Literature DB >> 25762286

Cerebellar output controls generalized spike-and-wave discharge occurrence.

Lieke Kros1, Oscar H J Eelkman Rooda1, Jochen K Spanke1, Parimala Alva2, Marijn N van Dongen3, Athanasios Karapatis3, Else A Tolner4, Christos Strydis1, Neil Davey2, Beerend H J Winkelman5, Mario Negrello1, Wouter A Serdijn3, Volker Steuber2, Arn M J M van den Maagdenberg4,6, Chris I De Zeeuw1,5, Freek E Hoebeek1.   

Abstract

OBJECTIVE: Disrupting thalamocortical activity patterns has proven to be a promising approach to stop generalized spike-and-wave discharges (GSWDs) characteristic of absence seizures. Here, we investigated to what extent modulation of neuronal firing in cerebellar nuclei (CN), which are anatomically in an advantageous position to disrupt cortical oscillations through their innervation of a wide variety of thalamic nuclei, is effective in controlling absence seizures.
METHODS: Two unrelated mouse models of generalized absence seizures were used: the natural mutant tottering, which is characterized by a missense mutation in Cacna1a, and inbred C3H/HeOuJ. While simultaneously recording single CN neuron activity and electrocorticogram in awake animals, we investigated to what extent pharmacologically increased or decreased CN neuron activity could modulate GSWD occurrence as well as short-lasting, on-demand CN stimulation could disrupt epileptic seizures.
RESULTS: We found that a subset of CN neurons show phase-locked oscillatory firing during GSWDs and that manipulating this activity modulates GSWD occurrence. Inhibiting CN neuron action potential firing by local application of the γ-aminobutyric acid type A (GABA-A) agonist muscimol increased GSWD occurrence up to 37-fold, whereas increasing the frequency and regularity of CN neuron firing with the use of GABA-A antagonist gabazine decimated its occurrence. A single short-lasting (30-300 milliseconds) optogenetic stimulation of CN neuron activity abruptly stopped GSWDs, even when applied unilaterally. Using a closed-loop system, GSWDs were detected and stopped within 500 milliseconds.
INTERPRETATION: CN neurons are potent modulators of pathological oscillations in thalamocortical network activity during absence seizures, and their potential therapeutic benefit for controlling other types of generalized epilepsies should be evaluated.
© 2015 The Authors Annals of Neurology published by Wiley Periodicals, Inc. on behalf of American Neurological Association.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25762286      PMCID: PMC5008217          DOI: 10.1002/ana.24399

Source DB:  PubMed          Journal:  Ann Neurol        ISSN: 0364-5134            Impact factor:   10.422


