

TTP loss-of-function promotes promiscuous SC activation.

(A–C) Uninjured TA muscle sections from wild type (WT), TTP knockout, and TTP/TNFR1/2 triple knockout mice (3KO) were stained for MyoD (red) to identify cells committed to myogenesis. Loss of TTP or combined loss of TTP/TNFR1/2 in muscle results in significant increases in MyoD+ cells (A, B) and centrally located nuclei (quantified in C), both hallmarks of actively regenerating muscle. (D–F) Pax7+ SCs were infected with mCherry-tagged shRNAs and analyzed 3 weeks post-infection to examine the effect of TTP knockdown on SC activation (Figure 5—figure supplement 2B). TA muscle cross sections were stained with either Pax7 (green) or MyoD (green) and laminin (white) to determine the activation status of infected (mCherry+) SCs. Shown in (E) and (F) are bar graphs quantifying the fraction of mCherry+ cells immunoreactive for Pax7 or MyoD, respectively. N = 3 mice for each experimental condition. For all images, nuclei are labeled blue with DAPI and muscle fibers are depicted in white using an anti-laminin antibody; scale bars = 50 µm. In bar graphs, (*) denotes a p-value < 0.05, (**) p < 0.01, (***) p < 0.001 as determined by student's two tailed t-tests.

DOI: http://dx.doi.org/10.7554/eLife.03390.012

Uninjured TA muscle sections from wild type (WT), TTP knockout, and TTP/TNFR1/2 triple knockout mice (3KO) were stained for (A) Pax7 (red) and laminin (white) to identify SCs (carets), and-Ki67 (green) to mark non-quiescent, cycling cells (asterisks). (A–B) When compared to WT muscle sections, the number of Pax7+ SCs were similar in TTP KO and 3KO muscle sections. (C) TTP loss-of-function results in a significant increase in sublaminar Ki67+ cells. Scale bar = 50 µm.

DOI: http://dx.doi.org/10.7554/eLife.03390.013

(A) A graphic image depicting the breeding scheme employed to express tva (RCAS receptor) on Pax7+ SCs. (B) Experimental timeline for RCAS-based studies presented in (C–D) and in Figure 5. Briefly, concentrated RCAS was injected via tail vein on 3 consecutive days into recombined Pax7;Rosa26 recipient mice and muscle tissue was harvested for analysis 3 weeks following the final RCAS injection. (C) Representative montage reconstructions of TA muscle cross-sections from mice infected with control (left) or TTP (right) shRNAs. Dashed boxes highlight areas of mCherry+ fibers resulting from activation and eventual fusion of mCherry infected Pax7+ SCs. (D) Bar graph depicting the activation index (mCherry+ fiber/single cell ratio) of control vs TTP knockdown muscle cross-sections 3 weeks post-infection. (**) p < 0.01. N = 3 mice for each experimental condition. Scale bar = 200 µm.

DOI: http://dx.doi.org/10.7554/eLife.03390.014

Figure 5—figure supplement 1.

TTP loss-of-function promotes muscle activation.

Uninjured TA muscle sections from wild type (WT), TTP knockout, and TTP/TNFR1/2 triple knockout mice (3KO) were stained for (A) Pax7 (red) and laminin (white) to identify SCs (carets), and-Ki67 (green) to mark non-quiescent, cycling cells (asterisks). (A–B) When compared to WT muscle sections, the number of Pax7+ SCs were similar in TTP KO and 3KO muscle sections. (C) TTP loss-of-function results in a significant increase in sublaminar Ki67+ cells. Scale bar = 50 µm.

DOI: http://dx.doi.org/10.7554/eLife.03390.013

TTP loss-of-function promotes promiscuous SC activation.

(A–C) Uninjured TA muscle sections from wild type (WT), TTP knockout, and TTP/TNFR1/2 triple knockout mice (3KO) were stained for MyoD (red) to identify cells committed to myogenesis. Loss of TTP or combined loss of TTP/TNFR1/2 in muscle results in significant increases in MyoD+ cells (A, B) and centrally located nuclei (quantified in C), both hallmarks of actively regenerating muscle. (D–F) Pax7+ SCs were infected with mCherry-tagged shRNAs and analyzed 3 weeks post-infection to examine the effect of TTP knockdown on SC activation (Figure 5—figure supplement 2B). TA muscle cross sections were stained with either Pax7 (green) or MyoD (green) and laminin (white) to determine the activation status of infected (mCherry+) SCs. Shown in (E) and (F) are bar graphs quantifying the fraction of mCherry+ cells immunoreactive for Pax7 or MyoD, respectively. N = 3 mice for each experimental condition. For all images, nuclei are labeled blue with DAPI and muscle fibers are depicted in white using an anti-laminin antibody; scale bars = 50 µm. In bar graphs, (*) denotes a p-value < 0.05, (**) p < 0.01, (***) p < 0.001 as determined by student's two tailed t-tests.
Figure 5—figure supplement 2.

SC-specific TTP knockdown breaks quiescence in uninjured muscle.

(A) A graphic image depicting the breeding scheme employed to express tva (RCAS receptor) on Pax7+ SCs. (B) Experimental timeline for RCAS-based studies presented in (C–D) and in Figure 5. Briefly, concentrated RCAS was injected via tail vein on 3 consecutive days into recombined Pax7;Rosa26 recipient mice and muscle tissue was harvested for analysis 3 weeks following the final RCAS injection. (C) Representative montage reconstructions of TA muscle cross-sections from mice infected with control (left) or TTP (right) shRNAs. Dashed boxes highlight areas of mCherry+ fibers resulting from activation and eventual fusion of mCherry infected Pax7+ SCs. (D) Bar graph depicting the activation index (mCherry+ fiber/single cell ratio) of control vs TTP knockdown muscle cross-sections 3 weeks post-infection. (**) p < 0.01. N = 3 mice for each experimental condition. Scale bar = 200 µm.

DOI: http://dx.doi.org/10.7554/eLife.03390.014

DOI: http://dx.doi.org/10.7554/eLife.03390.012

TTP loss-of-function promotes muscle activation.

Uninjured TA muscle sections from wild type (WT), TTP knockout, and TTP/TNFR1/2 triple knockout mice (3KO) were stained for (A) Pax7 (red) and laminin (white) to identify SCs (carets), and-Ki67 (green) to mark non-quiescent, cycling cells (asterisks). (A–B) When compared to WT muscle sections, the number of Pax7+ SCs were similar in TTP KO and 3KO muscle sections. (C) TTP loss-of-function results in a significant increase in sublaminar Ki67+ cells. Scale bar = 50 µm. DOI: http://dx.doi.org/10.7554/eLife.03390.013

SC-specific TTP knockdown breaks quiescence in uninjured muscle.

