Literature DB >> 25793370

MiR-506 is down-regulated in clear cell renal cell carcinoma and inhibits cell growth and metastasis via targeting FLOT1.

Feng-qiang Yang1, Hai-Min Zhang, Hai-ming Zhang1, Shao-Jun Chen1, Yang Yan1, Jun-hua Zheng1.   

Abstract

BACKGROUND: Some microRNAs (miRNAs) are abnormally expressed in cancer and contribute to tumorigenesis. In the present study, we investigated the role of miR-506 in clear cell renal cell carcinoma (ccRCC).
METHODS: miR-506 expression was detected in renal cancer cell lines 786-O, ACHN, Caki-1, and Caki-2 and ccRCC specimens by quantitative real-time-PCR. We assessed the association of miR-506 expression with pathology and prognosis in ccRCC patients. We over-expressed and knocked-down miR-506 expression in two renal cancer cell lines, 786-O and ACHN, and assessed the impact on cell proliferation, migration and invasion. A luciferase reporter assay was conducted to confirm the target gene of miR-506 in renal cancer cell lines.
RESULTS: miR-506 was significantly down-regulated in renal cancer cell lines and ccRCC specimens. Low miR-506 expression in ccRCC specimens was associated with an advanced clinical stage and poor prognosis. miR-506 expression was an independent prognostic marker of overall ccRCC patient survival in a multivariate analysis. Over-expression of miR-506 in renal cancer cells decreased cell growth and metastasis, In contrast, down-regulation of miR-506 expression promoted renal cancer cell growth and metastasis. FLOT1, a potential target gene of miR-506, was inversely correlated with miR-506 expression in ccRCC tissues. Consistent with the effect of miR-506, knockdown of FLOT1 by siRNA inhibited cell malignant behaviors. Rescue of FLOT1 expression partially restored the effects of miR-506.
CONCLUSIONS: miR-506 exerts its anti-cancer function by directly targeting FLOT1 in renal cancer, indicating a potential novel therapeutic role in renal cancer treatment.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25793370      PMCID: PMC4368579          DOI: 10.1371/journal.pone.0120258

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Renal cell carcinoma (RCC) is the most lethal urologic tumor and the sixth leading cause of cancer deaths in the Western world. Each year, around 200,000 patients are diagnosed with this malignancy resulting in approximately 100,000 deaths, and its incidence is increasing steadily in recent years [1]. Roughly 80% of RCC are clear cell RCC (ccRCC), originating from the renal proximal tubule, and 25–30% of patients with RCC have evidence of metastases at initial presentation [2, 3]. Although radical nephrectomy can effectively cure early and local RCC, 30% of patients develop metastases after surgery [4]. The prognosis for metastatic RCC is poor as therapeutic options are limited. Median survival in a recent cohort was only 1.5 years with fewer than 10% of patients surviving to 5 years [5]. Research into the molecular mechanisms underlying RCC metastasis will be required to inform the development of effective therapies. MicroRNAs (miRNAs) are a class of small, single stranded, non coding RNA molecules of 19–24 nucleotides that are cleaved from 70–100 nucleotide hairpin pre-miRNA precursors [6]. miRNAs bind to complementary sequences in the 3’ untranslated regions (UTR) of their target mRNAs and induce mRNA degradation or translational repression [7]. miRNAs have been implicated in the regulation of biological processes such as cell proliferation, apoptosis, metabolism, and cellular differentiation [8]. Furthermore, miRNAs have recently been reported to function as both oncogenes and suppressors of tumor progression [9]. Therefore, miRNAs expression profiles can contribute to the diagnosis and classification of cancers, and may provide clinical prognostic information and inform therapies [10,11]. miR-506 has been found to be frequently dysregulated and functions as a tumor suppressor in several cancers. Bentwich et al. first identified miR-506 as a component of an X chromosome-linked miRNA cluster in the primate testis [12]. miR-506 expression was found to be up-regulated in kidney allografts bearing interstitial fibrosis and tubular atrophy and in primary biliary cirrhosis [13]. Zhao et al. found that restoration of miR-506 in malignant transformed human bronchial epithelial cells reduced cell proliferation [14]. miR-506 has since been reported to play key roles in the regulation of cell growth, migration, chemo-sensitivity and epithelial-mesenchymal transition in cancers [15,16]. Recent profile studies showed that miR-506 is epigenetically silenced in various cancers and regulated cancer cell biological behaviors by targeting important genes such as TGF-β, hedgehog pathway transcription factor Gli3 and CDK4/6FOXM1 [15-17]. These studies indicated that miR-506 can serve as a potential tumor suppressor. The flotillin protein family, including flotillin-1 (FLOT1 or Reggie-2) and flotillin-2 (FLOT2 or Reggie-1), have been identified as markers of lipid rafts [18]. As components of lipid rafts, flotillins were reported to be involved in the initiation of signaling transduction through recruitment of receptor kinases, such as Src tyrosine kinases [19]. Recently, FLOT1 was reported to be elevated in several types of cancer, including non-small cell lung cancer, breast cancer and hepatocellular carcinoma, and played important roles in development and progression of cancer [20-22]. The aim of this study was to investigate the role of miR-506 in renal cancer. We found that the expression level of miR-506 decreased in ccRCC tissues and was inversely associated with histologic grade, clinical stage, tumor stage, lymph node metastasis, and distant metastasis. Gain-of-function and loss-of-function studies demonstrated that miR-506 acts as a tumor suppressor by affecting renal cancer cell proliferation, migration and invasion. Furthermore, FLOT1 was identified as a direct functional target of miR-506. Knockdown of FLOT1 was consistent with the effects of miR-506 in renal cancer, and rescue expression of FLOT1 could partially restore the effects of miR-506. Our findings indicated that miR-506 was down-regulated and might act as a tumor suppressor by directly targeting FLOT1 in renal cancer, suggesting that miR-506 has a potential role in the diagnosis and therapy of renal cancer.

