Thorsten Pfirrmann1, Pablo Villavicencio-Lorini2, Abinash K Subudhi1, Ruth Menssen3, Dieter H Wolf3, Thomas Hollemann1. 1. Martin-Luther University Halle-Wittenberg, Institute of Physiological Chemistry, Halle, Germany. 2. Martin Luther University Halle-Wittenberg, Institute of Human Genetics, Halle, Germany. 3. University of Stuttgart, Institute of Biochemistry, Pfaffenwaldring 55, 70569 Stuttgart, Germany.
Abstract
In Saccharomyces cerevisiae the Gid-complex functions as an ubiquitin-ligase complex that regulates the metabolic switch between glycolysis and gluconeogenesis. In higher organisms six conserved Gid proteins form the CTLH protein-complex with unknown function. Here we show that Rmnd5, the Gid2 orthologue from Xenopus laevis, is an ubiquitin-ligase embedded in a high molecular weight complex. Expression of rmnd5 is strongest in neuronal ectoderm, prospective brain, eyes and ciliated cells of the skin and its suppression results in malformations of the fore- and midbrain. We therefore suggest that Xenopus laevis Rmnd5, as a subunit of the CTLH complex, is a ubiquitin-ligase targeting an unknown factor for polyubiquitination and subsequent proteasomal degradation for proper fore- and midbrain development.
In Saccharomyces cerevisiae the Gid-complex functions as an ubiquitin-ligase complex that regulates the metabolic switch between glycolysis and gluconeogenesis. In higher organisms six conserved Gid proteins form the CTLH protein-complex with unknown function. Here we show that Rmnd5, the Gid2 orthologue from Xenopus laevis, is an ubiquitin-ligase embedded in a high molecular weight complex. Expression of rmnd5 is strongest in neuronal ectoderm, prospective brain, eyes and ciliated cells of the skin and its suppression results in malformations of the fore- and midbrain. We therefore suggest that Xenopus laevisRmnd5, as a subunit of the CTLH complex, is a ubiquitin-ligase targeting an unknown factor for polyubiquitination and subsequent proteasomal degradation for proper fore- and midbrain development.
Previously, we isolated nine GID (glucose-induced degradation deficient) genes necessary for the glucose-induced degradation of fructose-1,6-bisphosphatase (FBPase) from yeast [1]. Seven of these proteins are part of a high molecular mass protein complex. In Saccharomyces cerevisiae the so-called Gid-complex functions as an ubiquitin-ligase complex that targets key gluconeogenic enzymes for polyubiquitination and subsequent proteasomal degradation to initiate an irreversible shutdown of the gluconeogenic pathway [2-4].The ubiquitin proteasome system (UPS) regulates the targeted temporal and spatial degradation of proteins. The covalent modification of a protein with ubiquitin requires a set of three classes of enzymes, the ubiquitin-activating enzyme (E1), the ubiquitin-conjugating enzyme (E2) and finally the ubiquitin-ligase (E3) [5]. In humans there exist an estimated number of 600 ubiquitin-ligases that all share the E3 typical RING or HECT domain. Classical RING domains bind two zinc atoms by a Cys3HCys4 motif [6]. The Saccharomyces cerevisiae Gid complex contains two proteins with non-canonical RING domains Gid2 and Gid9, the orthologs of RMND5 and MAEA of the vertebrate CTLH complex [3, 4].Most subunits of the Gid-complex are conserved with a remarkable sequence and domain-distribution conservation throughout the eukaryotic kingdom [7]. GID1, GID2, GID4, GID5, GID7, GID8 and GID9 have their closest human relatives in RanBP9, RMND5, C17ORF39, ARMC8, MKLN1, C20ORF1 (aka Twa1) and MAEA respectively. All subunits except C17ORF39 are part of the humanCTLH-complex [8, 9] and a similar complex in Arabidopsis thaliana [10] and other eukaryotes [7] exists.While function and topology of the yeast Gid-complex subunits are well described, the function of the vertebrate counterpart remains poorly understood. Most subunits carry a CTLH-domain (C-terminal to LisH motif domain) and a LisH-domain (lis homology domain) [11]. The