(A) A graphic image depicting the breeding scheme employed to express tva (RCAS receptor) on Pax7+ SCs. (B) Experimental timeline for RCAS-based studies presented in (C–D) and in Figure 5. Briefly, concentrated RCAS was injected via tail vein on 3 consecutive days into recombined Pax7;Rosa26 recipient mice and muscle tissue was harvested for analysis 3 weeks following the final RCAS injection. (C) Representative montage reconstructions of TA muscle cross-sections from mice infected with control (left) or TTP (right) shRNAs. Dashed boxes highlight areas of mCherry+ fibers resulting from activation and eventual fusion of mCherry infected Pax7+ SCs. (D) Bar graph depicting the activation index (mCherry+ fiber/single cell ratio) of control vs TTP knockdown muscle cross-sections 3 weeks post-infection. (**) p < 0.01. N = 3 mice for each experimental condition. Scale bar = 200 µm. DOI: http://dx.doi.org/10.7554/eLife.03390.014 The relative contributions of non cell autonomous and cell autonomous effects on precocious SC activation cannot be resolved with the global knockout mice and thus, we employed an alternative approach to determine the effects of SC-specific TTP loss-of-function in vivo. We expressed the receptor for RCAS(A) virus, avian leukosis virus receptor (subgroup A), or tva, in SCs and infected skeletal muscle tissue with RCAS modified to express U6-driven TTP shRNAs or control shRNAs with a fluorescent CMV-driven mCherry reporter (Hughes, 2004; Harpavat and Cepko, 2006; Seidler et al., 2008; von Werder et al., 2012). Since mammalian cells lack tva we generated Pax7;Rosa26 mice that express tva on Pax7+ SCs upon tamoxifen-mediated Cre recombinase activation to evaluate RNAi-mediated TTP knockdown in quiescent adult muscle SCs (Figure 5—figure supplement 2A). Tamoxifen-treated Pax7;Rosa26 mice were injected intravenously with RCAS-shRNA-mCherry viruses to infect quiescent SCs (Figure 5—figure supplement 2B). Myofibers were not mCherry+ 72 hr post-infection, ruling out direct infection by RCAS viruses (not shown). 3 weeks post infection with a control shRNA (shScramble), we observed mCherry expression in individual cells and in a small percentage of muscle fibers (Figure 5—figure supplement 2C, left panel), demonstrating in vivo SC infection and subsequent fusion of infected SCs into myofibers (mCherry+ fibers). A marked increase in mCherry+ fibers was observed in TTP shRNA (shTTPmix) infected muscle compared to muscle infected with scrambled shRNA expressing virus (Figure 5—figure supplement 2C, right panel, Figure 5—figure supplement 2D). Muscle sections from control infected and TTP knockdown infected mice were then visualized for Pax7 and MyoD immunoreactivity and scored to quantify SC activation (Figure 5D–F; additional quantification in Supplementary file 2B). The mCherry+ cells in control muscles infected with the scrambled shRNA expressing RCAS were >95% Pax7+ with fewer than 5% of the mCherry+ cells immunoreactive for MyoD (Figure 5D–F). In contrast, a >threefold increase in MyoD+ immunoreactivity was observed mCherry+ cells in shTTPmix-infected muscle (Figure 5D,F). Thus, SC-specific TTP knockdown breaks SC quiescence, promoting precocious SC activation and enhancing cell fusion with existing myofibers in the absence of muscle injury.

Discussion

SC homeostasis, the maintenance of quiescence and re-acquisition of quiescence following asymmetric or symmetric cell division is not fully understood. Relatively constant SC numbers are maintained in healthy adult mice prior to and following single or multiple induced muscle injuries (Cornelison et al., 2004; Pisconti et al., 2010). Elegant experiments have established roles for maintenance of quiescence by microRNAs, where miR-489 represses Dek expression to maintain quiescence, miR-31 represses Myf-5 translation to maintain quiescence, and alternative polyadenylation regulates Pax3 (Boutet et al., 2012; Cheung et al., 2012; Crist et al., 2012). Here, we propose that SC quiescence is actively maintained by mRNA decay, an additional post-transcriptional regulatory mechanism, via the Tis11 family of RNA binding proteins (Figure 6). Together, these studies suggest that a host of post-transcriptional regulatory mechanisms maintain the quiescent state of skeletal muscle stem cells and represent an efficient and rapid method for tissue-specific stem cell responses.
Figure 6.

Inhibition of TTP by p38α/β MAPK initiates a feed-forward circuit that commits SCs to the myogenic lineage.

Muscle regeneration requires SCs to rapidly exit from quiescence but to also renew the quiescent SC population upon completion of regeneration. We propose that TTP suppresses transcripts for SC activation as a mechanism for immediate exit from quiescence. Upon muscle injury, p38α/β MAPK is rapidly activated resulting in phosphorylation of TTP. Phospho-TTP no longer suppresses activation-associated transcripts resulting in rapid induction and SC activation. One such activation-associated transcript targeted by TTP is MyoD, which is rapidly induced due to inactivation of TTP by p38α/β MAPK concurrent with increased MyoD mRNA stability mediated by HuR and transcriptional upregulation of the MyoD gene locus. Since MyoD up-regulates its own transcription, muscle injury would trigger a rapid feed-forward loop resulting in MyoD expression driving SCs to commit to myoblasts. Additionally, we propose that TTP may be involved in down regulation of MyoD mRNA and other TTP-target transcripts expressed by myoblasts, during the initial formation of a quiescent SC population or in reacquisition of quiescence following an injury.

DOI: http://dx.doi.org/10.7554/eLife.03390.015

Inhibition of TTP by p38α/β MAPK initiates a feed-forward circuit that commits SCs to the myogenic lineage.

Muscle regeneration requires SCs to rapidly exit from quiescence but to also renew the quiescent SC population upon completion of regeneration. We propose that TTP suppresses transcripts for SC activation as a mechanism for immediate exit from quiescence. Upon muscle injury, p38α/β MAPK is rapidly activated resulting in phosphorylation of TTP. Phospho-TTP no longer suppresses activation-associated transcripts resulting in rapid induction and SC activation. One such activation-associated transcript targeted by TTP is MyoD, which is rapidly induced due to inactivation of TTP by p38α/β MAPK concurrent with increased MyoD mRNA stability mediated by HuR and transcriptional upregulation of the MyoD gene locus. Since MyoD up-regulates its own transcription, muscle injury would trigger a rapid feed-forward loop resulting in MyoD expression driving SCs to commit to myoblasts. Additionally, we propose that TTP may be involved in down regulation of MyoD mRNA and other TTP-target transcripts expressed by myoblasts, during the initial formation of a quiescent SC population or in reacquisition of quiescence following an injury. DOI: http://dx.doi.org/10.7554/eLife.03390.015 Gene chip analysis of SCs isolated from uninjured and injured skeletal muscle and gene chip analysis of quiescent SCs isolated following injection of p38α/β MAPK inhibitors, identified a cohort of transcripts rapidly down-regulated upon SC activation, prior to cell cycle entry (Farina et al., 2012). Transcripts encoding proteins that directly regulate mRNAs, including mRNA binding proteins involved in skeletal muscle diseases were highly represented, supporting a critical role for post-transcriptional regulation of RNA in skeletal muscle homeostasis (Farina et al., 2012). The involvement of p38α/β MAPK signaling in SC activation (Jones et al., 2005), asymmetric SC division (Troy et al., 2012) and loss of SC function during aging (Bernet et al., 2014) identifies p38α/β MAPK targets as likely mediators of these cellular processes. Therefore, we focused on TTP, which is a p38α/β MAPK signaling target (Stumpo et al., 2010) and was down-regulated to the greatest extent during SC activation. The Tis11/Zfp36 gene family is comprised of TTP and three related genes, of which TTP is the best characterized, containing a tandem zinc finger domain that binds AU rich sequences in the 3′ UTR of mRNAs and targets the mRNAs for sequestration or decay (Brooks and Blackshear, 2013). Potential TTP mRNA targets in SCs would most likely include positive regulators of myogenic commitment. One probable TTP target, HuR, is reported to stabilize MyoD and Myogenin transcripts in myogenic cell lines (Figueroa et al., 2003). Although we found no evidence that TTP regulates HuR during SC activation, HuR is rapidly induced upon SC activation, suggesting that critical mediators of myogenic commitment, including the myogenic transcription factors MyoD and Myf5, are regulated by multiple post-transcriptional regulatory pathways. For example, Myf5 is sequestered from translation in quiescent SCs by miR-33 (Crist et al., 2012). MyoD is a likely candidate for post-transcriptional regulation as MyoD mRNA is present at low but detectable levels in freshly isolated SCs (Supplemental file 1C) (Cornelison et al., 2001; Liu et al., 2013). MyoD protein is induced within 3h of SC activation (Jones et al., 2005) and requires p38α/β MAPK activity (Jones et al., 2005). Asymmetric p38α/β MAPK is required for commitment of one daughter cell to myogenesis during asymmetric SC division (Troy et al., 2012) and presumably, the TTP binding site in the 3′ UTR of MyoD would permit TTP-mediated mRNA decay in daughter cells lacking activated p38α/β MAPK. The behavior of SCs from aged mice is consistent with p38α/β MAPK-mediated regulation of MyoD as these SCs predominately commit to myogenesis with an accompanying reduction in self-renewal, consistent with their elevated p38α/β MAPK activity (Bernet et al., 2014; Cosgrove et al., 2014). Although MyoD mRNA appears to be a TTP target, TTP likely regulates other mRNAs with AU-rich sites involved in maintenance of SC quiescence. Furthermore, the Tis11 family members Brf1 and Brf2 were also down-regulated upon SC activation. Ongoing work is focused on identification and characterization of additional TTP/Tis11 targets and their involvement in maintenance of SC quiescence. In the absence of muscle injury, SC-specific TTP knockdown increased MyoD+ cells, presumably at the expense of Pax7+ progenitor cells. The increase in MyoD+ cells was accompanied by an increase in mCherry+ myofibers when compared to controls where SCs were infected with scrambled shRNAs. Thus, TTP inhibition breaks SC quiescence in uninjured muscle, providing strong evidence for the involvement of TTP in regulating SC homeostasis. Similarly, post-transcriptional regulation of mRNAs by miR-489 maintains SC quiescence, suggesting Dek and potentially other miR-489 targets regulate SC homeostasis (Cheung et al., 2012). As we do not know the extent of functional diversity within the Pax7+ SC population it is possible that TTP loss-of-function and miR-489 preferentially affect sub-populations of Pax7+ SCs. Additional experiments will resolve whether SC quiescence is coordinately regulated by multiple post-transcriptional mechanisms or whether subsets of SCs are uniquely responsive to distinct skeletal muscle repair or maintenance requirements. SC quiescence is maintained by multiple post-transcriptional regulatory mechanisms including miRNA-mediated inhibition of Myf5 translation (Crist et al., 2012) and Dek translation (Cheung et al., 2012). Here, we show that in addition to Myf5 and Pax3 (Boutet et al., 2012), MyoD mRNA is regulated post-transcriptionally via a distinct regulatory mechanism whereby MyoD mRNA is targeted for rapid decay in quiescent SCs. Post-transcriptional regulatory circuitry is required for SC homeostasis and appears to maintain SCs in a primed state, permitting a rapid response to skeletal muscle injury. Moreover, post-transcriptional gene regulation likely facilitates SC self-renewal by asymmetric division and may regulate SC homeostasis via multiple mechanisms. In other tissues undergoing rapid turnover, similar post-transcriptional regulatory networks may ensure that a primed stem cell pool is available to repair and maintain tissue function.

