Feng Tian1, Xiang-Lu Ji1, Wan-An Xiao1, Bin Wang1, Fei Wang1. 1. Department of Orthopaedic Surgery, Shengjing Hospital of China Medicine University, Miyoshi Street, No. 36, Heping District, Shenyang, Liaoning 110024, China.
Abstract
CXC chemokines are essential for osteogenic differentiation of bone mesenchymal stem cells (BMSCs) for use in bone tissue engineering and regenerative medicine in clinical settings. However, an accurate understanding of the underlying mechanisms is still needed. In this study, we analyzed the effects of CXC chemokine ligand-13 (CXCL13) on osteogenic differentiation of rat BMSCs and initiated a preliminary discussion on possible mechanisms. BMSCs were isolated from bone marrow of rat and incubated with CXCL13 recombinant protein in differentiation medium. The main osteogenesis indexes were alkaline phosphatase (ALP) activity and calcium nodes. Expression of Runx2 and CXCR5 was determined using western blot, while miRNAs were determined with quantitative-RT-PCR. Si-CXCR5 was transfected into MSCs to silence CXCR5. A miRNA-23a mimic was transfected into BMSCs for overexpression of miRNA-23a. Recombinant CXCL13 induced ALP activity, deposition of calcium salts, and formation of calcium nodes, and it also increased expression of Runx2. The expression of recombinant CXCL13 suppressed expression of miRNA-23a. Overexpression of miR-23a reversed CXCL13 induced-osteogenic differentiation of BMSCs and expression of Runx2. Recombinant CXCL13 attenuated the interaction of miRNA-23a with the Runx2 3'UTR. Silencing of CXCR5 abrogated recombinant CXCL13-induced downregulation of miRNA-23a expression. In summary, CXCL13 promotes osteogenic differentiation of BMSCs by inhibiting miR-23a expression.
CXC chemokines are essential for osteogenic differentiation of bone mesenchymal stem cells (BMSCs) for use in bone tissue engineering and regenerative medicine in clinical settings. However, an accurate understanding of the underlying mechanisms is still needed. In this study, we analyzed the effects of CXC chemokine ligand-13 (CXCL13) on osteogenic differentiation of rat BMSCs and initiated a preliminary discussion on possible mechanisms. BMSCs were isolated from bone marrow of rat and incubated with CXCL13 recombinant protein in differentiation medium. The main osteogenesis indexes were alkaline phosphatase (ALP) activity and calcium nodes. Expression of Runx2 and CXCR5 was determined using western blot, while miRNAs were determined with quantitative-RT-PCR. Si-CXCR5 was transfected into MSCs to silence CXCR5. A miRNA-23a mimic was transfected into BMSCs for overexpression of miRNA-23a. Recombinant CXCL13 induced ALP activity, deposition of calcium salts, and formation of calcium nodes, and it also increased expression of Runx2. The expression of recombinant CXCL13 suppressed expression of miRNA-23a. Overexpression of miR-23a reversed CXCL13 induced-osteogenic differentiation of BMSCs and expression of Runx2. Recombinant CXCL13 attenuated the interaction of miRNA-23a with the Runx2 3'UTR. Silencing of CXCR5 abrogated recombinant CXCL13-induced downregulation of miRNA-23a expression. In summary, CXCL13 promotes osteogenic differentiation of BMSCs by inhibiting miR-23a expression.