latter is often associated with syndromes involving malformations of the central nervous system [12]. For example, the mammalianCTLH/LisH subunit MKLN1, the ortholog of yeastGid7 [4, 8], is expressed in the hippocampus and the cerebellum [13] and was recently found to be involved in dynein dependent GABAA- receptor transport along actin filaments and microtubuli [14]. A similar function is described for ARMC8 [15].RMND5A the human ortholog of yeastGid2 also contains a CTLH/LisH- and the E3 typical RING-domain. Interestingly, mammals encode for two GID2 orthologous genes called RMND5A and RMND5B, but only RMND5A is part of the CTLH-complex. Nevertheless, RMND5B associates with several ubiquitin-conjugating enzymes [16]. Therefore it is likely that both proteins function as ubiquitin-ligases. A recent report describes humanRMND5A expression to be regulated by the small non-coding RNA miRNA-138. In conjunction with RanBP10 and Exportin5, RMND5A is described to protect Exportin5 from proteasomal degradation [17]. Clinical data concerning RMND5A are restricted to a recent case report that describes a giant occipitoparietal meningoencephalocele in a newborn baby. This rare neurodevelopmental defect coincides with a 80.65-kb gain within chromosome band 2p11.2 resulting in a duplication of the RMND5A gene [18].We show that Xenopus laevisRmnd5 functions as an ubiquitin ligase, most probably in the context of the CTLH-complex. Rmnd5 transcript is mainly present in ectodermal derivatives in Xenopus laevis. The suppression of rmnd5 function leads to defects of the prospective prosencephalon and mesencephalon, pointing towards a role of Rmnd5 during neural development. We speculate that Rmnd5 targets a yet unknown neurospecific factor for degradation.
Results and Discussion
Xenopus laevis Rmnd5 protein is structurally and functionally related to human RMND5A
We set out to gain knowledge of the phylogenetic distribution of yeastGid2 orthologous proteins by comparison of the protein sequences. The Gid2/Rmnd5 protein sequences of the indicated organisms were obtained from NCBI and used for multiple sequence analysis with the T-Coffee algorithm [19]. Further reconstruction and analysis of phylogenetic relationships were done by the Phylogeny.fr software [20] and are displayed in Fig. 1A. It can be seen that Gid2/Rmnd5 is conserved throughout the eukaryotic kingdom. In fungi (Saccharomyces cerevisiae, Candida albicans, Aspergillus niger), nematodes (Caenorhabditis elegans), plants (Arabidopsis thaliana), insects (Drosophila melanogaster), amphibians (Xenopus laevis) and birds (Falco peregrinus, Gallus gallus) only a single isoform is present (shown in black), while mammals (Homo sapiens, Ornithorhynchus anatinus, Sarcophilus harrisii, Canis lupus, Mus musculus, Rattus norvegicus possess two isoforms (homolog A in blue, homolog B in red) that are highly similar. Interestingly, the single isoforms existing in Xenopus laevis, Gallus gallus and Falco peregrinus are phylogenetically closer to the mammalian isoform A (Fig. 1B). While the humanRMND5A is 94% identical to Xenopus laevisRmnd5, the humanRMND5B isoform only shows 70% identity (calculated by T-Coffee). In previous studies, we have shown that humanRMND5A localises to the cytosol and to the nucleus, while humanRMND5B is entirely cytosolic [21]. In Fig. 1C representative cells transfected with either Xenopus laevisrmnd5 (Rmnd5, upper panel), humanRMND5A (RMND5A, middle panel) or RMND5B (RMND5B) can be seen. Respective protein localisation is shown in the left column (GFP), the nuclei in the middle (DAPI) and an overlay in the right column (merge). As shown before, humanRMND5A is distributed to the cytosol and the nucleus, while humanRMND5B is cytosolic. Xenopus laevisRmnd5 shows a localisation pattern similar to humanRMND5A and therefore is not only structurally but also functionally closer to humanRMND5A.
Fig 1
Xenopus laevis Rmnd5 protein is structurally and functionally related to human RMND5A.