Materials and Methods

Human ccRCC specimens

A total of 106 primary ccRCC tissues and matched adjacent normal tissues were obtained from patients who underwent radical nephrectomy in the Department of Urology, Shanghai Tenth People’s Hospital of Tongji University between 2006 to 2008. None of the patients had received chemotherapy or radiotherapy before surgery. After surgical resection, tumor tissues and adjacent normal tissues were collected and stored at −80°C until use. Use of clinical sample cohorts in this study was approved by the Institution research ethics committee of Tongji University. All participants gave written consent for their information to be stored in the hospital database and used for research.

Cell culture

Immortalized normal human proximal tubule epithelial cell line HK-2 was purchased from the American Type Culture Collection (ATCC, USA). Human renal cancer cell lines 786-O, ACHN, Caki-1, and Caki-2 were obtained from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (CCCAS, China). Renal cancer cells were cultured in RPMI-1640 medium (Gibco) with 10% fetal bovine serum (FBS, Gibco), 50 U/ml penicillin and 50 μg/ml streptomycin. HK-2 cells were cultured in KSFM medium (Gibco). All cells were maintained at 37°C in a 5% CO2 humidified incubator.

Total RNA extraction and quantitative real-time PCR

RNA was isolated by TRIZOL reagent (Invitrogen) according to the manufacturer’s protocol. Quantitative real-time PCR (qRT-PCR) was performed with an Applied Biosystems 7900HT system (Applied Biosystems) using SYBR Premix Ex Taq (Takara). PCR volume (20 μl) contained 1 μl reverse transcript product. Cycling conditions were 1 cycle of 95°C for 30 seconds, 40 cycles of 95°C for 5 seconds and 60°C for 30 seconds. PCR was performed in triplicate. For measurement of the FLOT1 transcript from total RNA, total cDNA was synthesized using a Takara reverse transcription kit (Takara). qRT-PCR was performed using SYBR Pre-mix ExTaq (Takara). U6 snRNA and GAPDH were used as endogenous controls for miRNA and mRNA, respectively. The ΔΔCt method was used to determine relative quantitation of miRNA and mRNA expression, and fold change was determined as 2-ΔΔCt. The FLOT1 sense primer was 5′-CCCATCTCAGTCACTGGCATT-3′, and the antisense primer was 5′-CCGCCAACATCTCCTTGTTC-3′. For the GAPDH gene, the sense primer was 5'-TGCACCACCAACTGCTTAGC-3′, and the antisense primer was 5'-GGCATGGACTGTGGTCATGAG-3'. The miR-506 sense primer was 5′-AGCCGTTTGTTCGTTCGGCT-3′, and the antisense primer was 5′-GTGCAGGGTCCGAGGT-3′. For the U6 snRNA gene, the sense primer was 5′-CTCGCTTCGGCAGCACA-3′, and the antisense primer was 5′-AACGCTTCACGAATTTGCGT-3′.

Bioinformatics

miR-506 targets were prediced using TargetScan 5.1 (http://www.targetscan.org) and miRanda (http://www.microrna.org). According to these algorithms we predicted that the FLOT1 gene might be a direct target of miR-506.

Transient transfection

The miR-506 mimics, miR-negative control of mimics (miR-Ctrl), siRNA for FLOT1 (si-FLOT1) and siRNA-negative control (si-NC) were synthesized and purified by RiboBio (Guangzhou, China), miR-506 inhibitor and miR-negative control of inhibitor (anti-miR-Ctrl) were synthesized and purified by Gene-Pharma (Shanghai, China), as illustrated in Table 1. miR-506 mimics, miR-506 inhibitor, and si-FLOT1 were transfected at a final concentration of 50 nM using Lipofectamine 2000 reagent (Invitrogen), according to the manufacturer’s instructions. Total RNA and protein were collected 48 hours after transfection.
Table 1

Sequences of the miRNA mimics, inhibitor and siRNA.

NameSequence(5′- 3′)
miR-506 mimicsUAAGGCACCCUUCUGAGUAGA
miR-CtrlUUCUCCGAACGUGUCACGUTT
miR-506 inhibitorUCUACUCAGAAGGGUGCCUUA
anti-miR-CtrlCAGUACUUUUGUGUAGUACAA
si-FLOT1CCCTCAATGTCAAGAGTGAAA
si-NCUUCUCCGAACGUGUCACGU

Construction of Plasmids

The 3’-untranslated region (3’-UTR) sequences of human FLOT1, containing the putative miR-506 binding site, were isolated from 786-O cDNA using PCR amplification and cloned into the pGL3 vector (Promega), which was named wild-type 3′-UTR (wt 3′-UTR). Point mutations in the putative miR-506 binding seed regions were created using the Quick-Change Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s protocol. The resultant product served as the mutated 3′-UTR (mut 3′-UTR). Both the wild-type and mutant insert fragments sequences were confirmed by DNA sequencing. For FLOT1 over-expression, the cDNA of FLOT1 containing the putative miR-506 binding sites was cloned into the multiple cloning site of the pcDNA3.1 vector (Invitrogen), which was named wild-type 3′UTR-FLOT1 (wt 3′UTR-FLOT1). The mut 3′UTR-FLOT1 was obtained as described above. In the rescue experiment, cells were co-transfected with 50 nM of miR-506 mimics and 500 ng of plasmid in a 6-well plates.