Absence epilepsy is among the most prevalent forms of generalized epilepsy among children and is characterized by sudden periods of impaired consciousness and behavioral arrest.1, 2 Like other types of generalized epilepsies, absence seizures are electrophysiologically defined by oscillatory activity in cerebral cortex and the thalamic complex.3 Thalamocortical oscillations are primarily caused by excessive cortical activity and can be identified in the electrocorticogram (ECoG) as generalized spike‐and‐wave discharges (GSWDs).3, 4 The underlying excessive cortical activity not only excites thalamic neurons, but also provides potent bisynaptic inhibition by means of cortical axonal collaterals to the inhibitory reticular thalamic nucleus.3, 5, 6, 7 Excess tonic γ‐aminobutyric acid (GABA)‐mediated inhibition in thalamus may also contribute to absence seizures.3, 7, 8 Oscillatory cortical activity thereby poses a dual excitation–inhibition effect on thalamic neurons, which drives thalamocortical network oscillations.5, 7, 8, 9 Recent studies in several rodent models indicate that direct stimulation of thalamic nuclei10 or cerebral cortex11 can be effective in disrupting thalamocortical oscillations and thereby stopping generalized oscillations in thalamocortical networks, such as GSWDs. Apart from direct interventions in thalamus and cortex, thalamic afferents can affect the balance in excitation and inhibition and thereby potentially mediate thalamocortical oscillations. One of the initial stimulation sites to prevent seizures in epileptic patients was the cerebellar cortex.12, 13, 14, 15, 16, 17, 18 Yet, as shown in 3 controlled, blind studies,19, 20, 21 the impact of these cerebellar surface stimulations was highly variable and probably reflects irregularities in the converging inputs from superficial and deeper parts of the cerebellar cortex neurons to the cerebellar nuclei (CN).22 Given the considerable divergence of excitatory axonal projections from the CN to a wide range of motor, associative, and intralaminar thalamic nuclei,4, 6, 23, 24, 25, 26, 27, 28, 29 we considered this region an ideal candidate to effectively modulate thalamocortical oscillations. We hypothesized that altering the firing patterns of CN neurons should affect GSWD occurrence. To test this hypothesis, we utilized homozygous tottering (tg) mice that frequently show absence seizures and harbor a P601L missense mutation in the Cacna1a gene that encodes the pore‐forming α1A‐subunit of voltage‐gated CaV2.1 Ca2+ channels.30, 31 Once we established that tg CN neurons showed oscillatory action potential firing patterns comparable to that found in rat models for absence epilepsy,32 we assessed the effect of increasing or decreasing CN neuronal firing on GSWD occurrence by local pharmacological interventions using modulators of GABAA‐mediated neurotransmission. In addition, we generated a closed‐loop detection system for on‐demand optogenetic stimulation to stimulate CN neurons with millisecond precision. Finally, to exclude the possibility that our design of intervention is tailored to the specific pathophysiology of tg mice, we extended our key experiments to an unrelated mouse model for absence epilepsy: the C3H/HeOuJ inbred mouse line.33

Materials and Methods

All experiments were performed in accordance with the European Communities Council Directive. Protocols were reviewed and approved by local Dutch experimental animal committees.

Animals

Data were collected from 4‐ to 30‐week‐old homozygous and wild‐type littermates of natural mutant tg mice and 8‐ to 10‐week‐old inbred C3H/HeOuJ mice. Male and female tg and wild‐type littermates were bred using heterozygous parents. The colony, which was originally obtained from Jackson Laboratory (Bar Harbor, ME), was maintained in C57BL/6NHsd purchased from Harlan Laboratories (Horst, the Netherlands). Conformation of the presence of the tg mutation in the Cacna1a gene was obtained by polymerase chain reaction using 5′‐TTCTGGGTACCAGATACAGG‐3′ (forward) and 5′‐ AAGTGTCGAAGTTGGTGCGC‐3′ (reverse) primers (Eurogentech, Seraing, Belgium) and subsequent digestion using restriction enzyme NsbI at the age of postnatal day (P) 9 to P12. Male inbred C3H/HeOuJ mice were purchased from Charles River Laboratories (Wilmington, MA).