(A) Phylogenetic tree of Rmnd5 orthologs. The taxonomic tree of representative eukaryotic species rendered by Phylogeny.fr software [20]. Respective Gid2/Rmnd5 sequences obtained from NCBI with indicated accession numbers (Saccharomyces cerevisiae [NP_010541.3], Candida albicans [XP_712238.1], Aspergillus niger [XP_001388791.2], Caenorhabditis elegans [NP_508444.1], Arabidopsis thaliana [NP_196525.1], Drosophila melanogaster [NP_611536.3], Xenopus laevis [NP_001086276.1], Falco peregrinus [XP_005229906.1], Gallus gallus [XP_004936301.1] Homo sapiens [NP_073617.1; NP_073599.2], Ornithorhynchus anatinus [XP_007670084.1; XP_001515875.2], Sarcophilus harrisii [XP_003758697.1; XP_003756956.1], Canis lupus familiaris [XP_852129.1; XP_531873.2], Mus musculus [NP_077250.2; NP_079622.1], Rattus norvegicus [XP_232051.4; NP_001017473.1]); homolog A (blue), homolog B (red). (B) Sequence alignment of Xenopus laevis Rmnd5 (top), Homo sapiens RMND5A (middle) and RMND5B (bottom). Identical residues (red), similar residues (blue), others (black). Identities (%): Xenopus laevis Rmnd5 to human RMND5A (94%), to human RMND5B (70%). (C) Localization of Homo sapiens RMND5A (RMND5a, middle panel), RMND5B (RMND5b, bottom panel) and Xenopus laevis Rmnd5 (Rmnd5, top panel) in HEK293 cells. GFP signal (left column), DAPI signal (middle column), merged signals (right column).
Xenopus laevis Rmnd5 protein is structurally and functionally related to human RMND5A.
(A) Phylogenetic tree of Rmnd5 orthologs. The taxonomic tree of representative eukaryotic species rendered by Phylogeny.fr software [20]. Respective Gid2/Rmnd5 sequences obtained from NCBI with indicated accession numbers (Saccharomyces cerevisiae [NP_010541.3], Candida albicans [XP_712238.1], Aspergillus niger [XP_001388791.2], Caenorhabditis elegans [NP_508444.1], Arabidopsis thaliana [NP_196525.1], Drosophila melanogaster [NP_611536.3], Xenopus laevis [NP_001086276.1], Falco peregrinus [XP_005229906.1], Gallus gallus [XP_004936301.1] Homo sapiens [NP_073617.1; NP_073599.2], Ornithorhynchus anatinus [XP_007670084.1; XP_001515875.2], Sarcophilus harrisii [XP_003758697.1; XP_003756956.1], Canis lupus familiaris [XP_852129.1; XP_531873.2], Mus musculus [NP_077250.2; NP_079622.1], Rattus norvegicus [XP_232051.4; NP_001017473.1]); homolog A (blue), homolog B (red). (B) Sequence alignment of Xenopus laevisRmnd5 (top), Homo sapiensRMND5A (middle) and RMND5B (bottom). Identical residues (red), similar residues (blue), others (black). Identities (%): Xenopus laevisRmnd5 to humanRMND5A (94%), to humanRMND5B (70%). (C) Localization of Homo sapiensRMND5A (RMND5a, middle panel), RMND5B (RMND5b, bottom panel) and Xenopus laevisRmnd5 (Rmnd5, top panel) in HEK293 cells. GFP signal (left column), DAPI signal (middle column), merged signals (right column).Interestingly, two isoforms of RMND5 only exist in mammals with the genomic location of the humanRMND5A gene on chromosome 2 (2p11.2) and the RMND5B gene on chromosome 5 (5q35.3). The appearance of RMND5B is therefore a relatively late event in evolution and most probably a consequence of gene duplication. Despite the high degree of structural conservation, it is not clear if both proteins have redundant, overlapping or completely different functions in the cell. It is also unclear if both isoforms can be part of the CTLH-complex as exchangeable subunits. Therefore, to avoid redundancy effects between RMND5A and RMND5B, we consider Xenopus laevis as an ideal model organism to study Rmnd5 function during early development.
Rmnd5 is expressed during early embryonic development
To study a potential role of Rmnd5 during development of the neural system, we first analyzed its spatio-temporal expression pattern in embryos of Xenopus laevis. We started out looking at the temporal expression of rmnd5 by semi-quantitative RT-PCR using total RNA from consecutive developmental stages of Xenopus laevis embryos. In Fig. 2A a specific signal at the expected size of 305 bp indicated the existence of rmnd5 transcript (upper panel), while ODC1 primers were used to control the amount of input RNA (lower panel). The expression of rmnd5 receives a strong maternal contribution, as RT-PCR products are detectable at NF (Nieuwkoop and Faber) stage 3 and declines steadily until gastrulation (NF stage 12). Zygotic transcripts of rmnd5 are detectable through all further stages analyzed, though on a much lower level compared to NF stage 3. This finding is confirmed on the protein level, but a comparable decline in Rmnd5 levels is not visible (Fig. 2B). Whole mount in situ hybridisation (WMISH) reveals first expression of rmnd5 at the four-cell stage (Fig. 2C-A, NF stage 3) and the eight-cell stage (Fig. 2C-C, NF stage 4). Here rmnd5 transcript is mostly present in the animal pole (top), an area developing into derivatives of ectoderm and mesoderm. During gastrulation (NF-stage 12) increasing levels of rmnd5 transcripts appear enhanced in the prospective head region (Fig. 2C-D) and during neurulation (Fig. 2C-E, NF stage 18) in the neuronal ectoderm (red arrow) and subpopulations of skin cells, most likely the ciliated cells of the skin (Fig. 2C-E, -H; yellow arrow). In a later stage of development (NF stage 34, Fig. 2C-J, -K), the expression of rmnd5 is mainly restricted to head structures and demarcates neural tissues and derivatives. Strong expression is observed in the eyes (Fig. 2C-J, -K, -L; green arrow) and the prosencephalon (Fig. 2C-J, -K, -L, -M; red arrow).