Luciferase Activity Assay

Cells were seeded in triplicate in 24-well plates one day before transfection. Wt or mut 3′-UTR vectors and the control vector pGL3 (Promega) coding for Renilla lucifearse were co-transfected with miR-506 mimics or miR-Ctrl into 786-O cells using Lipofectamine 2000 reagent, as previously described. After 48 hours, cells were harvested and lysed, and the luciferase activity was assayed using the Dual-Luciferase Assay Reporter System (Promega). The firefly luciferase fluorescence was normalized to Renilla, and the relative ratios of firefly to Renilla activity were reported.

Cell Proliferation Assay

To assess cell proliferation, 786-O and ACHN cells were plated in 96-well plates overnight and transfected with miR-506 mimic or miR-506 inhibitor. Proliferation was determined by 3-(4,5-dimethylthiazol-2-yl)-2–5 diphenyltetrazolium bromide (MTT, Sigma) assay at 12, 24, 48, 72, and 96 hours after transfection, and the absorbance of samples was measured with a spectrophotometer reader (Molecular Devices) at 570 nm. All experiments were performed in six replicates and were repeated three times independently.

Cell cycle assay

To assess cell cycle distribution, 786-O and ACHN cells were plated in 6-well plates and transfected with miR-506 mimic or miR-506 inhibitor. After transfection, the cells were collected by trypsinization, fixed in 70% ice-cold ethanol overnight, then washed with phosphate buffer saline (PBS), and stained with propidium iodide (PI, 50 mg/ml) in PBS supplemented with RNase (50 mg/ml) in the dark at room temperature (RT) for 30 min. Tests were performed in triplicate for each sample, and analyses of cell cycle distribution were performed by flow cytometer in accordance with the manufacturer’s guidelines (BD Bioscience).

Apoptosis assay

The Annexin V-FITC Apoptosis Detection kit (BD Biosciences) and PI was used to assess the apoptotic effect of miR-506. 786-O and ACHN cells transfected with miR-506 mimic or miR-506 inibitor were suspended in RPMI-1640 medium. The cells were re-suspended in 500 μl cold Binding Buffer with 1.25 μl Annexin V-FITC, and incubated for 15 min at RT in the dark. Cells were re-suspended in 500 μl cold Binding Buffer with 10 μl PI, incubated for 4 hours and analyzed by flow cytometry (BD Bioscience).

Scratch migration assay

To determine cell migration, 786-O and ACHN cells transfected with miR-506 mimic or miR-506 inhibitor were seeded into 12-well plates and cultured overnight. Before scratching, cells were starved for 24 hours in medium with 1% FBS. Similar sized wounds were introduced to monolayer cells using a sterile white pipette tip. Wounded monolayer cells were washed three times by PBS to remove cell debris and then cultured. The speed of wound closure was monitored and photographed at 48 hours. Each experiment was performed three times independently.

Transwell invasion assay

To determine cell invasion, Matrigel-coated invasion chambers (Invitrogen) were used according to the manufacturer’s protocol. 786-O and ACHN cells transfected with miR-506 mimic or miR-506 inhibitor were suspended in 200 μl serum-free RPMI-1640 medium and seeded on the upper chamber. The lower chamber was filled with 10% FBS as the chemoattractant. After 48 hours, cells on the upper side of the membrane were wiped off, cells on the lower side of the membrane were fixed and stained with crystal violet solution. The cells under the microscopic fields in each chamber were photographed and counted, values were expressed as fold induction. All invasion assays were performed in triplicate in at least three independent experiments.

Western blot analysis

Transfected 786-O and ACHN cells were cultured for 48 hours, then lysed in lysis buffer containing protease inhibitor. Protein concentration was determined using a Bio-Rad protein assay system (Bio-Rad). Equivalent amounts of proteins were separated by SDS-PAGE, and then transferred to polyvinylidene difluoride membranes (Bio-Rad). After blocking in Tris buffered saline (TBS) containing 5% nonfat milk, the membranes were incubated with specific primary antibodies (Abcam) at 4°C for 12 hours and then with horseradish peroxidase conjugated anti-mouse antibody for 2 hours at RT. Membranes were visualized using ECL detection reagent (Amersham LifeScience).

Statistical analysis

All statistical analyses were performed using SPSS version 18.0 software. Data are presented as the mean ± SD from at least three independent experiments. The statistical significance between groups was determined using the Student’s t test. Association between expression level of miR-506 and each clinicopathologic parameter was evaluated using Pearson’s Chi-square test. Patient survival was evaluated using the Kaplan-Meier method and compared using log-rank test. Univariate and multivariate Cox regression analyses were performed to analyze the survival data. Correlation between expression levels of miR-506 and its target gene FLOT1 in ccRCC tissues was analyzed using Spearman’s correlation coefficient. P<0.05 was considered to be statistically significant.