Experimental Procedures

Surgery

Mice were anesthetized with isoflurane (4% in 0.5l/min O2 for induction and 1.5% in 0.5l/min O2 for maintenance). The skull was exposed, cleaned, and treated with OptiBond All‐In‐One (Kerr Corporation, Orange, CA) to ensure adhesion of a light‐curing hybrid composite (Charisma; Heraeus Kulzer, Hanau, Germany) to the skull to form a pedestal. Subsequently, five 200μm Teflon‐coated silver ball tip electrodes (Advent Research Materials, Eynsham, UK) or five 1mm stainless steel screws were subdurally implanted for cortical recordings by ECoG. Four of the electrodes were bilaterally positioned above the primary motor cortex (+1mm anterior‐posterior [AP]; ±1mm medial ‐ lateral [ML] relative to bregma) and primary sensory cortex (−1mm AP; ± 3.5mm ML). A fifth electrode was placed in the rostral portion of the interparietal bone to serve as reference (−1mm AP relative to lambda). The electrodes and their connectors were fixed to the skull and embedded in a pedestal composed of the hybrid composite or dental acrylic (Simplex Rapid; Associated Dental Products, Kemdent Works, Purton, UK). To enable optogenetic control of neuronal activity in CN, a subset of tg and C3H/HeOuJ mice received 2 small (∼0.5mm in diameter) craniotomies in the interparietal bone (−2mm AP relative to lambda; ±1.5–2mm ML) to initially accommodate the injection pipette and later the optical fibers. CN were stereotactically injected bilaterally with 100 to 120nl of the AAV2‐hSyn‐ChR2(H134R)‐EYFP vector (kindly provided by Dr K. Deisseroth [Stanford University] through the Vector Core at the University of North Carolina) at a rate of ∼20nl/min 3 to 6 weeks prior to recordings. To allow electrophysiological recordings from CN neurons, all mice received bilateral craniotomies (∼2mm diameter) in the occipital bone without disrupting the dura mater. Finally, a dental acrylic recording chamber (Simplex rapid) was constructed. The exposed tissue was covered with tetracycline‐containing ointment (Terra‐cortril; Pfizer, New York, NY) and the recording chamber was sealed with bone wax (Ethicon, Somerville, NJ). After surgery, the mice recovered for at least 5 days (or 3 weeks in the case of virally injected mice) in their home cage and were allowed two ∼3‐hour sessions on consecutive days during which the mice were left undisturbed to accommodate to the setup.

Electrophysiological Recordings

During the accommodation session, the animals’ motor behavior was visually inspected for behavioral correlates of the oscillatory cortical activity during episodes of GSWDs. No consistent patterns of movement were identified during such epileptic activity, as described before in tg and other rodent models of absence epilepsy.30, 32, 34 Recordings were performed in awake, head‐fixed animals, lasted no longer than 4 consecutive hours, and were performed during various times of day. No consistent pattern was identified in ECoG frequency spectra with respect to the day–night cycle.35 While being head‐restrained, mice were able to move all limbs freely. Body temperature was supported using a homeothermic pad (FHC, Bowdoin, ME). For extracellular single unit recordings, custom‐made, borosilicate glass capillaries (outer diameter = 1.5mm, inner diameter = 0.86mm, resistance = 8–12MΩ, taper length = ∼8mm, tip diameter = ∼1μm; Harvard Apparatus, Holliston, MA) filled with 2M NaCl were positioned stereotactically using an electronic pipette holder (SM7; Luigs & Neumann, Ratingen, Germany). CN were localized by stereotactic location as well as the characteristic sound and density of neuronal activity.36 To record from medial CN (MCN), electrodes were advanced through vermal lobules 6 to 7 with 0° jaw angle relative to the interaural axis to a depth of 1.6 to 2.4mm. To record from interposed nuclei (IN), electrodes were advanced through the paravermal or hemispheric part of lobules 6 to 7 using a yaw angle of ∼10° relative to the interaural axis to a depth of 1.8 to 2.7mm. To record from lateral CN (LCN), electrodes were advanced through the paravermal or hemispheric part of lobules 6 to 7 using a yaw angle of ∼25° relative to the interaural axis to a depth of 2.7 to 4mm. A subset of electrophysiological recording sites was identifiable following Evans blue injections (see below) and confirmed the accuracy of our localization technique. ECoGs were filtered online using a 1 to 100Hz band pass filter and a 50Hz notch filter. Single unit extracellular recordings and ECoGs were simultaneously sampled at 20kHz (Digidata 1322A; Molecular Devices, Axon Instruments, Sunnyvale, CA), amplified, and stored for offline analysis (CyberAmp & Multiclamp 700A, Molecular Devices).