Adult MSCs derived from bone marrow stroma or connective tissue are capable of differentiating into multiple lineages including fibroblasts, osteoblasts, adipocytes, or chondrocytes [1]. Their characteristics of easy isolation and pronounced differentiation potential have led to consideration of application of MSCs in a variety of clinical therapies [2]. In recent years, BMSCs were proposed for use in bone defect repair due to their capacity for osteogenic differentiation [2]. This osteogenic differentiation potential of MSCs has been extensively studied and culturing conditions for in vitro differentiation have been established. The introduction of these cells into bone defects in patients was generally accepted, but the control of differentiation conditions still remains problematic. Therefore, obtaining a clear understanding of the mechanism underlying osteogenic differentiation is particularly important.Chemokines are a group of small cytokine-like proteins that function by interacting with their seven transmembrane-domain glycoprotein receptors coupled to the G protein signaling pathway [3]. The CXC chemokines represent a subfamily where the first two of four invariant cysteine residues are separated by a single amino acid and are essential for regulation of tumor immunity and organ specific metastasis [4, 5]. Current evidence indicates that CXC chemokines are expressed in bone tissue [6]. The interactions of CXC chemokines and chemokine receptors are known to mediate the migration of MSCs [7, 8]. One member of the CXC chemokine family, the CXC chemokine ligand-13 (CXCL13), binds monogamously to the CXC chemokine receptor-5 (CXCR5), and is essential for recruitment of MSCs during bone repair [9]. It also modulates cellular proliferation of osteoblasts [10]. Therefore, we hypothesized that CXCL13 might be involved in osteogenic differentiation of MSCs and we attempted to reveal a possible underlying mechanism.MicroRNAs (miRNAs) are small noncoding RNA molecules that function as suppressors for gene expression by interacting with the 3′-untranslated regions (3′UTRs) of target mRNAs. Initial studies have investigated the functional activity of specific miRNAs in bone [11]. The miRNAs expressed in osteoblasts (referred to as “osteo-miRNAs”) are critical for osteoblast differentiation and regulation of bone formation. A program of microRNAs also controls the osteogenic lineage progression by targeting transcription factor Runx2, which is essential for osteogenic differentiation [12].In the present study, BMSCs were isolated from bone marrow of Sprague-Dawley (SD) mice and incubated with CXCL13 recombination protein in differentiation medium, followed by examination of the osteogenic differentiation-related phenotype. We also investigated the possible involvement of CXCL13 in the stimulation of miRNAs and its interaction with Runx2 expression.
2. Materials and Method
2.1. Cell Isolation and Differentiation
BMSCs were isolated from male SD mice weighing 160–200 g. Briefly, the mice were anesthetized with Xylasin 2% at 1 mg/kg as premedication, followed with Ketamin HCl 10% at 60 mg/kg, and then the femur was isolated. The femur cavum ossis was rinsed under aseptic conditions with culture medium consisting of low glucose DMEM (L-DMEM, Gibco), 10% fetal bovine serum (FBS; Hyclone, Logan, Utah), 100 U/mL penicillin (Hyclone), and 100 mg/mL streptomycin (Hyclone). Cells in culture medium were counted and then plated into culture dishes. Finally, the cells were cultured in humidified air containing 5% CO2, at 37°C. The culture medium was replaced every 3 days until the cells reached 80% confluence. Cells were passaged using 0.25% trypsin (Hyclone) for 2 min at room temperature. The fourth generation cells were used for the subsequent experiments.Osteoblastic differentiation was carried out on the eighth day by culturing the BMSCs in induction medium containing 50 mg/mL ascorbic acid, 10 mmol/L sodium b-glycerophosphate, and 10 nmol/L dexamethasone, with or without CXCL13 recombination protein. Cells were harvested at the day 17 for mRNA and miRNA extraction or osteogenesis analysis.
2.2. Alizarin Red Staining
Alizarin red staining was used to detected calcium (Ca) deposits. In brief, BMSCs were washed twice with phosphate-buffered saline (PBS), followed by fixation with paraformaldehyde for 30 min at 4°C. After washing with double distilled water (ddH2O) three times, the fixed cells were cultured in 0.1% Alizarin red (Sigma-Aldrich, USA) Tris-HCl (pH 8.3) staining solution for 30 min at 37°C. Finally, the cells were extensively washed with distilled water and the staining of calcium mineral deposits was recorded under bright field microscopy. Each assay condition was repeated in triplicate and the experiment was repeated at least three times.