Results

miR-506 expression was down-regulated in renal cancer and correlated negatively with advanced clinical stage

To study the expression levels of miR-506 in renal cancer, the expression level of miR-506 in renal cancer cell lines was first analyzed by qRT-PCR. In comparison to immortalized normal proximal tubule epithelial cell line HK-2, miR-506 expression was down-regulated in all four renal cancer cell lines (786-O, ACHN, Caki-1, Caki-2) (Fig. 1A, P<0.05). We further assessed the expression level of miR-506 in ccRCC tissues and adjacent normal tissues. The expression levele of miR-506 in ccRCC tissues was significantly lower than that in adjacent normal tissues (Fig. 1B, P<0.05). Next we investigated the association between miR-506 expression and clinicopathological features in the 106 ccRCC patients. We found that miR-506 expression was significantly correlated with histological grade, clinical stage, tumor stage, lymph node metastasis, and distant metastasis (P<0.05), but was not significant associated with patients’ gender, age and tumor size (Table 2). These results indicate that miR-506 is down-regulated in renal cancer, and that reduced expression of miR-506 may play a key role in the development and progression of renal cancer.
Fig 1

miR-506 expression was down-regulated in human renal cancer.

A. Expression of miR-506 in 4 renal cancer cell lines and human proximal tubule epithelial cell line HK-2; B. Expression of miR-506 in ccRCC tissues and adjacent normal tissues; C. The survival analysis of miR-506. Patients with lower miR-506 expression in tumor tissue were closely correlated with poorer overall survival than patients with higher expression. * P <0.05.

Table 2

Relationship between miR-506 expression level and clinicopathologic parameters.

ParametersGroupTotalmiR-506 expression P value
HighLow
GenderMale5826320.751
Female482325
Age (years)<655722350.089
≥65492722
Tumor size (cm)<4 cm6534310.114
≥4 cm411526
Clinical stageI–II5934250.008
III-IV471532
Histological gradeG1-G26741260.000
G3-G439831
Tumor stageT1-T26239230.000
T3-T4441034
Lymph node metastasisAbsence8846420.006
Presence18315
Distant metastasisAbsence9247450.010
Presence14212

miR-506 expression was down-regulated in human renal cancer.

A. Expression of miR-506 in 4 renal cancer cell lines and human proximal tubule epithelial cell line HK-2; B. Expression of miR-506 in ccRCC tissues and adjacent normal tissues; C. The survival analysis of miR-506. Patients with lower miR-506 expression in tumor tissue were closely correlated with poorer overall survival than patients with higher expression. * P <0.05.

Low miR-506 expression predicted poor prognosis in patients with RCC

Kaplan–Meier analysis revealed that ccRCC patients with low miR-506 expression had a significantly shorter overall survival time than those with high miR-506 expression (log-rank test, P<0.05) (Fig. 1C). miR-506 expression level, histological grade, clinical stage, tumor stage, lymph node metastasis, and distant metastasis were significantly correlated with overall survival rate of patients with ccRCC (P<0.05) (Table 3). Multivariate analysis indicated that relative expression of miR-506, histological grade, clinical stage, tumor stage, lymph node metastasis and distant metastasis were independent prognostic factors for the overall survival of ccRCC patients (P<0.05) (Table 3). These results suggest that miR-506 expression level may represent powerful independent predictor of outcome in ccRCC patients.
Table 3

Univariate and multivariate analyses of prognostic parameters for survival in patients with ccRCC.

ParametersUnivariate analysisMultivariate analysis
Risk ratio95% CI P value Risk ratio95% CI P value
Gender1.3790.628–2.3970.318
Male vs Female
Age (years)2.4140.432–3.1750.291
≥65 vs <65
Tumor size (cm)2.6320.583–4.2710.127
≥4 vs <4
Clinical stage2.4811.337–4.6180.0072.2691.571–4.1620.005
III-IV vs I-II
Histological grade3.3972.218–5.714<0.0013.0822.094–5.4140.009
G3-G4 vs G1-G2
Tumor stage2.9162.017–5.3930.0132.7492.214–4.9670.015
T3-T4 vs T1-T2
Lymph node metastasis6.3172.944–9.6190.0065.6422.329–8.1740.015
Presence vs Absence
Distant metastasis7.1142.917–11.4270.0085.1423.172–9.2170.010
Presence vs Absence
miR-5064.2471.982–8.6590.0033.8862.179–7.524<0.001
Low vs High

miR-506 suppressed cell proliferation, blocked G1-to-S transition and induced apoptosis in renal cancer cells

To investigate the effect of miR-506 on cell proliferation, we performed over-expression and knockdown experiments in two renal cancer cell lines, 786-O and ACHN. Successful over-expression and knockdown of miR-506 in the cells was confirmed by qRT-PCR (Fig. 2A. 2B, P<0.05).
Fig 2

miR-506 regulated cell proliferation, cell cycle and apoptosis in 786-O and ACHN cell lines.

A. miR-506 was up-regulated in 786-O and ACHN cells by transfection of miR-506 mimics; B. miR-506 was down-regulated in 786-O and ACHN cells by transfection of miR-506 inhibitor; C. By MTT assay, the proliferation of 786-O and ACHN cells transfected with miR-506 mimics was inhibited compared with miR-Ctrl; D. The proliferation of 786-O and ACHN cells transfected with miR-506 inhibitor was accelerated compared with anti-miR-Ctrl; E. By flow cytometric analysis, transfection of miR-506 mimics induced G1 arrest of 786-O and ACHN cells; F. miR-506 down-regulated by miR-506 inhibitor resulted in a significant decrease in the cellular population in G0/G1 phase but a sharp increase in S phase in 786-O and ACHN cells. G. By apoptosis assay, transfection of miR-506 mimics resulted in a significant increase of apoptosis in 786-O and ACHN cells. H. miR-506 silencing resulted in a significant decrease of apoptotic cells. * P <0.05.

miR-506 regulated cell proliferation, cell cycle and apoptosis in 786-O and ACHN cell lines.