Fig 2
rmnd5 is expressed during early embryonic development.
(A) Temporal RT-PCR analysis of rmnd5 expression (top panel); different developmental stages (NF-stages) indicated at the top. ODC1 functions as RNA input control (bottom). (B) Rmnd5 protein at different developmental stages. Western blot analysis of embryo lysate from indicated stages (top). α-RMND5A (Novus Biological; rabbit, 1:1000); α-Tubulin (AbD Serotec, rat, 1:2500). (C) Spatial analysis of rmnd5 expression. Whole mount in situ hybridisation (Wmish) of wild type Xenopus laevis embryos at different developmental stages. NF stage 3 (panel a, left) and stage 4 (panel c) rmnd5 transcript in the animal pole (top), NF-stage 12 (panel d) rmnd5 transcripts around the prospective head, NF-stage 18; 24 (panel e, f, g, h) neuronal ectoderm (red arrow, panel e) and ciliated cells of the skin (yellow arrow, panel e, g, h), NF-stage 34 (panel j, k, l, m) proencephalon (red arrow) and eyes (green arrow). Negative controls with sense probes (panel b, i).
rmnd5 is expressed during early embryonic development.
(A) Temporal RT-PCR analysis of rmnd5 expression (top panel); different developmental stages (NF-stages) indicated at the top. ODC1 functions as RNA input control (bottom). (B) Rmnd5 protein at different developmental stages. Western blot analysis of embryo lysate from indicated stages (top). α-RMND5A (Novus Biological; rabbit, 1:1000); α-Tubulin (AbD Serotec, rat, 1:2500). (C) Spatial analysis of rmnd5 expression. Whole mount in situ hybridisation (Wmish) of wild type Xenopus laevis embryos at different developmental stages. NF stage 3 (panel a, left) and stage 4 (panel c) rmnd5 transcript in the animal pole (top), NF-stage 12 (panel d) rmnd5 transcripts around the prospective head, NF-stage 18; 24 (panel e, f, g, h) neuronal ectoderm (red arrow, panel e) and ciliated cells of the skin (yellow arrow, panel e, g, h), NF-stage 34 (panel j, k, l, m) proencephalon (red arrow) and eyes (green arrow). Negative controls with sense probes (panel b, i).Our results show, that in Xenopus laevisrmnd5 transcripts and Rmnd5 protein are present continuously within the investigated time frame. The localisation of transcripts in neuronal ectoderm, prospective prosencephalon, the eyes and subpopulations of the skin suggests a function during neural development.