Pharmacological Modulation of CN Neuronal Action Potential Firing

To bilaterally target the CN for pharmacological intervention, their location was first determined as described above, after which we recorded 1 hour of "baseline" ECoG. Next, a borosilicate glass capillary (Harvard Apparatus; tip diameter = ∼5μm) filled with 1 of the following mixtures replaced the recording pipette to allow high spatial accuracy of the injection: to decrease CN neuronal action potential firing, we applied 0.5% muscimol (GABAA‐agonist; Tocris Bioscience, Bristol, UK) dissolved in 1M NaCl (Sigma‐Aldrich, St Louis, MO); to increase CN neuronal action potential firing, we applied 100µM gabazine (GABAA‐ antagonist; Tocris) dissolved in 1M NaCl; or 1M NaCl for sham injections. The experimenter was blinded for the solutions injected. The solution was bilaterally administered to CN by pressure injections of ∼150nl at a rate of ∼50nl/min, following which 1 hour of postinjection ECoG was recorded. As an additional control, similarly sized injections of saline with either gabazine or muscimol were administered to lobules 6 and 7 and Crus I and Crus II of the cerebellar cortex. The drugs were injected superficially (0.7–1mm from the surface) to avoid spread to the CN. The locations of the injections were identified with the use of electrophysiological recordings and stereotactic coordinates, and most (19 of 26) CN injections were histologically confirmed using the fluorescence of Evans blue (1% in 1M saline supplied to the injected solution; Supplementary Fig).37 To verify the effects of muscimol, gabazine, and vehicle, we recorded extracellular activity in the injected area during 20 to 50 minutes after the injections. Immediately after acquiring the postinjection ECoG, an overdose of sodiumpentobarbital (0.15ml intraperitoneally) was administered allowing transcardial perfusion (0.9% NaCl followed by 4% paraformaldehyde in 0.1M phosphate buffer [PB]; pH = 7.4) to preserve the tissue for histological verification of the injections.

Optogenetic Stimulation of CN Neurons

Optic fibers (inner diameter = 200μm, numerical aperture = 0.39; Thor labs, Newton, NJ, USA) were placed ∼200μm from the injection site and connected to 470nm or 590nm light‐emitting diodes (LEDs; Thor labs), or ∼200μm above the brain, that is, in the "wrong location." Light intensity at the tip of the implantable fiber was 550 ± 50μW/mm2 (measured after each experiment). Activation of LEDs by a single 30‐ to 300‐millisecond pulse was triggered manually (open‐loop) or by a closed‐loop detection system (as described below). In each mouse, 4 stimulation protocols were used: (1) bilateral stimulation (470nm), (2) unilateral stimulation (470nm), (3) bilateral stimulation (590nm), and (4) bilateral stimulation (470nm) with optical fibers outside of the CN (to exclude potential effects of visual input on the GSWD occurrence.30, 32 After the last experimental session, animals were sedated and perfused (as described above) to preserve tissue for histological verification of channelrhodopsin‐2 (ChR2) expression.