A. miR-506 was up-regulated in 786-O and ACHN cells by transfection of miR-506 mimics; B. miR-506 was down-regulated in 786-O and ACHN cells by transfection of miR-506 inhibitor; C. By MTT assay, the proliferation of 786-O and ACHN cells transfected with miR-506 mimics was inhibited compared with miR-Ctrl; D. The proliferation of 786-O and ACHN cells transfected with miR-506 inhibitor was accelerated compared with anti-miR-Ctrl; E. By flow cytometric analysis, transfection of miR-506 mimics induced G1 arrest of 786-O and ACHN cells; F. miR-506 down-regulated by miR-506 inhibitor resulted in a significant decrease in the cellular population in G0/G1 phase but a sharp increase in S phase in 786-O and ACHN cells. G. By apoptosis assay, transfection of miR-506 mimics resulted in a significant increase of apoptosis in 786-O and ACHN cells. H. miR-506 silencing resulted in a significant decrease of apoptotic cells. * P <0.05. The proliferation rate of both renal cancer cell lines transfected with miR-506 mimics was significantly decreased in comparison to cells transfected with a negative control (miR-Ctrl) (Fig. 2C, P<0.05). In contrast, the proliferation rate of both renal cancer cell lines transfected with miR-506 inhibitor was significantly increased in comparison to cells transfected with a negative control (anti-miR-Ctrl) (Fig. 2D, P<0.05). As miR-506 significantly suppressed renal cancer cell proliferation, we next aimed to determine whether miR-506 affected cell cycle progression and apoptosis of renal cancer cell lines. Cell cycle distribution was analyzed by flow cytometry and revealed that miR-506 mimics markedly induce G1 phase arrest of renal cancer cell lines (Fig. 2E, P<0.05). Consistent with this result, silencing of miR-506 resulted in a significant decrease in the cellular population in G0/G1 phase but an increase in S phase (Fig. 2F, P<0.05). Also miR-506 mimics induced apoptosis (Fig. 2G, P<0.05), whereas silencing of miR-506 inhibited apoptosis of renal cancer cells (Fig. 2H, P<0.05).

miR-506 inhibited migration and invasion of renal cancer cells

We further investigated whether miR-506 influenced renal cancer cell migration and invasion. The scratch migration assay revealed that miR-506 mimics markedly inhibited renal cancer cell migration (Fig. 3A, P<0.05). Consistent with this result, silencing of miR-506 resulted in a significant increase in renal cancer cell migration (Fig. 3B, P<0.05). Moreover, Transwell invasion assays revealed that the invasion potential of renal cancer cells transfected with miR-506 mimics was significantly decreased (Fig. 3C, P<0.05), whereas silencing of miR-506 significantly enhanced renal cancer cell invasion (Fig. 3D, P<0.05). These results suggest that miR-506 may contribute to inhibition of metastasis of renal cancer cells.
Fig 3

miR-506 regulated cell migration and invasion in 786-O and ACHN cell lines.

A. By scratch migration assay, the migration ability of 786-O and ACHN cells transfected with miR-506 mimics was inhibited compared with miR-Ctrl; B. The migration ability of 786-O and ACHN cells transfected with miR-506 inhibitor was accelerated compared with anti-miR-Ctrl; C. By transwell invasion assay, transfection of miR-506 mimics inhibited invasion ability of 786-O and ACHN cells; D. miR-506 down-regulated by miR-506 inhibitor resulted in a significant increase in the invasion ability of 786-O and ACHN cells. * P <0.05.

miR-506 regulated cell migration and invasion in 786-O and ACHN cell lines.

A. By scratch migration assay, the migration ability of 786-O and ACHN cells transfected with miR-506 mimics was inhibited compared with miR-Ctrl; B. The migration ability of 786-O and ACHN cells transfected with miR-506 inhibitor was accelerated compared with anti-miR-Ctrl; C. By transwell invasion assay, transfection of miR-506 mimics inhibited invasion ability of 786-O and ACHN cells; D. miR-506 down-regulated by miR-506 inhibitor resulted in a significant increase in the invasion ability of 786-O and ACHN cells. * P <0.05.

miR-506 negatively regulated FLOT1 gene expression by directly targeting its 3′-UTR

To investigate the mechanisms by which miR-506 influences cellular proliferation, migration and invasion, we employed TargetScan and miRanda algorithms to search for putative protein-coding gene targets of miR-506, The gene for FLOT1 was identified by both TargetScan and miRanda as a potential target. We performed a luciferase reporter assay to determine whether FLOT1 was a direct target of miR-506 in renal cancer cells. The target region sequence of FLOT1 3′UTR (wt 3′UTR) or the mutant sequence (mut 3′UTR) was cloned into a luciferase reporter vector (Fig. 4A). These constructed reporter vectors were co-transfected with miR-506 mimics or miR-Ctrl into the 786-O cell line. Transfection of miR-506 down-regulated the luciferase activity of the FLOT1 wt 3′UTR construct (Fig. 4B, P<0.05), confirming that FLOT1 is a direct target of miR-506.
Fig 4

Forced expression of miR-506 negatively regulated FLOT1 expression.

A. Diagram of FLOT1 3′UTR contained reporter constructs; B. Luciferase assay. 786-O cells were transiently co-transfected with wt/mut 3′UTR with miR-506 mimics as indicated; C. miR-506 inhibited the expression of FLOT1 at the protein level in 786-O and ACHN cells. * P <0.05.