Materials and methods

Mice

Mice were bred and housed according to National Institutes of Health (NIH) guidelines for the ethical treatment of animals in a pathogen-free facility at the University of Colorado (Wildtype and Syndecan-4 null line) or at the at the National Institutes of Environmental Health Sciences (TTP and TTP;TNFR1/2 null lines). All animal protocols were approved by the local IACUC. Wild-type mice were C57Bl/6xDBA2 (B6D2F1; Jackson Labs, ME, USA); Syndecan-4 null (Cornelison et al., 2004), TTP null (Taylor et al., 1996), and TTP;TNFR1/2 null (Carballo et al., 2001) mice are previously described. Cells, myofibers and TA muscles were harvested from female mice that were 3–6 months old. For TTP null and TTP;TNFR1/2 null analysis, TA muscle tissues were collected from male and female litermates that were 3–6 months old.

Microarray analysis and QT-PCR analysis

Isolation and analysis of primary SCs by microarray and QT-PCR analysis was as previously described (Farina et al., 2012). CEL files from three replicate gene chips were imported directly into Spotfire (TIBCO, MA, USA) and normalized by GCRMA. Using a 99% confidence threshold (p-value ≤ 0.01), probe sets that changed ≥twofold in relative expression between Sdc4 uninjured SCs and Sdc4 SCs 12 hr post injury were subtracted from probe sets that changed ≥twofold between wild type uninjured SCs and wild type SCs 12 hr post injury. This analysis resulted in the WT-S4 gene list (Supplemental file 1A,B). Gene ontology analysis was performed using Ingenuity Pathway Analysis, CA, USA (Farina et al., 2012).

QT-PCR analysis

For in vitro activation, SCs were isolated from five wild type mice, pooled, and cultured for 0 hr (freshly isolated), 2 hr, 4 hr, 8 hr and 12 hr in F12C containing 15% Horse serum and 2 nM FGF-2; data were collected for two independent experiments. Superscript III RT (Invitrogen, CA, USA) was used for reverse transcription of RNA into cDNA. Fast SYBR Green master mix (Applied Biosystems) was used according to manufacturer's instructions to amplify target transcripts using primers spanning exon/exon junctions for Elavl1 and Zfp36, Zfp36l1 and Zfp36l2. 18S rRNA was used as a reference gene and samples were analyzed in triplicate. Primer sequences: elavl1 Exon1/2; (FOR: 5′ GCTTATTCGGGATAAAGTAGCAGGA; REV: 5′ TTCACAAAACCGTAGCCCAAG). Zfp36 Exon1/2; (FOR: 5′ GCCATCTACGAGAGCCTCCA; REV: 5′ CGTGGTCGGATGACAGGTC). Zfp36l1 Exon1/2; (FOR: 5′ CGAAGTTTTATGCAAGGGTAA; REV: 5′ GCGCTGGGAGTGCTGTAGTT). Zfp36l2 Exon1/2; (FOR 5′ CGACCACACTTCTGTCACCCT; REV 5′ GGATTTCTCCGTCTTGCACAA).

RCAS virus generation and infection

RCASBP(A) vectors containing Gateway cloning sites were obtained from Addgene (MA, USA) (Harpavat and Cepko, 2006). Control and TTP shRNA constructs (TRC1/1.5, Sigma–Aldrich, MO, USA) were subcloned into RCAS vectors along with the sequence encoding the florescent reporter mCherry protein. RCAS viruses were generated in DF-1 chicken fibroblast cells using standard protocols and were concentrated and stored at −80C until use (Flanagan-Steet et al., 2000). For in vivo studies, Tamoxifen-inducible Pax7 Cre-driver mice (provided by Dr Gabrielle Kardon) were crossed with a conditional Tva receptor line (ROSA26) (Seidler et al., 2008) to generate mice that upon tamoxifen administration express the Tva viral receptor on Pax7+ SCs. 3 days following a standard tamoxifen regimen, concentrated RCAS virus was injected (on 3 consecutive days) via tail vein into recipient mice to introduce shRNA and reporter gene constructs into uninjured Pax7+ SCs. 3 weeks post infection, TA muscle was harvested and processed/analyzed as described for immunofluorescence.

Immunofluorescence of fixed sections

All mice were housed in a pathogen-free facility, and the Institutional Animal Care and Use Committee at the University of Colorado approved all protocols. Whole TA muscles were either perfused or fixed for 2 hr on ice with 4% Paraformaldehyde following dissection from the limb. Muscles were sunk in 30% sucrose and mounted in Tissue Tek O.C.T. mounting media. Cryosections were post-fixed onto slides for 5 min in 4% PFA, permeablized for 5 min with 0.5% TritonX-100 in Phosphate Buffered Saline (PBS), and blocked for 1 hr at room temperature with 5% BSA+0.2% Tx-100. Primary antibodies were used at the following dilutions: 1:250 mouse anti-Pax7 (Developmental Hybridoma Bank, Iowa University), 1:500 rabbit anti-MyoD (Santa Cruz [C-20] sc-304, CA, USA), rabbit anti-Ki67 (ab15580, Abcam, MA, USA), 1:300 Rat anti-Laminin (4HB-2, Sigma-Aldrich, MO, USA), 1:1000 anti-TTP (Cao et al., 2004), 1:1000 Chicken anti-Syndecan-4, 1:50 anti-Phospho-MAPKAPK-2 (Thr334) (Cat#3041, Cell Signaling). Sections were stained for 2 hr at room temperature or overnight at 4°, washed with PBS+0.2% Tx-100 and stained with Alexa Fluor secondary antibodies (anti-rabbit 488, anti-chicken 555, anti-Rat 647, and for mouse IgG detection anti-mouse 488) at a dilution of 1:500 for 1 hr at room temperature. Primary antibody concentrations for Duolink PLA were as follows: 1:200 anti-phospho-MAPKAPK-2 (Thr334) (Cat#3041, Cell Signaling, MA, USA), 1:100 anti-CUGBP1 (sc-20003, Santa Cruz, CA, USA), 1:100 anti-HuR (sc-5261, Santa Cruz, CA, USA), and 1:100 anti-TTP (sc-14030, Santa Cruz, CA, USA). PLA was otherwise performed according to the manufacturer's protocol (Olink Biosciences, Sweden). All immunostaining samples were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) and sections were mounted with Vectashield (Vector Labs, CA, USA).