Immunofluorescence

After perfusion, the cerebellum was removed and postfixed in 4% paraformaldehyde in 0.1M PB for 1.5 hour, placed in 10% sucrose in 0.1M PB at 4°C overnight, and subsequently embedded in gelatin in 30% sucrose (in 0.1M PB). Embedded brains were postfixed for 2.5 to 3 hours in 30% sucrose and 10% formaldehyde (in Milli‐Q; Millipore, Billerica, MA) and placed overnight in 30% sucrose (in 0.1M PB) at 4°C. Forty‐micrometer‐thick transversal slices were serially collected for immunofluorescent 4′,6‐diamidino‐2‐phenylindole (DAPI) staining. To confirm correct localization of the injections, fluorescence was assessed with images captured using a confocal laser scanning microscope (LSM 700; Zeiss, Lambrecht, Germany) at 555nm (Evans blue), 405nm (DAPI), and 488 to 527nm (green fluorescent protein/yellow fluorescent protein range) and optimized for contrast and brightness manually (Zen 2009 software, Zeiss). The fluorescent images were captured using a tile‐scan function of the Zen software with a ×10 objective and have been optimized for representation using Adobe Illustrator (Creative Suite 6; Adobe Systems, San Jose, CA). Cerebellar nuclei (CN) neuronal action potential firing patterns are modulated during generalized spike‐and‐wave discharges (GSWDs). (A) Schematic of recording sites for electrocorticogram (ECoG) from primary motor (M1) and sensory (S1) cortices and extracellular single unit CN neuronal (CNN) recordings (Th = thalamus, hpc = hippocampus). (B) ECoG from M1 and S1 with GSWD episodes (horizontal lines), indicating absence seizures. (C) Zoom of M1 episode outlined in B and simultaneously recorded action potential firing of a single CN neuron. (D; top panel) Zoom of outlined M1 and CNN recording in C. Red lines align ECoG spike with pause in CNN action potential firing. Bottom panel: Compass plot of phase difference between ECoG spike and modulated CNN action potential firing. IN = interposed nuclei; LCN = lateral CN; MCN = medial CN. (E) Raster plot and accompanying peri–spike‐and‐wave discharge time histogram of CNN action potentials (AP) for 3 consecutive seizures (t = 0 is aligned with each ECoG spike). (F) Distribution of absolute Z scores of mean power at GSWD frequency as determined by fast Fourier transform for MCN, IN, and LCN. Note that none of the negative Z scores was below −1.96, and therefore showing absolute Z scores does not change the number of data points below and above the 1.96 cutoff score (corresponding to p < 0.05; horizontal dashed line). Total number of recorded neurons: MCN, n = 100; IN, n = 67; LCN, n = 43. (G) Bar plots representing firing frequency, coefficient of variation, coefficient of variation 2 (CV2), and burst index for CN neurons recorded in wild‐type littermate (n = 94; black) and seizure‐modulated (n = 103; light gray) and non‐modulated CN neurons recorded in tg (n = 107; dark gray). For clarity, we truncated the negative error bars. **p < 0.01, ***p < 0.001 (multivariate analysis of variance, post hoc analyses of variance with Bonferroni correction; see Table 1). (H) Result of the Gaussian process regression to predict the Z score from interictal activity parameters (CV, firing frequency, log‐interval entropy, and permutation entropy) represented as a confusion matrix. The prediction is characterized as being a true positive (tp) when the predicted Z score is >1.96 (dotted line) and the actual Z score is >1.96. A true negative (tn) is scored when both predicted and actual Z scores are <1.96. False positive (fp) and false negative (fn) refer to neurons that have been incorrectly predicted as GSWD modulated and GSWD non‐modulated, respectively. Note that we were able to achieve a precision of 0.70 and a recall of 0.94, which means that 70% of CN neurons (n = 210) that were predicted as GSWD modulated actually were GSWD modulated, and 94% of all GSWD‐modulated neurons have been identified correctly by the model. The Pearson correlation coefficient (r) between the predicted Z score and the actual Z score was 0.56 with p ≤ 0.05.
Table 1