Forced expression of miR-506 negatively regulated FLOT1 expression.

A. Diagram of FLOT1 3′UTR contained reporter constructs; B. Luciferase assay. 786-O cells were transiently co-transfected with wt/mut 3′UTR with miR-506 mimics as indicated; C. miR-506 inhibited the expression of FLOT1 at the protein level in 786-O and ACHN cells. * P <0.05. To further confirm that FLOT1 is a target gene for miR-506, Western blot analysis were used to detect the expression of FLOT1 in the presence of miR-506 mimics in 786-O and ACHN cells. FLOT1 expression was significantly down-regulated after expression of miR-506 (Fig. 4C, P<0.05). Moreover, the mRNA levels of FLOT1 and miR-506 expression in one set of ccRCC tissue were assessed by qRT-PCR. miR-506 expression was inversely correlated with FLOT1 mRNA expression (Spearman’s p = −0.592, P<0.05). Taken together, our results suggest that FLOT1 is a potential target of miR-506, and that miR-506 negatively regulated FLOT1 gene expression in ccRCC.

FLOT1 silencing recapitulated the effects of miR-506 in renal cancer cells

To explore the function of FLOT1 in renal cancer, 786-O and ACHN cells were transfected with si-FLOT1. qRT-PCR and Western blot analysis indicated that FLOT1 expression levels decreased significantly after 48 hours in both 786-O and ACHN cells transfected with si-FLOT1 (Fig. 5A,5B). The MTT assay revealed that knockdown of FLOT1 also inhibited renal cancer cell proliferation (Fig. 5C, P<0.05). Furthermore, Scratch migration assay and transwell invasion assay suggested that down-regulation of FLOT1 expression inhibited the migration and invasion capability of renal cancer cells (Fig. 5D,5E). FLOT1 silencing induces a very similar phenotype to miR-506 expression in renal cancer cells. These results suggest that miR-506 down-regulates FOLT1, thus suppressing renal cancer cell growth and metastasis.
Fig 5

FLOT1 was essential for renal cancer cell proliferation, migration and invasion, and involved in the miR-506 induced inhibition of cell proliferation.

A,B. Analysis of mRNA and protein expression by qRT-PCR and Western blot, FLOT1 was reduced by si-FLOT1 in 786-O and ACHN cells; C. By MTT assay, the proliferation of 786-O and ACHN cells was significantly inhibited by transfection with si-FLOT1; D. By scratch migration assay, the migration ability of 786-O and ACHN cells was significantly decreased by transfection with si-FLOT1; E. By transwell invasion assay, the invasion ability of 786-O and ACHN cells was significantly inhibited by transfection with si-FLOT1; F. MTT assay showed cell proliferation in 786-O and ACHN cells co-transfected with miR-506 mimics and wt/mut 3′UTR-FLOT1. * P <0.05.

FLOT1 was essential for renal cancer cell proliferation, migration and invasion, and involved in the miR-506 induced inhibition of cell proliferation.

A,B. Analysis of mRNA and protein expression by qRT-PCR and Western blot, FLOT1 was reduced by si-FLOT1 in 786-O and ACHN cells; C. By MTT assay, the proliferation of 786-O and ACHN cells was significantly inhibited by transfection with si-FLOT1; D. By scratch migration assay, the migration ability of 786-O and ACHN cells was significantly decreased by transfection with si-FLOT1; E. By transwell invasion assay, the invasion ability of 786-O and ACHN cells was significantly inhibited by transfection with si-FLOT1; F. MTT assay showed cell proliferation in 786-O and ACHN cells co-transfected with miR-506 mimics and wt/mut 3′UTR-FLOT1. * P <0.05.

Reintroduction of FLOT1 rescued miR-506-induced effects on renal cancer cell proliferation

If FLOT1 indeed serves as a direct functional target of miR-506, reintroduction of FLOT1 into miR-506-expressing cells should antagonize the effects of miR-506. To address this hypothesis, we co-transfected miR-506 mimics along with wt/mut 3′UTR-FLOT1 plasmid which FLOT1 cDNA contained into 786-O cells. MTT assay showed that mut 3′UTR-FLOT1 could partially abrogate the miR-506 mediated effects in 786-O and ACHN cells, to restore the proliferation compared with the miR-Ctrl (Fig. 5F, P<0.05). These findings demonstrate that FLOT1 reintroduction abrogated miR-506-induced cellular behaviors, suggesting that FLOT1 is a functional mediator of miR-506 in renal cancer cells.