Immunofluorescence of primary SCs

Primary SCs were dried down on gelatin coated-coverslips in 10 µl PBS in a laminar flow hood and fixed with 4% Paraformadehyde for 10 min at room temperature. Syndecan-4 staining for primary SCs was done as described for myofibers. Primary antibodies were used at the following dilutions: 1:500 mouse anti-HuR, provided by Dr Joan Steitz from Yale University, and 1:200 Rabbit anti-phospho-TTP antibody provided by Dr Georg Stoecklin at the University of Heidelberg in Germany. For scoring fluorescence intensity values, the samples were blinded and masks overlapping Syndecan-4 staining were made. The mean intensity for all fluorescence channels was calculated and background staining was subtracted using Slidebook software (Intelligent Imaging Innovations, CO, USA).

Preparation, transfection, and immunofluorescence of myofibers

Muscle was dissected from hind limbs and digested for 1.5 hr at 37°C in 400U/ml Type I Collagenase (Worthington, NJ, USA). The muscle slurry was placed into tissue culture dishes containing 15% horse serum in F12C media. Myofibers were teased apart from the muscle using pulled glass pipets and placed into fresh media. Fifty myofibers were transferred to six-well plates containing 2 ml F12C with 15% horse serum and 2 nM FGF-2. Fibers were transfected with 2.75 µg of the pcDNA3-TTP-AA-myc plasmid and 0.25 µg eGFP-N1 plasmid with Lipofectamine 2000 (Invitrogen, CA, USA) according to the manufacturer's instructions for 4 hr. Transfection efficiencies ranged from 25% to 29%. The myofibers were then washed with F12C containing 15% horse serum and 2 nM FGF-2 and incubated for a total of 30 hr in culture. Myofibers were washed with PBS and fixed with 4% paraformaldehyde for 10 min, incubated with 10% goat serum for 1 hr at room temperature, then incubated overnight with 1:1000 chicken anti-Syndecan-4 antibody. The myofibers were washed 3 times with PBS and incubated for 1 hr at room temperature with anti-chicken 1:1000 AlexaFluor 555 and were post-fixed. To detect internal epitopes, myofibers were then permeabilized with PBS containing 0.5% Triton X-100. Following a 1 hr block with 10% goat serum, fibers were incubated with primary antibodies (1:50 mouse anti-MyoD or 1:500 mouse anti-HuR) overnight at 4°C. Fibers were then incubated with secondary anti-mouse Alexa Fluor 647 (1:500) antibodies for 1 hr at room temperature before being mounted on slides with Vectashield containing DAPI.

Intraperitoneal injection inhibition of p38α/β MAPK with SB203580

In vivo inhibition of p38α/β MAPK was performed using a dosage of 15 mg SB203580 (Alexis Biochemicals, NY, USA) per kg of body weight. SB203580 was resuspended in DMSO and diluted using saline (0.9% NaCl). 1 hr prior to muscle tissue harvest, mice were injected intraperitoneally with 10 µl/g of 1.5 mg/ml SB203580 or a corresponding volume of diluted DMSO as a control. Hind limb muscle tissue was dissected from the leg and immediately placed in 25 μM SB203580 or the DMSO carrier as a control. Primary SCs were isolated as previously described (Cornelison et al., 2004). Briefly, muscle tissue was minced using No. 10 scalpels for 5 min and then incubated for 1 hr at 37°C in 400U/ml Type I Collagenase (Worthington, NJ, USA). The muscle slurry was diluted with F12-C media containing 15% horse serum and sequentially passed through 70 µm and 40 µm filters yielding a single cell suspension. SCs in suspension were fixed immediately in 4% paraformaldehyde for 10 min.

RNA decay assays with the β-globin-MyoD 3′ UTR reporter

The entire 3′ UTR of MyoD was amplified by PCR from C2C12 myoblast cDNA using the following primers: FOR: 5′ GCATCCATGCGGCCGCGGATGGTGTCCCTGGTTCTT; REV 5′ GCAATCATGCGGCCGCGCGTCTTTATTTCCAACACCT. The PCR product was cloned into NotI sites of the Tetracycline responsive β-Globin reporter construct as previously described (Lykke-Andersen et al., 2000). Quikchange from Agilent (CA, USA) was used to mutate the WTß-MyoD construct according to the manufacturer's instructions using the following primers: FOR: 5′ GGGAGCCCCTTGGGCTAGAGTCATCTCCCAGGCATGCT; REV 5′ AGCATGCCTGGGAGATGACTCTAGCCCAAGGGGCTCCC. Tet-off Hela cells were co-transfected in six-well plates with 2.5 µg of either a wild type or mutant pcTET2-β-MyoD plasmid, 0.05 µg of a CMV-β-Globin plasmid, a tetracycline unresponsive loading and transfection control, and either 0.05 µg of a CMV-wtTTP plasmid, 0.05 μg CMV-wtTTP and 0.5 μg Flag-MK2EE or a pcDNA3 control plasmid. Transcription was pulsed for 6 hr by removal of tetracycline from the media. Following addition of 1 μg/ml tetracycline, RNA was harvested at indicated time points using Trizol according to manufacture's instructions. RNA was separated on a 1.2% Agarose Formaldehyde gel, transferred to a Nylon membrane, probed for β-globin, and the half-life was calculated as previously described (Clement and Lykke-Andersen, 2008).