2.3. ALP Activity Assay
Identical numbers of cells were seeded. Cells cultured in differentiation medium were washed twice with PBS and then fixed in 4% (v/v) paraformaldehyde for 5 min at room temperature. The fixed cells were incubated with staining solution containing 0.1% (w/v) naphthol AS_MX phosphate, 56 mmol/L 2-amino-2-methyl-1-3-propanediol, and 0.1% (w/v) fast red violet LB salt for 10 min and stored in water for 20 min. Quantitative analysis of ALP activity was conducted by a colorimetric assay of enzyme activity using an ALP kit (BioAssay System, USA), following the manufacturer's instructions. Briefly, cell layers were washed three times with PBS and then total proteins were extracted with Protein Extract Reagents (Pierce, USA). The protein concentration in the lysate was quantified using the Bradford protein assay (Pierce Rockford, IL). A 25 μL volume of lysate was mixed with 25 μL of the freshly prepared colorimetric substrate para-nitrophenyl phosphate and incubated at 37°C for 30 min. The enzymatic reaction was stopped by adding 100 μL 0.2 mol/L NaOH. The optical density of the yellow product para-nitrophenol was determined by a HTS 7000 Plus Bio Assay reader (Perkin Elmer Life Sciences, USA) at a wavelength of 405 nm. The ALP activity was represented as OD405 per mg protein.
2.4. Transfection Assay
The functional relevance of miR-23a was verified by transfecting BMSCs with a miR-23a mimic or its negative controls (obtained from Ambion) in 24-well plates (105 cell per well) with Lipofectamine 2000 transfection agent (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions. After incubation for 24 h, the transfected cells were cultured in differentiation medium to induce osteogenic differentiation. At the indicated time points, the cells were harvested for miRNA and protein analysis.
2.5. Western-Blot Analysis
Total cell extracts were harvested in lysis buffer containing 50 mM Tris-base, 150 mM NaCl, 1% TritonX-100, 1% sodium deoxycholate, 0.1% SDS, 1 mMPMSF, and 0.2% Aprotinin (Sigma). The protein concentrations in the lysates were quantified by the Bradford protein assay (Pierce Rockford, IL). Equal amounts of protein were mixed with 2x sample buffer (Beyotime) and boiled. Proteins were separated on a 10% SDS-PAGE gel and transferred to a PVDF membrane (Millipore) using the semidry transfer method. After blocking in 10% nonfat dried milk in TTBS for 2 h, the proteins were incubated overnight at 4°C with anti-Runx2 (1 : 200, Santa Cruz Biotech) or anti-β-actin antibody (acted as an internal control, 1 : 100, Santa Cruz Biotech). Next, the blots were incubated with a horseradish peroxidase-conjugated secondary antibody (1 : 5000, Santa Cruz Biotech) at room temperature for 1 h. The protein was visualized using an ECL chemiluminescence kit (Pierce; Rockford, IL, USA).
2.6. miRNA Isolation and Analysis
The relative expression of a panel of miRNAs was assessed by quantitative Real-Time PCR (qPCR). Total RNA was extracted from cultured cells with TRIzol SM reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. The concentration and purity of RNA were controlled by ultraviolet-visible spectrophotometry (1.8, A260/A280, 2.0). After purification, RNA (1 μg) was reverse transcribed using the QuantiMir RT Kit (System Biosciences) according to the manufacturer's instructions. Specific miRNA forward primers (as below) and the 3′ universal primer (supported by the QuantiMir RT Kit) were used for endogenous miRNAs analysis. The qPCR was performed with SYBR Green Master Mix (Applied Biosciences) and a two-step cycling protocol (anneal and elongate at 60°C, then denature at 94°C). All transcript levels were normalized to that of mouse U6 snRNA transcript levels. The forward primer sets for real-time qPCR were as follows:miR-23a: ATCACATTGCCAGGGATTTCC,miR-30c: TGTAAACATCCTACACTCTCAGC,miR-34c: AGGCAGTGTAGTTAGCTGATTGC,miR-133a: TTGGTCCCCTTCAACCAGCTGT,miR-135a: TATGGCTTTTTATTCCTATGTGA,miR-137: TATTGCTTAAGAATACGCGTAG,miR-204: TTCCCTTTGTCATCCTATGCCTG,miR-205: TCCTTCATTCCACCGGAGTCTG,miR-217: TACTGCATCAGGAACTGACTGGAT,miR-218: TTGTGCTTGATCTAACCATGT,miR-338: TCCAGCATCAGTGATTTTGTTGA,U6 Control Forward: CGC TTC GGC AGC ACA TAT AC,Control Reverse: AAA ATA TGG AAC GCT TCA CGA.