Discussion

Cancer is characterized by abnormal and uncontrolled cell proliferation, which is caused not only by the dysregulation of several pivotal proteins but also by a systemic change in the miRNA profile [22]. miRNAs have been identified as important regulators of tumorigenesis and cancer progression through various molecular pathways [23]. We found that miR-506 was significantly down-regulated in human renal cancer cell lines and clinical samples in comparison to immortalized normal human proximal tubule epithelial cell lines and adjacent normal tissues. We also found that lower expression of miR-506 was closely associated with advanced histologic grade, clinical stage, tumor stage, positive lymph node metastasis, and distant metastasis in ccRCC patients. In addition, low miR-506 expression was correlated with lower overall survival. Furthermore, up-regulated expression of miR-506 could inhibit cell proliferation, migration and invasion of RCC cell lines. In contrast, knockdown miR-506 expression promoted proliferation, migration and invasion. Moreover, FLOT1 was identified as a direct target of miR-506. We demonstrated that miR-506 acts as a novel growth and metastasis suppressor of renal cancer, and low expression of miR-506 contributes to tumor progression and metastasis in renal cancer patients. Down-regulation of miR-506 has been identified in several cancers such as cervical cancer, ovarian cancer, and lung cancer, indicating that miR-506 plays an important role in tumorigenesis and tumor progression. Wang et al. reported that miR-506 was down-regulated in cervical cancer tissues and inhibited cell migration and invasion via targeting transcription factor SP1 [14]. Liu et al. identified miR-506 as a candidate tumor suppressor in ovarian cancer and reported that miR-506 regulated cell survival via CDK4/6FOXM1 [17]. Arora et al. found that miR-506 was down-regulated in breast cancer tissues and suggested that miR-506 regulates breast cancer epithelial-mesenchymal transition by targeting Vimentin, Snai2, and CD151 [15]. Over-expression of miR-506 inhibited TGFβ-induced EMT and suppressed adhesion, invasion, and migration of MDA-MB-231 cells [15]. Wen et al. reported that miR-506 was significantly down-regulated in cervical cancer tissues and inhibits cervical cancer growth in vitro and in vivo [16]. miR-506 induced cell cycle arrest at the G1/S transition, and enhanced apoptosis and chemosensitivity of cervical cancer cell lines and targeted Gli3 [16]. These results underline an important role for miR-506 in tumor progression. However, the precise mechanism of miR-506 activity in renal cancer has not been clearly elucidated. In our study, we report for the first time that miR-506 expression was significantly decreased in ccRCC tissues in comparison to adjacent normal tissues. Interestingly, we found that lower levels of miR-506 were associated with advanced histologic grade, clinical stage, tumor stage, positive lymph node metastasis, and distant metastasis, In addition, low miR-506 expression was correlated with lower overall survival rates and may represent an independent prognostic factor in patients with ccRCC. The capability of cells to proliferate, migrate and invade is considered an important determinant of tumorigenesis and progression. We found that miR-506 may play a key role in renal cancer tumorigenesis and progression, and we found that miR-506 could suppress renal cancer cell line proliferation, migration and invasion, indicated its role as a tumor suppressor. We also identified FLOT1 as a direct target of miR-506. The protein encoded by the FLOT1 gene is an integral membrane protein that participates in a wide variety of cellular processes such as membrane receptor signaling, membrane trafficking, cell adhesion and cell motility [18,19]. Up-regulation of FLOT1 has been reported to contribute to proliferative and invasive behavior and worse prognosis in various cancers [20-22]. Li et al.’s study indicated that abnormal expression of FLOT1 correlated with tumor progression and poor survival in patients with non-small cell lung cancer [20]. Zhang et al. found that the high FLOT1 expression was associated with progression and poor prognosis in hepatocellular carcinoma [22]. Lin et al. reported that FLOT1 was markedly up-regulated in human breast cancer cells and tissues, and knock-down of FLOT1 inhibited the proliferation and tumorigenesis of breast cancer cells through the Akt/FOXO3a pathway [21]. Xiong et al. indicated that FLOT1 could clearly activate the growth and metastasis of oral squamous carcinoma, and that FLOT1 expression activates the NF-κB signaling pathway by enhancing phosphorylation of p65 and IκBα, and translocation of p65 into nucleus [24]. These reports indicated that FLOT1 can regulate many cellular processes, including proliferation, migration, invasion and tumorigenesis. Consistent with those studies above, we demonstrated that miR-506 could directly target and down-regulate FLOT1, and high FLOT1 expression was associated with low miR-506 expression in renal cancer tissues. Our findings suggest that post-transcriptional regulation of FLOT1 by miRNA is a vital mechanism underlying cancer growth and metastasis, and miR-506 may serve as potential treatment target for regulating FLOT1 to inhibit the growth and metastasis of renal cancer.

Conclusions

miR-506 expression was down-regulated in ccRCC and correlated with advanced histologic grade, clinical stage, tumor stage, positive lymph node metastasis, and distant metastasis. In addition, low miR-506 expression was correlated with lower overall survival rates and could be an independent prognostic factor in patients with ccRCC. Ectopic expression of miR-506 suppressed cell growth and metastasis by decreasing FLOT1 expression, indicating that the underlying mechanism by which miR-506 mediates tumor suppression. Our results provide a further insight into the pathogenesis of renal cancer and indicate novel potential biomarkers and therapeutic targets for renal cancer treatment.
  23 in total

Review 1.  Principles of micro-RNA production and maturation.

Authors:  Y Zeng
Journal:  Oncogene       Date:  2006-10-09       Impact factor: 9.867

Review 2.  Analytical aspects of microRNA in diagnostics: a review.

Authors:  Mariàngels de Planell-Saguer; María Celina Rodicio
Journal:  Anal Chim Acta       Date:  2011-05-20       Impact factor: 6.558

3.  The role of miR-506 in transformed 16HBE cells induced by anti-benzo[a]pyrene-trans-7,8-dihydrodiol-9,10-epoxide.

Authors:  Yao Zhao; Huanying Liu; Yuanqi Li; Jianjun Wu; Anne R Greenlee; Chengfeng Yang; Yiguo Jiang
Journal:  Toxicol Lett       Date:  2011-06-24       Impact factor: 4.372

4.  miR-506 acts as a tumor suppressor by directly targeting the hedgehog pathway transcription factor Gli3 in human cervical cancer.