Flag-tagged immunoprecipitations of TTP bound to the MyoD 3′ UTR

HeLa Tet-off cells in 10-cm plates were transiently transfected with 2.0 µg of the mouse TTP expression plasmids, pcDNA3-Flag-mTTP or pcDNA3-Flag-mTTPF126N (previously described [Lai et al., 2002] or 2.0 µg of an expression plasmid containing the N-terminus of the MS2 viral coat protein (previously described [Lykke-Andersen et al., 2001]) together with 1.0 µg of a pwtGAP3UAC plasmid (previously described [Clement and Lykke-Andersen, 2008]), which lacks a TTP binding site and either 8.0 µg of a pcTET2MyoD plasmid or 9.0 µg of a pcTET2 ATG-GMCSF plasmid. Cells were lysed in 800 µl of RNA immunoprecipitation buffer containing 10 mM Tris pH 7.5, 200 mM NaCl, 2 mM EDTA, 0.1% Triton X-100, 1 µg/ml FLAG Peptide (Sigma-Aldrich, MO, USA), and protease inhibitors 0.5 mM PMSF, 2 µg/ml each of aprotinin and leupeptin. Lysates were incubated with 40 µl (bead volume) anti-FLAG M2 agarose (Sigma) at 4°C for 2 hr. Complexes were washed 8 times with Net-2 (50 mM Tris-HCl pH 7.5, 200 mM NaCl, 0.1% Triton X-100), eluted in 1 ml of Trizol reagent (Invitrogen) and stored at −20°C. Pellet and 10% input fractions were separated on a 1.2% agarose formaldehyde gel, transferred to a nylon membrane, and probed for β-Globin (previously described (Clement and Lykke-Andersen, 2008)). eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers. Thank you for sending your work entitled “Post-transcriptional regulation of satellite cell quiescence by TTP-mediated mRNA decay” for consideration at eLife. Your article has been favorably evaluated by Janet Rossant (Senior editor) and three reviewers, one of whom is a member of our Board of Reviewing Editors. The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission. The comments of the reviewers converge to a considerable extent. We would ask you to address the points raised and to pay particular attention to the question of the role of TTP in satellite cells (using single fiber experiments for example), TTP effects on transcripts and protein levels, TTP, p38 phosphorylation and messenger RNA stabilisation should be clearly established in this context. The discussion in the paper of the role of TTP in quiescence is not very convincing and if retained requires data on MyoD transcription in these cells, although this does not necessarily have to include in vitro stability assays. The full reviews have been included to assist with your revisions: Reviewer #1: This manuscript identifies the RNA binding protein Tristetrapolin (TTP or Zfp36) as a factor that is up-regulated in quiescent versus activated satellite cells. The authors show that it binds to AU-rich sequences in the 3' UTR of MyoD mRNA, promoting messenger decay. Interestingly they find that MyoD is already transcribed in quiescent satellite cells and propose that accumulation of this myogenic determination factor, which would lead to myogenesis, is prevented by this post-transcriptional mechanism. Phosphorylation of TTP by p38 MAPK prevents its destabilising action and the authors propose that this takes place on muscle injury when satellite cells are activated and enter myogenesis. Mouse mutant analysis demonstrates the role of TTP in maintaining quiescence since in its absence satellite cells are activated. These results provide new insight into the regulation of satellite cell behaviour and are of interest to the wider field of stem cell research as well as to the muscle community. A number of points need to be addressed by the authors: 1) HuR is another mRNA binding protein which is known to stabilise MyoD mRNA. Unlike TTP it is expressed at a higher level in activated satellite cells. The authors show that TTP does not regulate HuR, but this does not exclude competition between the factors. Does HuR bind to different sites on the MyoD mRNA? Can the factors bind together and what is the consequence in the critical period of transition at the time of satellite cell activation? 2) TTP is down-regulated at the transcriptional level in activated satellite cells. Why do the authors insist on the functional importance of TTP inactivation by phosphorylation in this context and what is the relative timing of these events? A weakness of the TTP phosphorylation data in this paper is that the antibody to phosphorylated TTP does not work well on sections so that evidence on its in vivo significance is largely circumstantial. More experiments on isolated fibres without TTP overexpression would be helpful. 3) The question of maintenance of satellite cell quiescence, versus return to quiescence after activation, is raised in the paper. The mutant TTP phenotype indicates inappropriate activation in the absence of injury, although this could be a failure of acquisition of quiescence by satellite cells in the postnatal period of growth. Experiments with isolated fibres and siRNA would permit analysis of the role of TTP in the maintenance of Pax7-positive cells that do not differentiate but normally reconstitute the quiescent satellite cell pool. 4) TTP targets pre-inflammatory mRNAs in macrophages and down-regulation of TTP activity leads to up-regulation of TNFa receptors. The authors examine triple mutants as well as the simple TTP mutant, showing rescue of the TTP mutant phenotype. The TTP mutation is not targeted to satellite cells and may therefore exert indirect effects on these cells via the inflammatory response which is known to be important for muscle regeneration. The authors should take this into account. 5) Experiments on TTP and mRNA stability are carried out in HeLa cells. It would be more satisfactory to show the effect on MyoD mRNA in satellite cells. Are many other mRNAs in satellite cells affected? Reviewer #2: In this manuscript, Hausburg et al. identify the mRNA decay factor Tristetraprolin (TTP) as a mediator of satellite cell (SC) quiescence. While the data supporting TTP as a regulator of MyoD transcript is convincing, the mechanism by which TTP is regulated from SC quiescence to activation needs further clarification. 1) The microarray and qPCR analyses do not appear to correlate with protein expression analysis of TTP. The authors clearly show that Zfp36 transcript levels are highest in the quiescent state and this rapidly decreases upon SC activation (either following injury or in culture). At the same time, the authors suggest that in quiescent SCs TTP protein is active and will target its own mRNA for rapid decay. The authors use this reasoning to conclude why they only observe TTP protein expression in 50% of SCs. Yet, their microarray and qPCR analysis would suggest that mRNA levels should be high, and thus, protein levels should be readily detectable. To add to the confusion, the authors suggest that p38α/β activation results in TTP phosphorylation and stabilization of the protein. If this is the case, mRNA transcript levels should also be stabilized since the protein will no longer mediate decay of its transcript. Additionally, the protein should be readily detectable in all SCs due to its increased stability. According to Figure 2D, however, this is not the case as the number of TTP+/Sdc4+ cells do not increase following injury. The authors need to re-evaluate and clarify their proposed mechanism for how TTP protein and mRNA are regulated from quiescence to activation. 2) The link made in this manuscript between p38α/β activation and TTP regulation is based solely on previously published work. In this study, however, experiments to confirm that this mechanism is active in SCs were not adequate. Inhibiting p38α/β activation by chemical inhibitors does not necessarily demonstrate a direct regulation by p38α/β on TTP. Does MK2 phosphorylate TTP directly in SCs? Proximity ligation assay between phospho-MK2 and TTP would enhance this claim. Specific siRNA knock-down of MK2 in SCs cultured on myofibers demonstrating reduced TTP phosphorylation is also needed. 3) Figure 3C demonstrates immunoreactivity of phospho-TTP on an isolated SC. The authors should also provide staining of phospho-TTP from SCs cultured on myofibers comparing immediately isolated fibers (quiescent SCs) to SCs cultured on myofibers for 30 hours (activated). 4) Given that TTP is a proposed mediator of SC quiescence, it is very surprising that there were no differences in Pax7+ SC numbers in TTP KO and 3KO mice compared to WT. At what age were these mice examined? Would there be a difference in mice of older ages? Are other TTP family members compensating for the loss of TTP, and are mice with KO of multiple TTP family members available? 5) MyoD and Myf5 are known to be differentially regulated in satellite cells. Does TTP target Myf5? This is an important point to address and may highlight the differences in MyoD vs. Myf5 regulation. Reviewer #3: The manuscript by Hausberg and colleagues addresses regulation of MyoD by the RNA binding protein, TTP. The study of RNA binding proteins in stem/progenitor cells is topical. Its role in MyoD regulation, a master regulator of myogenesis warrants investigation. Overall, the authors have done an excellent job of carefully analyzing the expression of TTP during satellite cell quiescence and transition to proliferation, and its regulation of MyoD. In addition, the germline knockout mice show a satellite cell phenotype in vivo showing that TTP is functionally relevant. However at present, I am less clear of the role of TTP in SC function/regulation as it pertains to MyoD. I have two major points that need addressing: the stability and active transcription of MyoD in quiescence cells and the role of TTP as it pertains to p38 and MyoD on satellite cell function. 