CN Action Potential Firing

Tested DataCompared Groups N p t or F‐valueStatistical Test
Differences in phase relation between CN modulation and GSWD cycle
Phase relationMCN1000.512 F(2,100) = 0.674Watson–Williams multiple sample test
IN67
LCN43
Differences in CN neuronal action potential firing
Coherence tg GSWD‐modulated103<0.001a t(195.9) = 13.35Independent samples t test
tg non‐modulated107
OverallWild type94<0.001a F(4,192) = 68.72MANOVA (Pillai's trace)
tg GSWD‐modulated interictal103
Firing frequencyWild type940.095 F(1,195) = 2.81ANOVA (Bonferroni)
tg GSWD‐modulated interictal103
Coefficient of variationWild type94<0.001a F(1,195) = 58.88ANOVA (Bonferroni)
tg GSWD‐modulated interictal103
CV2Wild type94<0.001a F(1,195) = 34.63ANOVA (Bonferroni)
tg GSWD‐modulated interictal103
Burst indexWild type94<0.001a F(1,195) = 230.86ANOVA (Bonferroni)
tg GSWD‐modulated interictal103
OverallWild type94<0.001a F(4,196) = 16.66MANOVA (Pillai's trace)
tg non‐modulated interictal107
Firing frequencyWild type940.092 F(1,199) = 2.86ANOVA (Bonferroni)
tg non‐modulated interictal107
Coefficient of variationWild type94<0.001a F(1,199) = 15.13ANOVA (Bonferroni)
tg non‐modulated interictal107
CV2Wild type94<0.01a F(1,199) = 6.79ANOVA (Bonferroni)
tg non‐modulated interictal107
Burst indexWild type94<0.001a F(1,199) = 37.99ANOVA (Bonferroni)
tg non‐modulated interictal107
Overall tg GSWD‐modulated interictal103<0.001a F(4,205) = 17.84MANOVA (Pillai trace)
tg non‐modulated interictal107
Firing frequency tg GSWD‐modulated interictal103<0.001a F(1,208) = 16.31ANOVA (Bonferroni)
tg non‐modulated interictal107
Coefficient of variation tg GSWD‐modulated interictal103<0.01a F(1,208) = 7.12ANOVA (Bonferroni)
tg non‐modulated interictal107
CV2 tg GSWD‐modulated interictal103<0.01a F(1,208) = 9.47ANOVA (Bonferroni)
tg non‐modulated interictal107
Burst index tg GSWD‐modulated interictal103<0.001a F(1,208) = 62.6ANOVA (Bonferroni)
tg non‐modulated interictal107

Corresponds to Figure 1.

Statistically significant.

ANOVA = analysis of variance; CN = cerebellar nuclei; GSWD = generalized spike‐and‐wave discharge; IN = interposed nuclei; LCN = lateral cerebellar nuclei; MANOVA = multivariate analysis of variance; MCN = medial cerebellar nuclei.

Bimodal modulation of generalized spike‐and‐wave discharge (GSWD) occurrence by pharmacological manipulation of cerebellar nuclei (CN) neuronal (CNN) action potential firing. (A) Confocal image of coronal cerebellar slice with bilateral muscimol injections (blue = 4′,6‐diamidino‐2‐phenylindole (DAPI); red = Evans blue indicating the injection sites; IN = interposed nucleus; IV = 4th ventricle; LCN = lateral CN; MCN = medial CN). (B) Examples of CNN recordings before and after bilateral muscimol (top) and gabazine (bottom) injections. (C) Bar plots for the impact of gabazine on CNN firing as quantified by the difference between pre‐ and postgabazine injections (n = 81 and n = 55, respectively) in firing frequency, coefficient of variation, median CV2, and burst index; **p < 0.01, ***p < 0.001 (multivariate analysis of variance, post hoc analyses of variance [ANOVAs] with Bonferroni corrections; see Table 2). (D; top) Representative electrocorticogram (ECoG) of primary motor cortex (M1) ECoG before and after muscimol injection; (bottom) representative M1 ECoG before and after gabazine injection. (E) Time course of the effects of muscimol (left) and gabazine (right) on the average number of GSWD episodes (bin size = 5 minutes). (F, G) Normalized number of seizures (F) and normalized seizure duration (G) before and after muscimol (left) and gabazine (right) injections (1 hour each) for bilateral injections in all CN (n = 10 for both gabazine and muscimol), in IN/LCN (n = 6 for muscimol and 5 for gabazine), and in MCN (n = 4 for muscimol and 5 for gabazine). Note that for quantification of the seizure duration after gabazine injection, only 9 mice are included in all CN and 4 mice in the IN/LCN group, because 1 mouse did not show any GSWDs postinjection. Blue dots indicate data recorded from male mice and red dots from female. *p < 0.05, **p < 0.01 (Friedman ANOVAs and Mann–Whitney U tests; see Tables 2 and 3). (H) Normalized number of GSWD episodes (left) and normalized GSWD episode duration (right) for control experiments; saline injections in the CN and muscimol and gabazine injections in superficial cerebellar cortical areas.
Table 2