Rmnd5 is important for proper early development of the embryonic forebrain
In order to analyze the function of Rmnd5, we inhibit the translation of rmnd5 via injection of targeted antisense morpholino oligonucleotides. We injected 2.5 pmol rmnd5-morpholino together with 100 pg synthetic beta-gal RNA as a tracer into one cell of two-cell stage embryos and fixed them at NF stage 32–34. For further analysis, embryos were subjected to whole-mount in situ hybridisation (WMISH) after fixation and beta-Gal staining. A set of probes was employed to cover different states of differentiation and morphogenesis during the development of the central nervous system. Noticeable, loss of Rmnd5 function suppresses mostly the proper development of the mesencephalon, the prosencephalon and the eye. For example pax6 expression at stage 34 is specific to amacrine and bipolar cells of the retina, epithelium of the lens, prospective prosencephalon and interneurons [22]. As a prominent phenotype, expression of pax6 in the rmnd5-morpholino injected side (IS) is completely absent from the prospective prosencephalon (Fig. 3A-B, yellow arrow) while expression in the mid-/hindbrain was shifted to posterior (Fig. 3A-B, compare green/ red arrow). In a frontal section the lack of pax6 signal in the dorsal area of the prospective prosencephalon is obvious, since the respective tissue is almost absent (Fig. 3A-D, yellow arrow). Thus, the lack of expression can be observed with all other marker genes (Fig. 3A-J, -L, [n-tubulin],-n,-q [en2],-x’ [nkx2.1] and Fig. 3B, -B, -D, -E, [sox2]; yellow arrow). Strikingly, the expression of n-tubulin in subpopulations of skin cells is also severely reduced (Fig. 3A-H, -I), while expression in the prosepective spinal cord is not altered (Fig. 3A-K). In contrast, structures arising from placodes such as the olfactory placodes (Fig. 3A-F, green/red arrow) and the trigeminal nerve (3A-J, green/red arrow) or of mesodermal origin such as the heart tube (3A-M, -O, -P, -S, c-Actin, blue arrow) appear normal. The non-injected sides (NIS) of these embryos and standard morpholino injected embryos (S2 Fig.) do not expose such phenotypes. To control for off-target effects of the rmnd5 morpholino, we performed rescue experiments, injecting a synthetic rmnd5 RNA that cannot be targeted by the rmnd5-morpholino. In the presence of the rescuing RNA, the rmnd5 knockdown phenotype can be partially restored (Fig. 3C). Together our data suggests a role of Rmnd5 during the early development of dorsal areas of the pro- and mesencephalon, the eyes and most likely the ciliated cells of the skin. Its specific expression in these territories strongly supports a direct function of rmnd5 during these processes (Fig. 2C-E,-H, -J, -K, -L, -M).
Fig 3
The CTLH complex functions during early embryonic neurogenesis.
(A) rmnd5-mo injected embryos were used for in situ hybridisation with indicated marker probes; pax6 (upper lane), n-tubulin (middle lane), k20/en22/rx1/c-actin, emx1.2, nkx2.1 (bottom lanes). Abbreviations: IS, injected side; NIS, non-injected side. Quantitative representation of phenotypes are presented as a bar graph (percent embryos with phenotype to total amount (%); black, phenotype; grey, no phenotype); n = number of independent experiments, N = number of injected embryos analysed for respective marker, *P ≤0.05, ***≤0.001 (Chi Square test). (B) As (A) with sox2 as probe. (C) Xenopus embryos co-injected with rmnd5 morpholino (2.5 pmol/embryo) and synthetic capped RNA (100 pg/embryo) were used for in situ hybridisation and quantified as shown in A.
The CTLH complex functions during early embryonic neurogenesis.
(A) rmnd5-mo injected embryos were used for in situ hybridisation with indicated marker probes; pax6 (upper lane), n-tubulin (middle lane), k20/en22/rx1/c-actin, emx1.2, nkx2.1 (bottom lanes). Abbreviations: IS, injected side; NIS, non-injected side. Quantitative representation of phenotypes are presented as a bar graph (percent embryos with phenotype to total amount (%); black, phenotype; grey, no phenotype); n = number of independent experiments, N = number of injected embryos analysed for respective marker, *P ≤0.05, ***≤0.001 (Chi Square test). (B) As (A) with sox2 as probe. (C) Xenopus embryos co-injected with rmnd5 morpholino (2.5 pmol/embryo) and synthetic capped RNA (100 pg/embryo) were used for in situ hybridisation and quantified as shown in A.