1) To conclude that TTP directly impacts MyoD stability in quiescent cells it is important to demonstrate that MyoD is actively transcribed in quiescent cells. As a suggestion, could the authors perform an in-vitro stability assay whereby extract from quiescent vs activated cells is incubated with transcribed labeled 3'UTR MyoD reporter to see if stability of the reporter is differentially affected? Subsequently immunodeplete TTP and see what happens to reporter stability. Figure 4: Is it possible to use a MyoD mutant lacking the 3' region and flag tag? In combination with the presented data, this would substantiate the authors conclusions that wild type TTP directly binds the MyoD 3' UTR. 2) The authors correctly conclude that TTP regulates SC biology in some fashion. However the manuscript is not clearly written to pin down the role that TTP plays as it pertains to MyoD and p38. In the Results, subsection headed “A constitutively active mutant TTP blocks MyoD induction”: The authors use MyoD as a negative marker of SC quiescence. MyoD cannot be used in this case considering that TTP regulates MyoD. A different (independent) marker is needed. The use of germline mutants demonstrates an increased fraction of Pax7+ SCs express the cycling marker, Ki67. An increased number of MyoD+ cells are also reported. However the total number of Pax7 cells is not altered. Finally, the number of central nuclei is increased. The authors use the presence of MyoD as a mark of commitment. On its own MyoD alone cannot be used to determine commitment versus cycling satellite cells. Are MyoD+ cells expressing Pax7? Please provide data to substantiate conclusions. Overall, TTPs role in SC biology needs to be solidified. The authors should incorporate in vitro experiments to determine differences in cell cycle entry, expansion, differentiation and the re-establishment of quiescence. [Editors' note: further revisions were requested prior to acceptance, as described below.] Thank you for resubmitting your work entitled “Post-transcriptional regulation of satellite cell quiescence by TTP-mediated mRNA decay” for further consideration at eLife. Your revised article has been favorably evaluated by Janet Rossant (Senior editor), a Reviewing editor, and two reviewers. The manuscript has been improved but there are a few remaining issues that need to be addressed before acceptance, as outlined below: 1) The proximity ligation assay (Figure 3C) was performed in MM14 cells. As the focus of this study is on the maintenance of SC quiescence, this experiment should be performed on isolated SCs or myofiber associated SCs. 2) If the phospho-TTP antibody works for myofiber staining, it should be used to demonstrate an increase in phospho-TTP within SCs during activation (perform a time course). The authors stated in their response that p38α/β is phosphorylated immediately upon isolation and therefore TTP will already be phosphorylated. However, it is worth examining whether or not an increase in phospho-TTP staining can be detected during the course of SC activation. 3) It is unclear which TTP antibody was used for the myofiber experiment in Figure 3E. The text in the manuscript and figure legends suggests that non-phospho TTP antibody was used. The labeling within the figure, however, shows that fibers were stained with anti-phospho-TTP. Please clarify which antibody was used. 4) The number of MyoD+ and central nuclei should be expressed per muscle section in addition to the data already presented. This would help the reader to understand TTP disruption and its effects on activation (MyoD) and fusion (central nucleation) compared to uninjured wildtpe muscle (∼0% MyoD+ and central nucleation) and full injury (∼100% MyoD and central nucleation. Reviewer #1: 1) HuR is another mRNA binding protein which is known to stabilise MyoD mRNA. Unlike TTP it is expressed at a higher level in activated satellite cells. The authors show that TTP does not regulate HuR, but this does not exclude competition between the factors. Does HuR bind to different sites on the MyoD mRNA? Can the factors bind together and what is the consequence in the critical period of transition at the time of satellite cell activation? We have not addressed this point directly, however, our manuscript examines the transition of the satellite cell from the quiescent to an activated state. As we cannot detect HuR in quiescent satellite cells and HuR mRNA is induced when TTP declines, it is not likely that both proteins are present early during SC activation. We do show that TTP is not regulating HuR. During SC activation HuR is not present and knockdown or inhibition of TTP in quiescent SCs induces MyoD. Whether HuR is induced upon TTP knockdown is not known. Since our manuscript focuses on TTP, we believe these potentially interesting experiments are not relevant to the current work but we plan to explore the role of HuR and other RNA binding proteins in SC activation and SC self-renewal. 2) TTP is down-regulated at the transcriptional level in activated satellite cells. Why do the authors insist on the functional importance of TTP inactivation by phosphorylation in this context and what is the relative timing of these events? A weakness of the TTP phosphorylation data in this paper is that the antibody to phosphorylated TTP does not work well on sections so that evidence on its in vivo significance is largely circumstantial. More experiments on isolated fibres without TTP overexpression would be helpful. We now show with new data in Figure 3 that a short incubation (24h) with a MK2 inhibitor recapitulates the p38 inhibitor, preventing MyoD protein up-regulation. P38α/β MAPK is the only known kinase that phosphorylates MK2.Furthermore, we establish by PLA that TTP and MK2 are present in a complex in myogenic cells, directly confirming the role of MK2 and providing strong support that the p38α/β pathway regulates TTP activity. 3) The question of maintenance of satellite cell quiescence, versus return to quiescence after activation, is raised in the paper. The mutant TTP phenotype indicates inappropriate activation in the absence of injury, although this could be a failure of acquisition of quiescence by satellite cells in the postnatal period of growth. Experiments with isolated fibres and siRNA would permit analysis of the role of TTP in the maintenance of Pax7-positive cells that do not differentiate but normally reconstitute the quiescent satellite cell pool. We attempted to perform longer drug treatments in culture but ultimately decided an in vivo demonstration that inhibition of TTP disrupts SC quiescence would be the most convincing experiment. We utilized a novel retroviral approach to directly demonstrate that knockdown of TTP specifically in SCs breaks SC quiescence, induces MyoD protein accumulation, is accompanied by exit of SCs from G0, and increases myonuclear accretion. These data demonstrate directly the involvement of TTP in maintaining SC quiescence and SC homeostasis. We have not addressed the role of TTP in SC self-renewal as these experiments are not the focus of the current manuscript and are technically very challenging. Accordingly, references to TTP and SC self-renewal in the narrative were removed. 4) TTP targets pre-inflammatory mRNAs in macrophages and down-regulation of TTP activity leads to up-regulation of TNFa receptors. The authors examine triple mutants as well as the simple TTP mutant, showing rescue of the TTP mutant phenotype. The TTP mutation is not targeted to satellite cells and may therefore exert indirect effects on these cells via the inflammatory response which is known to be important for muscle regeneration. The authors should take this into account. Please see comments above to (3). 5) Experiments on TTP and mRNA stability are carried out in HeLa cells. It would be more satisfactory to show the effect on MyoD mRNA in satellite cells. Are many other mRNAs in satellite cells affected? Myogenic cells express TTP and endogenous TTP will obscure interpretation of the data. We chose the HeLa system as these cells are nearly devoid of TTP and permit us to directly determine the effects of TTP and the p38α/β pathway on MyoD mRNA stability. It would be difficult to perform similar experiments in myogenic cells as the endogenous MyoD and TTP would pose significant technical challenges in experimental design and interpretation. We are very interested in other mRNAs regulated by TTP and there are undoubtedly other mRNAs that play critical regulatory roles. We are performing unbiased sequencing experiments to identify these and plan to present the data in a subsequent manuscript. Reviewer #2: 1) The microarray and qPCR analyses do not appear to correlate with protein expression analysis of TTP. The authors clearly show that Zfp36 transcript levels are highest in the quiescent state and this rapidly decreases upon SC activation (either following injury or in culture). At the same time, the authors suggest that in quiescent SCs TTP protein is active and will target its own mRNA for rapid decay. The authors use this reasoning to conclude why they only observe TTP protein expression in 50% of SCs. Yet, their microarray and qPCR analysis would suggest that mRNA levels should be high, and thus, protein levels should be readily detectable. To add to the confusion, the authors suggest that p38α/β activation results in TTP phosphorylation and stabilization of the protein. If this is the case, mRNA transcript levels should also be stabilized since the protein will no longer mediate decay of its transcript. Additionally, the protein should be readily detectable in all SCs due to its increased stability. According to , however, this is not the case as the number of TTP+/Sdc4+ cells do not increase following injury. The authors need to re-evaluate and clarify their proposed mechanism for how TTP protein and mRNA are regulated from quiescence to activation. The reviewer has made an excellent point. The reviewer assumes that isolated SCs from which the RNA was obtained are quiescent, however, they are not quiescent but activated. We have previously reported that p38α/β MAPK is activated within minutes of injury and confirm those data here with our analysis of TTP phosphorylation. Thus, the high levels of TTP mRNA observed in freshly isolated SCs are likely due to TTP phosphorylation and subsequent TTP mRNA stabilization. Clearly, TTP mRNA is transcriptionally regulated by mechanisms that are not yet known as the mRNA declines following SC activation. For Figure 2D, the observation was made 1h post BaCl2, a short time period after SC activation. Whether this is a sufficient time to change TTP levels is unclear but a worthwhile question. However, the ratio of phospho-TTP to TTP should change dramatically. Unfortunately, the available anti-phospho-TTP antibodies do not work in sections, where we have extensively attempted a variety of techniques to improve phospho-TTP detection. Alternatively, SCs isolated and analyzed in culture are 3-5h or more post activation and do show extensive phospho-TTP immunoreactivity in virtually all cells. For the final point, we agree that additional experiments would solidify the pathway. We have performed several additional experiments, particularly with MK2 that support our conclusions (see new data in Figure 3, Figure 2–figure supplement 1 and Figure 3–figure supplement 1) Finally, to better address the role of TTP in satellite cells, we knocked down TTP in quiescent SCs in the absence of muscle injury. When TTP expression is reduced, SCs break quiescence, induce MyoD, and fuse into existing myofibers. These new data are presented in Figure 5 and Figure 5–figure supplement 2 (see comment (3) for Reviewer 1). 2) The link made in this manuscript between p38α/β activation and TTP regulation is based solely on previously published work. In this study, however, experiments to confirm that this mechanism is active in SCs were not adequate. Inhibiting p38α/β activation by chemical inhibitors does not necessarily demonstrate a direct regulation by p38α/β on TTP. Does MK2 phosphorylate TTP directly in SCs? Proximity ligation assay between phospho-MK2 and TTP would enhance this claim. Specific siRNA knock-down of MK2 in SCs cultured on myofibers demonstrating reduced TTP phosphorylation is also needed. We have addressed both of these excellent points. First, we performed PLA for MK2 and demonstrate that MK2 and TTP are in a complex in myogenic cells. Second, we used a chemical MK2 inhibitor to demonstrate that inhibition of MK2 prevents MyoD protein induction, similar to p38α/β inhibition and constitutive TTP activation. See comment (2) to Reviewer 1. 