2.7. Plasmid Construction and Luciferase Reporter Assays
Dual luciferase reporter assays were carried out to quantify Runx2 activity. The Runx2 3′UTR reporter assay was conducted by placing cultured cells in 24-well plates (1 × 105 cells per well), followed by cotransfection with pGL3-DROSHA 3′UTR-T and pRL-SV40 (50 : 1). The mimics of hsa-miR-23a and their negative controls (RIBO Bio, Guangzhou, P.R. China) were cotransfected with the reporter plasmids at a final concentration of 30 nmol/μL. Forty-eight hours after transfection, the luciferase activity in cell lysates was measured using the Dual-Luciferase Reporter Assay System (Promega, WI, USA) according to the manufacturer's protocol. Luciferase activity was normalized against the activity of the pRL-SV40. Independent triplicate experiments were performed for each plasmid construct.
2.8. siRNA Interference
The regulatory role of CXCL13 in osteoblastic differentiation was examined by silencing CXCL5, the receptor for CXCL13, via transfection of BMSCs with si-CXCL5. In brief, MSCs were seeded (5 × 105 cells/well) in 24-well plates and supplemented with α-MEM containing 10% FBS. One day after seeding, cells were transfected with double stranded siRNA (20 nM) against CXCL5 or with oligofectamine for 48 h. Cells transfected with nonspecific siRNA served as controls. Cells were cultured in the presence and absence of CXCL13 (15 ng/mL) for 6 h. Total cell lysates obtained were analyzed by Western blotting for CXCR5 expression and by real-time qPCR for miR-23a expression.
2.9. Statistical Analysis
Data are expressed as the mean ± SD. Statistical comparisons were made between two groups with the t-test and between multiple groups with one-way ANOVA. A value of P < 0.05 was considered significant unless otherwise described.
3. Results
3.1. CXCL13 Induced Osteogenic Differentiation of Mesenchymal Stem Cells
We first examined whether CXCL13 inhibits the osteogenic differentiation of MSCs. Isolated BMSCs from mouse were incubated with CXCL13 recombination protein in standard osteoblast induction medium. After 17 days of incubation, the osteogenic differentiation capability of the BMSCs was determined by Alizarin red staining and ALP activity. Alizarin red staining revealed that CXCL13 expression increased the formation of calcium salt nodules (Figure 1(a)). Quantification of ALP activity, an early marker of bone formation, revealed up to 1.2-fold increase in expression of this osteoblast marker, compared with the control (Figure 1(b)). These results indicated the osteoblast phenotype. Specifically, CXCL13 increased the level of Runx2 gene expression (Figure 1(c)).
Figure 1
Stimulation of osteogenic differentiation of mesenchymal stem cells by CXCL13. Mouse bone marrow mesenchymal stem cells (BMSCs) were incubated in differentiation media with or without recombinant CXCL13 protein (20 ng/mL) and on day 17, the analysis of osteogenesis and protein expression analysis was performed. (a) Representation of calcium nodes by alizarin red staining. (b) ALP activity. (c) Expression of Runx2 using western blot assays. All values represent means ± SD (n = 3). *
P < 0.05 compared with control groups treated without CXCL13 recombinant protein.
3.2. Regulation of miR-23a Expression by CXCL13 Treatment in BMSCs
Q-RT-PCR was used to determine whether CXCL13 treatment could alter miRNA expression in BMSCs after osteoblast induction. We detected a series of miRNAs, but only miR-23a expression was significantly decreased (Figure 2(a)), suggesting that CXCL13 signaling may inhibit miR-23 expression during osteoblast induction. Furthermore, the changes in miR-23a expression were monitored every two days after the cells were incubated in differentiation medium. As shown in Figure 2(b), a decreased expression of miR-23a accompanied BMSC differentiation and tended towards stabilization.
Figure 2
Expression profiles of miRNAs in BMSCs treated with CXCL13 recombinant protein. The cells were cultured in differentiation media with or without CXCL13 recombinant protein for 17 days, (a) miRNA expression levels were analyzed by Q-RT-PCR. (b) Changes in expression of miR-23a over a series of days. Expression was normalized to U6 small RNA and all values represent means ± SD (n = 3). *
P < 0.05 compared with control groups treated without CXCL13 recombinant protein.