Authors:  S-Y Wen; Y Lin; Y-Q Yu; S-J Cao; R Zhang; X-M Yang; J Li; Y-L Zhang; Y-H Wang; M-Z Ma; W-W Sun; X-L Lou; J-H Wang; Y-C Teng; Z-G Zhang
Journal:  Oncogene       Date:  2014-03-10       Impact factor: 9.867

Review 5.  Epigenetics and genetics. MicroRNAs en route to the clinic: progress in validating and targeting microRNAs for cancer therapy.

Authors:  Andrea L Kasinski; Frank J Slack
Journal:  Nat Rev Cancer       Date:  2011-11-24       Impact factor: 60.716

Review 6.  MicroRNAs: potential biomarkers for cancer diagnosis, prognosis and targets for therapy.

Authors:  William C S Cho
Journal:  Int J Biochem Cell Biol       Date:  2009-12-22       Impact factor: 5.085

7.  Flotillin-1 promotes cell growth and metastasis in oral squamous cell carcinoma.

Authors:  P Xiong; L Y Xiao; R Yang; Q Guo; Y Q Zhao; W Li; Y Sun
Journal:  Neoplasma       Date:  2013       Impact factor: 2.575

8.  Stage migration and increasing proportion of favorable-prognosis metastatic renal cell carcinoma patients: implications for clinical trial design and interpretation.

Authors:  Sujata Patil; Nicole Ishill; John Deluca; Robert J Motzer
Journal:  Cancer       Date:  2010-01-15       Impact factor: 6.860

9.  Abnormal expression of FLOT1 correlates with tumor progression and poor survival in patients with non-small cell lung cancer.

Authors:  Hui Li; Rui-Ming Wang; Shu-Guang Liu; Jian-Ping Zhang; Jing-Yu Luo; Bai-Jiang Zhang; Xing-Guo Zhang
Journal:  Tumour Biol       Date:  2013-11-26

10.  miR-506 regulates epithelial mesenchymal transition in breast cancer cell lines.

Authors:  Himanshu Arora; Rehana Qureshi; Woong-Yang Park
Journal:  PLoS One       Date:  2013-05-22       Impact factor: 3.240

View more
  25 in total

1.  CircRNA-UBE2G1 regulates LPS-induced osteoarthritis through miR-373/HIF-1a axis.

Authors:  Guang Chen; Tao Liu; Bofan Yu; Bingyi Wang; Qiang Peng
Journal:  Cell Cycle       Date:  2020-05-31       Impact factor: 4.534

2.  lncRNA PDIA3P regulates cell proliferation and invasion in non-small cell lung cancer.

Authors:  Xiaogang Yang; Baojun Yang
Journal:  Exp Ther Med       Date:  2019-08-13       Impact factor: 2.447

3.  Integration of GWAS and brain eQTL identifies FLOT1 as a risk gene for major depressive disorder.

Authors:  Jingmei Zhong; Shiwu Li; Wanli Zeng; Xiaoyan Li; Chunjie Gu; Jiewei Liu; Xiong-Jian Luo
Journal:  Neuropsychopharmacology       Date:  2019-02-16       Impact factor: 7.853

4.  Hsa_circ_0002577 promotes endometrial carcinoma progression via regulating miR-197/CTNND1 axis and activating Wnt/β-catenin pathway.

Authors:  Qiankun Shen; Tao He; Hongying Yuan
Journal:  Cell Cycle       Date:  2019-05-21       Impact factor: 4.534

Review 5.  The roles of microRNAs related with progression and metastasis in human cancers.

Authors:  Hai-Ting Liu; Peng Gao
Journal:  Tumour Biol       Date:  2016-10-06

Review 6.  Spectrum of microRNAs and their target genes in cancer: intervention in diagnosis and therapy.

Authors:  Alti Dayakar; Kumar D Shanmukha; Suresh K Kalangi
Journal:  Mol Biol Rep       Date:  2022-01-15       Impact factor: 2.742

7.  Correction: MiR-506 Is Down-Regulated in Clear Cell Renal Cell Carcinoma and Inhibits Cell Growth and Metastasis via Targeting FLOT1.

Authors:  Feng-Qiang Yang; Hai-Min Zhang; Shao-Jun Chen; Yang Yan; Jun-Hua Zheng
Journal:  PLoS One       Date:  2015-05-26       Impact factor: 3.240

8.  MiR-29 Induces K562 Cell Apoptosis by Down-Regulating FoxM1.

Authors:  Xiaofang Wang; Hua Zhong; Lei Wang; Yuqian Dong; Ankui Jia; Qingjiang Mo; Chenguang Zhang
Journal:  Med Sci Monit       Date:  2015-10-15

9.  Expression of microRNA-30c via lentivirus vector inhibits the proliferation and enhances the sensitivity of highly aggressive ccRCC Caki-1 cells to anticancer agents.

Authors:  Honglin Yang; Erlin Song; Guorong Shen; Tonghua Zhu; Tingwang Jiang; Hao Shen; Liping Niu; Biao Wang; Zhaoyang Lu; Jianping Qian
Journal:  Onco Targets Ther       Date:  2017-02-02       Impact factor: 4.147

10.  Overexpression of G6PD Represents a Potential Prognostic Factor in Clear Cell Renal Cell Carcinoma.

Authors:  Qiao Zhang; Xiaojia Yi; Zhe Yang; Qiaoqiao Han; Xuesong Di; Fufei Chen; Yanling Wang; Zihan Yi; Yingmin Kuang; Yuechun Zhu
Journal:  J Cancer       Date:  2017-02-25       Impact factor: 4.207

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.