3) demonstrates immunoreactivity of phospho-TTP on an isolated SC. The authors should also provide staining of phospho-TTP from SCs cultured on myofibers comparing immediately isolated fibers (quiescent SCs) to SCs cultured on myofibers for 30 hours (activated). First, on immediately isolated fibers SCs are not quiescent but activated. Thus, the experiment as suggested will not work as TTP is phosphorylated upon isolation (See ) as most/all SCs on myofibers are phospho- p38α/β+ upon isolation. We have performed additional experiments to address the concern. First, MK2 is not phosphorylated in uninjured muscle (new Figure 2–figure supplement 1A) and inhibition of MK2 prevents TTP phosphorylation and MyoD accumulation (new data as Figure 3E). 4) Given that TTP is a proposed mediator of SC quiescence, it is very surprising that there were no differences in Pax7+ SC numbers in TTP KO and 3KO mice compared to WT. At what age were these mice examined? Would there be a difference in mice of older ages? Are other TTP family members compensating for the loss of TTP, and are mice with KO of multiple TTP family members available? We agree with the reviewer and expected to see a reduction in SCs. While the numbers trend toward reduction, they are not significantly different in the knockout mice. With exercise or aging we expect to see a reduction but these experiments were not performed and are tangential to the focus of this manuscript. We performed a knock-down of TTP specifically in SCs and found that that these cells exit quiescence and fuse into myofibers in the absence of injury (new data in Figure 5 and Figure 5–figure supplement 2). For the knockdown, we do observe a significant reduction in Pax7+ cells (See new Figure 5) in agreement with the reviewer’s expectations. Finally, there are no Brf1 or Brf2 cKO mice available. We are, however, interested in functional compensation between family members and are actively pursuing this hypothesis in a separate manuscript. 5) MyoD and Myf5 are known to be differentially regulated in satellite cells. Does TTP target Myf5? This is an important point to address and may highlight the differences in MyoD vs. Myf5 regulation. We did not test Myf5 directly but given the absence of a consensus AU rich binding site, it is unlikely that TTP targets Myf5 directly. Of particular interest are whether the post-transcriptional regulation of MyoD and Myf5 collaborate or are executed in different subpopulations of SCs. Experiments to test this latter possibility are the subject of an ongoing study and will be published in a future manuscript. Reviewer #3: I have two major points that need addressing: the stability and active transcription of MyoD in quiescence cells and the role of TTP as it pertains to p38 and MyoD on satellite cell function. 1) To conclude that TTP directly impacts MyoD stability in quiescent cells it is important to demonstrate that MyoD is actively transcribed in quiescent cells. As a suggestion, could the authors perform an in-vitro stability assay whereby extract from quiescent vs activated cells is incubated with transcribed labeled 3'UTR MyoD reporter to see if stability of the reporter is differentially affected? Subsequently immunodeplete TTP and see what happens to reporter stability. We show this by microarray analysis, it has been confirmed and published by the Rando lab and the reference is included. Our unpublished RNA-Seq data show MyoD is present but these cells are activated, not quiescent. Presently, a run-on experiment to directly demonstrate MyoD transcription in quiescent SCs is not technically possible. Freshly isolated SCs are not quiescent and thus, if performed on freshly isolated cells, these experiments could be difficult to interpret. We realize this is not a fully satisfactory answer but do not believe there are better alternatives at this time. : Is it possible to use a MyoD mutant lacking the 3' region and flag tag? In combination with the presented data, this would substantiate the authors conclusions that wild type TTP directly binds the MyoD 3' UTR. The most convincing data are to mutate the putative binding site and demonstrate that the mutation abrogates binding of TTP and abrogates TTP function. These are precisely the experiments we reported. Removal of the entire 3’ UTR would eliminate any potential secondary binding sites that may contribute to function. Thus, we believe the mutant AU-rich sequence provides the most convincing evidence for the involvement of TTP in regulating MyoD stability. Since the suggested experiment would not add to the data presented we elected not to perform these experiments as they are time consuming and require extensive testing and analysis of new constructs. 2) The authors correctly conclude that TTP regulates SC biology in some fashion. However the manuscript is not clearly written to pin down the role that TTP plays as it pertains to MyoD and p38. We have now knocked down TTP in vivo in SCs and demonstrate directly that these SCs, exit quiescence, accumulate MyoD protein and fuse into myofibers. Additional data presented show that MK2 is present in a complex with TTP and that MK2 inhibition yields results similar to p38α/β inhibition and TTP activation. We believe these data further support a role for the p38α/β pathway regulating TTP activity and MyoD mRNA stability. In the Results, subsection headed “A constitutively active mutant TTP blocks MyoD induction”: The authors use MyoD as a negative marker of SC quiescence. MyoD cannot be used in this case considering that TTP regulates MyoD. A different (independent) marker is needed. We use Pax7 as well, although we are limited here by the ability to identify truly quiescent SCs. There is no marker of quiescence other than absence of phospho-MK2 or phospho-p38α/β MAPK. The use of germline mutants demonstrates an increased fraction of Pax7+ SCs express the cycling marker, Ki67. An increased number of MyoD+ cells are also reported. However the total number of Pax7 cells is not altered. Finally, the number of central nuclei is increased. The authors use the presence of MyoD as a mark of commitment. On its own MyoD alone cannot be used to determine commitment versus cycling satellite cells. Are MyoD+ cells expressing Pax7? Please provide data to substantiate conclusions. We are in agreement with the reviewers but due to the number of markers needed to identify the cells, we have no other choices. We performed additional experiments to specifically knockdown TTP in quiescent SCs in the absence of injury and believe these experiments provide strong support for our conclusions. Please see prior reviewer’s comments and new data in Figures 3, 5 and Figure 2nd and new data in F, Figure 3–Figure s, 2nd new d and Figure 5–figure supplement 2. Overall, TTPs role in SC biology needs to be solidified. The authors should incorporate in vitro experiments to determine differences in cell cycle entry, expansion, differentiation and the re-establishment of quiescence. Because the TTP mRNA is down-regulated following activation, these experiments would introduce TTP as an artifact and make experimental interpretation difficult. We elected to perform a similar experiment in vivo and report those data in the new Figure 5 and Figure 5–figure supplement 2. The role of TTP in self-renewal and re-establishment of quiescence is an important topic we are keenly interested in and plan a future manuscript on this topic. These experiments are technically challenging and not the focus of the current manuscript which has been reworded to better emphasize our focus on maintaining quiescence and SC homeostasis. [Editors' note: further revisions were requested prior to acceptance, as described below.] 1) The proximity ligation assay () was performed in MM14 cells. As the focus of this study is on the maintenance of SC quiescence, this experiment should be performed on isolated SCs or myofiber associated SCs. We performed the proximity ligation assay using primary isolated SCs and the full spectrum of RNABP antibodies described in the prior submission. We show the new data alongside the MM14 results in an updated Figure 3 demonstrating that pMK2::TTP and pMK2::HuR complexes are present in primary SCs and MM14 cells (see updated Figure 3C, D). 2) If the phospho-TTP antibody works for myofiber staining, it should be used to demonstrate an increase in phospho-TTP within SCs during activation (perform a time course). The authors stated in their response that p38α/β is phosphorylated immediately upon isolation and therefore TTP will already be phosphorylated – however, it is worth examining whether or not an increase in phospho-TTP staining can be detected during the course of SC activation. As stated and shown in the prior revision (Figure 2–figure supplement 1) illustrates, phospho-TTP is detectable in isolated SCs immediately following isolation (approximately 1h 20m post-dissection). Single myofiber isolation takes slightly more time (∼1h 50m) and thus may not be able to capture the [presumably] rapid inactivation (phosphorylation) of TTP. Despite this likely outcome, we performed a detailed short-term time course (0,3,6,12,24h) to query the extent of phospho-TTP in myofiber-associated SCs. Importantly, we confirm that TTP is rapidly inactivated in Pax7+ SCs and remains inactive for at least 24h post-isolation (see new Figure 2–figure supplement 2). 3) It is unclear which TTP antibody was used for the myofiber experiment in . The text in the manuscript and figure legends suggests that non-phospho TTP antibody was used. The labeling within the figure, however, shows that fibers were stained with anti-phospho-TTP. Please clarify which antibody was used. We thank the reviewers and apologize for our mistake and the confusion. We used the phospho-TTP antibody in Figure 3E. The figure labeling was indeed correct and references to these data in the main text and figure legends now agree and read “phospho-TTP”. 4) The number of MyoD+ and central nuclei should be expressed per muscle section in addition to the data already presented. This would help the reader to understand TTP disruption and its effects on activation (MyoD) and fusion (central nucleation) compared to uninjured wildtpe muscle (∼0% MyoD+ and central nucleation) and full injury (∼100% MyoD and central nucleation. We have now included detailed raw data (and associated statistics as appropriate) for all of the quantified graphs presented in Figure 5. These data can be found in Supplementary file 2A (TTP/3KO studies) and Supplementary file 2B (RCAS/shRNA studies). These show the data from which all of the graphs were derived.
  43 in total