Rmnd5 is part of an ubiquitin-ligase complex
In Saccharomyces cerevisiae we have shown that the Rmnd5 ortholog Gid2 is part of a specific ubiquitin-ligase complex targeting key gluconeogenic enzymes for polyubiquitination [3, 4]. In higher organisms the function of the CTLH-complex remains enigmatic. Several lines of evidence support the hypothesis that Rmnd5 functions as an ubiquitin-ligase as well. First, the non-canonical RING domains in Gid2/RMND5 and in Gid9/MAEA are evolutionary highly conserved. Second, humanRMND5B interacts with several ubiquitin-conjugating enzymes (E2s) [16]. And finally, several protein interaction partners are putative CTLH complex substrates and are degraded by the 26S proteasome [23]. Therefore, we tested whether Xenopus laevisRmnd5 is part of a high molecular mass protein complex and whether it exhibits ubiquitin-ligase activity. Xenopus laevis stage 36 embryo lysates were subjected to glycerol density centrifugation (Fig. 4A). Fractionation revealed that Rmnd5 is mostly present in fraction 6 and 7 at 200–300 kDa and fraction 1 at 50 kDa. The predicted molecular mass of Rmnd5 is 44 kDa; the protein appears to be partially associated with other proteins most probably in the context of the CTLH complex. Another subunit of the humanCTLH-complex is ARMC8 [8]. The Xenopus ortholog has a predicted molecular mass of 40 kDa. However, it is detected in fraction 5 and 6 (150–250 kDa, lower panel) and thus partially cofractionates with Rmnd5 under these conditions. We conclude, that Rmnd5 cofractionates with known subunits of the CTLH complex and thus most likely is an integral part of it. In a next step, we wanted to test if Rmnd5 has E3 ubiquitin-ligase activity. Fig. 4B shows the result of an in vitro polyubiquitination assay [4]. Only in the presence of active Xenopus laevisRmnd5 a strong polyubiquitination signal was detected. The Rmnd5 mutant protein containing a mutation in the conserved RING cysteine residue (C354S) and the respective negative controls do not show any autoubiquitination (Fig. 4B, lane 1, 2, 3). As a positive control, the human ubiquitin ligase HDM2 was included in the test. We conclude that vertebrate Rmnd5 possesses E3 ligase activity and is part of a multimeric protein complex, most probably the CTLH complex. Given the close evolutionary relationship between the Gid2/Rmnd5 proteins we asked whether Xenopus laevisRmnd5 is able to complement a gid2Δ deletion phenotype in Saccharomyces cerevisiae. We expressed a yeast codon optimized Xenopus laevisrmnd5 (sequence available upon request) in a gid2Δ deletion strain and measured the half-life of the gluconeogenic enzyme FBPase. Even elevated amounts of Rmnd5 are not able to rescue the Δgid2 phenotype (S1 Fig.). Additionally, no interaction between Rmnd5 and the yeast Gid complex can be measured. Despite the high degree of conservation, the structural differences of the protein binding domains appear to be too strong to allow incorporation of Rmnd5 into the yeast complex.
Fig 4
Rmnd5 is part of an ubiquitin ligase complex.
(A) Glycerol step gradient of Xenopus laevis NF stage 36 embryo lysates. Molecular mass (MW) standard: albumin (67 kDa), fraction 1, 2; LDH (140 kDa), fraction 4; catalase (232 kDa), fraction 6,7. Western blot analysis with α-RMND5A (Rmnd5; upper panel) (1:1000) and α-ARMC8 (lower panel) (1:1000). (B) In vitro polyubiquitination assay with recombinant Xenopus Rmnd5 and Rmnd5-C354S (lane 3, 4). Reactions are performed in the presence (+) or absence (-) of E1 (lane 1), E2 (lane 2) and purified Rmnd5 protein. HDM2 is used as a positive control (lane 5). Polyubiquitination (Poly-Ub) is detected with α-HA and α-RMND5A as control.
Rmnd5 is part of an ubiquitin ligase complex.
(A) Glycerol step gradient of Xenopus laevis NF stage 36 embryo lysates. Molecular mass (MW) standard: albumin (67 kDa), fraction 1, 2; LDH (140 kDa), fraction 4; catalase (232 kDa), fraction 6,7. Western blot analysis with α-RMND5A (Rmnd5; upper panel) (1:1000) and α-ARMC8 (lower panel) (1:1000). (B) In vitro polyubiquitination assay with recombinant XenopusRmnd5 and Rmnd5-C354S (lane 3, 4). Reactions are performed in the presence (+) or absence (-) of E1 (lane 1), E2 (lane 2) and purified Rmnd5 protein. HDM2 is used as a positive control (lane 5). Polyubiquitination (Poly-Ub) is detected with α-HA and α-RMND5A as control.Taken together, we show for the first time that Rmnd5 of a higher organism is part of an ubiquitin-ligase complex. Unexpectedly, the suppression of rmnd5 function during embryonic development leads to malformations specifically in dorsal parts of the pros- and mesencephalon, the eyes and of ciliated cells of the skin. Therefore, the accumulation of an unknown Rmnd5 substrate might disturb the proper regulation of e.g. neural progenitor proliferation, cell specification, neuronal differentiation, cell migration or ciliogenesis. Recently, the human transcription factor Sox2 was shown to interact with the entire CTLH-complex [24]. Sox2 is essential for the maintenance of neural stem cell pluripotency with a key role during the development of pituitary, forebrain and the eyes [25, 26] and shows a similar expression pattern as rmnd5 (compare Fig. 2C and Fig. 3B) We therefore assume that the CTLH complex regulates Sox2 stability and thus may explain the manifestation of Rmnd5 dependent malformations of neural structures in our animal model and the patient [18].