3.3. miR-23a Is Essential for CXCL13-Induced Osteogenic Differentiation of BMSCs
The involvement of miR-23a in the process of CXCL13-induced osteogenic differentiation of BMSCs was evaluated by transfecting cells with a miR-23a mimic before CXCL13 induction of osteogenesis. In contrast to the date presented in Figure 1, when compared with the negative control, pretreatment with the miR-23a mimic partly suppressed the CXCL13-induced increases in number of calcium salt nodules (Figure 3(a)) and in ALP activity (Figure 3(b)). Importantly, miR-23a treatment resulted in a 5.6 fold increase in expression of miR-23a when compared with the negative treatment (Figure 3(c)).
Figure 3
Overexpression of miR-23a reversed CXCL13 induced-osteogenic differentiation of mesenchymal stem cells. Before treatment with CXCL13 recombinant protein, BMSCs were transfected with a miR-23a mimic. The cells were incubated for 17 days for further analysis. (a) Representation of calcium nodes by alizarin red staining. (b) ALP activity. (c) Expression of miR-23a using Q-RT-PCR. All values represent means ± SD (n = 3). *
P < 0.05 compared with corresponding groups.
3.4. CXCL13 Mediated Upregulation of Runx2 by Inhibiting miR-23a
Direct targeting of the 3′UTR of Runx2 mRNA by miR-23a was examined by fusing the full-length 3′UTR to a luciferase (LUC) reporter (FL-Rx2UTR). CXCL13 treatment significantly increased expression of Runx2, the first transcription factor required for commitment to the osteoblast lineage, in BMSCs cells after osteogenic induction. We next determined the binding of the miR-23a to endogenous Runx2 mRNA by luciferase assays and found a decrease in the activity of Runx2 3′UTR (Figure 4(a)). In addition, pretransfection of cells with a miRNA-23a mimic to upregulate miRNA 23a reversed the CXCL13-induced increase in expression of Runx2 (Figure 4(b)).
Figure 4
Regulation of Runx2 expression by miR-23a in BMSCs. (a) Runx2 3′UTR luciferase assay. (b) Expression of Runx2 in cells transfected with a miR-23a mimic. All values represent means ± SD (n = 3). *
P < 0.05 compared with control groups.
3.5. Knock-Down of CXCR5 Promoted miR-23a Expression
The possibility that modulation of miR-23a expression by CXCL13 during BMSC osteogenic differentiation is mediated by integration to its receptor-CXCR5 was tested by treating cells with si-CXCR5 and observing its effects on CXCL13-reduced miR-23a expression. As shown in Figure 5(a), compared with the si-control, transfection of si-CXCR5 caused CXCR5 expression downregulation that abrogated CXCL13-induced downregulated miRNA-23a expression (Figure 5(b)).
Figure 5
CXCR5 interference abrogated CXCL13-induced downregulation expression of miR-23a. Before exposure to CXCL13, cells were transfected with si-CXCR5. (a) CXCR5 expression by western blotting. (b) Analysis of expression of miR-23a. All values represent means ± SD. *
P < 0.05 compared with corresponding groups.