1.  Muscle satellite cells are primed for myogenesis but maintain quiescence with sequestration of Myf5 mRNA targeted by microRNA-31 in mRNP granules.

Authors:  Colin G Crist; Didier Montarras; Margaret Buckingham
Journal:  Cell Stem Cell       Date:  2012-07-06       Impact factor: 24.633

2.  Alternative polyadenylation mediates microRNA regulation of muscle stem cell function.

Authors:  Stéphane C Boutet; Tom H Cheung; Navaline L Quach; Ling Liu; Sara L Prescott; Abdolhossein Edalati; Kevin Iori; Thomas A Rando
Journal:  Cell Stem Cell       Date:  2012-03-02       Impact factor: 24.633

3.  Interactions of CCCH zinc finger proteins with mRNA: non-binding tristetraprolin mutants exert an inhibitory effect on degradation of AU-rich element-containing mRNAs.

Authors:  Wi S Lai; Elizabeth A Kennington; Perry J Blackshear
Journal:  J Biol Chem       Date:  2002-01-08       Impact factor: 5.157

4.  Production of avian retroviruses and tissue-specific somatic retroviral gene transfer in vivo using the RCAS/TVA system.

Authors:  Alexander von Werder; Barbara Seidler; Roland M Schmid; Günter Schneider; Dieter Saur
Journal:  Nat Protoc       Date:  2012-05-24       Impact factor: 13.491

5.  Communication of the position of exon-exon junctions to the mRNA surveillance machinery by the protein RNPS1.

Authors:  J Lykke-Andersen; M D Shu; J A Steitz
Journal:  Science       Date:  2001-09-07       Impact factor: 47.728

6.  Quantitative ultrastructural study of muscle satellite cells in Duchenne dystrophy.

Authors:  Y Wakayama; D L Schotland; E Bonilla; E Orecchio
Journal:  Neurology       Date:  1979-03       Impact factor: 9.910

7.  MK2-induced tristetraprolin:14-3-3 complexes prevent stress granule association and ARE-mRNA decay.

Authors:  Georg Stoecklin; Tiffany Stubbs; Nancy Kedersha; Stephen Wax; William F C Rigby; T Keith Blackwell; Paul Anderson
Journal:  EMBO J       Date:  2004-03-11       Impact factor: 11.598

Review 8.  The RCAS vector system.

Authors:  Stephen H Hughes
Journal:  Folia Biol (Praha)       Date:  2004       Impact factor: 0.906

9.  The p38/MK2-driven exchange between tristetraprolin and HuR regulates AU-rich element-dependent translation.

Authors:  Christopher Tiedje; Natalia Ronkina; Mohammad Tehrani; Sonam Dhamija; Kathrin Laass; Helmut Holtmann; Alexey Kotlyarov; Matthias Gaestel
Journal:  PLoS Genet       Date:  2012-09-27       Impact factor: 5.917

10.  Rejuvenation of the muscle stem cell population restores strength to injured aged muscles.

Authors:  Benjamin D Cosgrove; Penney M Gilbert; Ermelinda Porpiglia; Foteini Mourkioti; Steven P Lee; Stephane Y Corbel; Michael E Llewellyn; Scott L Delp; Helen M Blau
Journal:  Nat Med       Date:  2014-02-16       Impact factor: 53.440

View more
  49 in total

1.  Single cell analysis of adult mouse skeletal muscle stem cells in homeostatic and regenerative conditions.

Authors:  Stefania Dell'Orso; Aster H Juan; Kyung-Dae Ko; Faiza Naz; Jelena Perovanovic; Gustavo Gutierrez-Cruz; Xuesong Feng; Vittorio Sartorelli
Journal:  Development       Date:  2019-04-11       Impact factor: 6.868

2.  Tis11 mediated mRNA decay promotes the reacquisition of Drosophila intestinal stem cell quiescence.

Authors:  Lindy McClelland; Heinrich Jasper; Benoît Biteau
Journal:  Dev Biol       Date:  2017-04-23       Impact factor: 3.582

3.  Muscle development and regeneration controlled by AUF1-mediated stage-specific degradation of fate-determining checkpoint mRNAs.

Authors:  Dounia Abbadi; Ming Yang; Devon M Chenette; John J Andrews; Robert J Schneider
Journal:  Proc Natl Acad Sci U S A       Date:  2019-05-21       Impact factor: 11.205

4.  Transcriptional Profiling of Quiescent Muscle Stem Cells In Vivo.

Authors:  Cindy T J van Velthoven; Antoine de Morree; Ingrid M Egner; Jamie O Brett; Thomas A Rando
Journal:  Cell Rep       Date:  2017-11-14       Impact factor: 9.423

Review 5.  Stem Cell Quiescence: Dynamism, Restraint, and Cellular Idling.

Authors:  Cindy T J van Velthoven; Thomas A Rando
Journal:  Cell Stem Cell       Date:  2019-02-07       Impact factor: 24.633

Review 6.  Cellular Mechanisms and Regulation of Quiescence.

Authors:  Océane Marescal; Iain M Cheeseman
Journal:  Dev Cell       Date:  2020-11-09       Impact factor: 12.270

Review 7.  Myogenic regulatory factors: The orchestrators of myogenesis after 30 years of discovery.

Authors:  Hasan A Asfour; Mohammed Z Allouh; Raed S Said
Journal:  Exp Biol Med (Maywood)       Date:  2018-01-07

Review 8.  Molecular circuitry of stem cell fate in skeletal muscle regeneration, ageing and disease.

Authors:  Albert E Almada; Amy J Wagers
Journal:  Nat Rev Mol Cell Biol       Date:  2016-03-09       Impact factor: 94.444

9.  Targeted mRNA Decay by RNA Binding Protein AUF1 Regulates Adult Muscle Stem Cell Fate, Promoting Skeletal Muscle Integrity.

Authors:  Devon M Chenette; Adam B Cadwallader; Tiffany L Antwine; Lauren C Larkin; Jinhua Wang; Bradley B Olwin; Robert J Schneider
Journal:  Cell Rep       Date:  2016-07-21       Impact factor: 9.423

10.  Niche Cadherins Control the Quiescence-to-Activation Transition in Muscle Stem Cells.

Authors:  Aviva J Goel; Marysia-Kolbe Rieder; Hans-Henning Arnold; Glenn L Radice; Robert S Krauss
Journal:  Cell Rep       Date:  2017-11-21       Impact factor: 9.423

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.