Material and Methods
Capped mRNA and morpholino injections
Capped rmnd5 m-RNA was generated using the mMESSAGE mMACHINE kit (Ambion, Austin, TX). Not1 linearized pTP251 was used as a template for SP6 transcription and 5 nl of capped mRNA (~2.5 ng) was injected into one blastomere of a 2-cell stage embryo together with rmnd5 morpholino. 25-mer morpholinos (MOs; Gene Tools, LLC Philomath, Oregon) were designed to target the ATG translation start site for rmnd5 (NM_001092807.1) mRNA transcripts (sequence: GCTCCACCGTGCCGCACTGATCCAT). A mismatch standard MO was used as control (sequence: CCTCTTACCTCAGTTACAATTTATA). Both were injected (2.5 pmol) into one blastomere of 2-cell stage embryos.
Glycerol Density Gradient Fractionation
100 μl aliquots of embryo extract were layered on top of a glycerol step gradient in lysis buffer (950 μl each of 50%, 40%, 30%, 20 and 10% of glycerol) and centrifuged at 340000 g in a SW60TI rotor (Beckman Coulter) for 22h at 16°C. Thereafter, 330 μl fractions were collected, total protein precipitated with trichloroacetic acid (10% final), solubilised in urea buffer and analyzed by Western blotting.
Purification of recombinant His-tagged protein
Expression and purification of recombinant Rmnd5 was performed as described before [27].
RNA preparation and reverse transcription
RNA was prepared from whole Xenopus embryos using a Qiagen RNeasy Kit following the instructions provided by the manufacturers. First strand cDNA was prepared from 500 ng total RNA using oligo-dT or random primer and reverse transcriptase (Gibco).
Whole mount in situ hybridization and RT-PCR
To analyze the spatio-temporal expression of rmnd5 during Xenopus laevis embryogenesis, a DIG-labeled antisense RNA probe was generated by linearizing pTP221 with HindIII-HF (NEB) and in vitro transcription with T7 RNA Polymerase (Roche) as described before [28]. Xenopus embryos were fixed at consecutive developmental stages and whole-mount in situ hybridization was carried out as previously described [29]. Embryos probed with antisense RNAs of n-tubulin, pax6, and rx1-en2-krox20, sox2, emx1.2, nkx2 and rmnd5 respectively were vibratome sectioned (30 μm) and photographed.
Oligonucleotides and plasmids
Plasmids and primers used in this work are listed in Table 1 and Table 2, respectively and are available upon request. Plasmid pTP250 contains the Xenopus laevisrmnd5 ORF amplified from pTP221 with primers TP250fwd and TP250rev, inserted via XhoI and HindIII into pEGFP-C1 (Clontech). pTP221 contains the Xenopus laevisrmnd5 ORF amplified from cDNA, which was inserted into EcoRI/XhoI linearized pTP213 by yeast homologous recombination and selection on CSD—URA medium. pTP230 is a pCA528 derivative containing Xenopus laevisrmnd5 that was cut from pTP221 and inserted into pCA528via XhoI and BamHI. pTP241 is a pTP230 derivative with a C354S mutation in the RMND5A gene SOMA-generated with primer TP226 [21]. Site-directed mutagenesis of plasmids was performed using SOMA [21].
pCS2+ containing CEN/ARS and URA3 gene from S. cerevisiae
[21]
pCA528
E.coli expression vector for T7-promoted expression of His6-SUMO fusion proteins
[30]
pTP250
pEGFP-C1 containing rmnd5 (Xenopus laevis)
This work
pTP224
pEGFP-C1 containing RMND5b (homo sapiens)
[21]
pTP225
pEGFP-C1 containing RMND5a (homo sapiens)
[21]
pTP251
Rmnd5 binding site silently mutated in pTP221
This work
Organisms and maintenance
Frogs were obtained from a commercial supplier (NASCO, USA). Production and rearing of embryos was performed as described previously [29] and embryos were maintained at 15°C and staged according to Nieuwkoop and Faber. All procedures were performed according to guidelines set by the german animal use and care laws (Tierschutzgesetz) and approved by the german state administration Saxony-Anhalt (Projekt/AZ: 42502-3-600 MLU). HEK293 cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum (v/v). Transfections were performed using Lipofectamin 2000 (Invitrogen). For microscopy studies cells were grown on cover slips pretreated with poly-l-lysine solution, 0,1% (Sigma-Aldrich) for 5 min.