4. Discussion
Recent studies have focused on understanding the osteogenic differentiation of MSCs because of their potential use in therapy for bone injury-related diseases [13]. Our findings suggested that CXCL13 is a potential promoter of osteogenic differentiation of BMSCs, which was monitored by the increased deposition of calcium into the extracellular matrix and the enhanced activity of the osteogenic marker ALP. Here, we observed that CXCL13-stimulated osteogenic differentiation of BMSCs is mediated by miR-23a downregulation that promoted expression of the osteogenic differentiation-related transcription factor -Runx2.Mesenchymal stem cells (MSCs), which show both self-renewal and multipotency, have been regarded as the most promising cell sources for bone tissue engineering and regenerative medicine. Much research has focused on the osteogenic differentiation of BMSCs. The CXC chemokines and their receptors are highly expressed in bone tissue. Smith et al. demonstrated that chemokines stimulate bidirectional migration of human mesenchymal stem cells across bone marrow endothelial layers [14]. Previous studies indicated that chemokines and their receptors played a key role in MSCs. Among the numerous chemokines, CXCL13 is only expressed in osteogenic precursor cells and its receptor CXCR5 is one of the strongly expressed MSC receptors. Lisignoli et al. demonstrated that CXCL13 induced proliferation in osteoblasts for bone repair of MSCs [10]. Thus, we hypothesized that CXCL13 might play a potential role in osteogenic differentiation of BMSCs. This hypothesis was supported by the emergence of an osteogenic differentiation phenotype in BMSCs incubated with recombination CXCL13 protein.A program of microRNAs has been reported as critical for osteoblast differentiation. Among these, only miR-23a expression was altered in the present study, with a 2.5-fold decline, suggesting the possibility of negatively correlated regulation of miR-23a in the CXCL13-stimulated osteogenic differentiation experiment. This was further demonstrated when BMSCs were treated with a miR-23a mimic that attenuated CXCL13-induced osteogenic differentiation in the BMSCs.Our data also indicated that CXCL13 upregulated Runx2 expression. Runx2 is a member of the runt-domain gene family of DNA binding proteins (Runx1, Runx2, and Runx3), which control the expression of numerous genes involved in cell growth, proliferation and determination of cell lineage [15-17]. Runx2 remains the earliest expressed of the transcriptional regulators critical for bone formation [18, 19]. Notably, a panel of 11 Runx2-targeting miRNAs (miR-23a, miR-30c, miR-34c, miR-133a, miR-135a, miR-137, miR-204, miR-205, miR-217, miR-218, and miR-338) is expressed in a lineage-related pattern in mesenchymal cell types [20]. Given this observation, we used a luciferase reporter assay to evaluate whether Runx2 is controlled by miR-23a during CXCL13-stimulated osteogenic differentiation of BMSCs. CXCL13 treatment reduced Runx2 3′UTR activity and attenuated Runx2 protein expression, and the latter effect was reversed by a miR-23a mimic treatment. These data indicated that CXCL13 induced osteogenic differentiation of BMSCs by downregulation of miR-23a, which enhanced expression of osteogenic differentiation-related transcription factor-Runx2.We also attempted to identify a possible CXCL13-specific receptor involved in this process. The CXC chemokine receptor-5 (CXCR5) is essential for bone repair by MSCs [9]. In our study, silencing of CXCR5 gene expression significantly abrogated the CXCL13-induced decrease in miR-23a expression.In summary, this study is the first to show that CXCL13 was capable of inducing osteogenic differentiation in BMSCs by inhibiting miR-23a expression. Silencing of miR-23a triggers the expression of critical regulators of osteogenesis, like Runx2, and these events ultimately result in enhanced mineralization of the extracellular matrix. This mechanism contrasts with the inhibitory effect of CXCL13 on osteogenic differentiation by posttranscriptional gene silencing. This signaling pathway stimulates osteoblast differentiation and might be involved in lineage determination.
Authors: Mohammad Q Hassan; Jonathan A R Gordon; Marcio M Beloti; Carlo M Croce; Andre J van Wijnen; Janet L Stein; Gary S Stein; Jane B Lian Journal: Proc Natl Acad Sci U S A Date: 2010-10-27 Impact factor: 11.205
Authors: Bekim Sadikovic; Maisa Yoshimoto; Susan Chilton-MacNeill; Paul Thorner; Jeremy A Squire; Maria Zielenska Journal: Hum Mol Genet Date: 2009-03-13 Impact factor: 6.150
Authors: Susana Gomes Santos; Maria Inês Almeida; Andreia Machado Silva; Sara Reis Moura; José Henrique Teixeira; Mário Adolfo Barbosa Journal: Bone Res Date: 2019-03-27 Impact factor: 13.567
Authors: Maria Rosa Iaquinta; Fernanda Martini; Antonio D'Agostino; Lorenzo Trevisiol; Massimo Bersani; Elena Torreggiani; Mauro Tognon; John Charles Rotondo; Elisa Mazzoni Journal: Front Bioeng Biotechnol Date: 2022-06-27