Western blotting
Western blotting was performed as described earlier [4]. Embryo extracts were prepared by homogenizing embryos with an injection needle (Braun, 0,7 × 30 mm) in one pellet volume of lysis buffer (20 mM Tris (pH8), 100 mM NaCl, 1mM EDTA, 0,5% Triton X-100, 10% glycerol, 0,1 mM PMSF, 10 μg/ml leupeptin, 1 μg/ml pepstatinA, 5 μg/ml aprotinin). Total protein was determined with the Bradford assay to load 20–30 μg total protein per lane. Antibodies were purchased from Abcam (Polyclonal ARMC8; WB 1:1000), Novus Biological (Polyclonal RMND5A; WB 1:1000).
Autoubiquitination assay
A 25 μl ubiquitination reaction contained 0.25 μg of E1 (yeast), 0.6 μg of UbcH5b, 10 μg of HA-ubiquitin, 1 μl of energy regeneration solution (all BostonBiochem, Cambridge), 2 μl ATP (100 mM, pH7.5), 2.5 μl ubiquitin reaction buffer (500 mM Tris-HCl, pH7.5, 500 mM NaCl, 100 mM MgCl2, 10 mM DTT, and 250 μM ZnCl2) and 2.25 μg of purified Rmnd5 or HDM2 (Enzo Lifescience) as a positive control. The reactions were incubated at 30°C for 3 h. Ubiquitination of protein was monitored by Western blot analysis with polyclonal anti-HA antibody (Sigma).
Complementation assay of Xenopus laevis Rmnd5 in yeast Δgid2.
Catabolite degradation of fructose-1,6-bisphosphatase (FBPase) in yeast. Δgid2 (YWO0906) was transformed with plasmid pRM41 harbouring V5-tagged rmnd5. YWO0906 and YWO2023 (containing GID2-V5) were transformed with empty plasmid pRS426 as controls. Cells were grown for 12h in synthetic complete medium without uracil containing 2% glucose. After addition of 2% glucose 1.5 OD600 of cells were taken at the indicated time points. Total protein was extracted and precipitated with trichloroacetic acid, resuspended in urea buffer and subjected to Western blot analysis with polyclonal FBPase antiserum, Pgk antibody (Molecular probes) and V5 antibody (Thermo Scientific), respectively. Digital data were quantified using TotalLab Quant and Excel; FBPase signals were normalised with 3-phosphoglycerate kinase (Pgk) (A) Representative Western blot of a complementation experiment. (B) Quantification of FBPase signal after glucose addition. Graphs include data from n = 10 (Rmnd5, blue), n = 7 (gid2 = Δgid2, red) and n = 5 (GID2, purple) experiments, respectively.(TIF)Click here for additional data file.As Fig. 3 with standard morpholino injected embryos(TIF)Click here for additional data file.
Authors: Bernhard Braun; Thorsten Pfirrmann; Ruth Menssen; Kay Hofmann; Hartmut Scheel; Dieter H Wolf Journal: FEBS Lett Date: 2011-10-29 Impact factor: 4.124
Authors: Jesse L Cox; Phillip J Wilder; Joshua M Gilmore; Erin L Wuebben; Michael P Washburn; Angie Rizzino Journal: PLoS One Date: 2013-05-07 Impact factor: 3.240
Authors: Cheng Dong; Shun-Jia Chen; Artem Melnykov; Sara Weirich; Kelly Sun; Albert Jeltsch; Alexander Varshavsky; Jinrong Min Journal: Proc Natl Acad Sci U S A Date: 2020-06-08 Impact factor: 11.205
Authors: Ka-Yiu Edwin Kong; Bernd Fischer; Matthias Meurer; Ilia Kats; Zhaoyan Li; Frank Rühle; Joseph D Barry; Daniel Kirrmaier; Veronika Chevyreva; Bryan-Joseph San Luis; Michael Costanzo; Wolfgang Huber; Brenda J Andrews; Charles Boone; Michael Knop; Anton Khmelinskii Journal: Mol Cell Date: 2021-05-10 Impact factor: 17.970
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391