Impact of Pharmacological Manipulations on CN Firing and GSWD Occurrence

Tested DataCompared Groups N p F Statistical Test
Effects of bilateral CN gabazine injections on CNN activity
Overall tg pregabazine81<0.001a F(4,131) = 39.83MANOVA (Pillai's trace)
tg postgabazine55
Firing frequency tg pregabazine81<0.001a F(1,134) = 37.15ANOVA (Bonferroni)
tg postgabazine55
Coefficient of variation tg pregabazine81<0.001a F(1,134) = 61.21ANOVA (Bonferroni)
tg postgabazine55
CV2 tg pregabazine81<0.001a F(1,134) = 117.63ANOVA (Bonferroni)
tg postgabazine55
Burst index tg pregabazine81<0.01a F(1,134) = 8.71ANOVA (Bonferroni)
tg postgabazine55
Effects of pharmacological manipulations of CN neurons on GSWDs
GSWD occurrence tg presaline CN60.180Friedman's ANOVA
tg postsaline CN
tg premuscimol CN10<0.01a Friedman's ANOVA
tg postmuscimol CN
tg pregabazine CN10<0.01a Friedman's ANOVA
tg postgabazine CN
tg premuscimol cortex50.655Friedman's ANOVA
tg postmuscimol cortex
tg pregabazine cortex50.317Friedman's ANOVA
tg postgabazine cortex
GSWD duration tg presaline CN60.414Friedman's ANOVA
tg postsaline CN
tg premuscimol CN100.206Friedman's ANOVA
tg postmuscimol CN
tg pregabazine CN100.317Friedman's ANOVA
tg postgabazine CN
tg premuscimol cortex50.655Friedman's ANOVA
tg postmuscimol cortex
tg pregabazine cortex50.655Friedman's ANOVA
tg postgabazine cortex

Corresponds to Figure 2C, F–H.

Statistically significant.

ANOVA = analysis of variance; CN = cerebellar nuclei; CNN = CN neuronal; GSWD = generalized spike‐and‐wave discharge; MANOVA = multivariate analysis of variance.

Table 3

Impact of Local Pharmacological Manipulations on GSWD Occurrence

Tested DataCompared Groups N p Statistical Test
GSWD occurrence pre vs post tg premuscimol IN/LCN6<0.05a Friedman's ANOVA
tg postmuscimol IN/LCN
tg premuscimol MCN4<0.05a Friedman's ANOVA
tg postmuscimol MCN
tg pregabazine IN/LCN5<0.05a Friedman's ANOVA
tg postgabazine IN/LCN
tg pregabazine MCN5<0.05a Friedman's ANOVA
tg postgabazine MCN
GSWD occurrence medial vs lateral CN tg postmuscimol IN/LCN60.067Mann–Whitney U test
tg postmuscimol MCN4
tg postgabazine IN/LCN5<0.01a Mann–Whitney U test
tg postgabazine MCN5
GSWD duration pre vs post tg premuscimol IN/LCN60.102Friedman's ANOVA
tg postmuscimol IN/LCN
tg premuscimol MCN41.00Friedman's ANOVA
tg postmuscimol MCN
tg pregabazine IN/LCN51.00Friedman's ANOVA
tg postgabazine IN/LCN
tg pregabazine MCN50.180Friedman's ANOVA
tg postgabazine MCN
GSWD duration medial vs lateral CN tg postmuscimol IN/LCN60.352Mann–Whitney U test
tg postmuscimol MCN4
tg postgabazine IN/LCN50.413Mann–Whitney U test
tg postgabazine MCN5

Corresponds to Figure 2F–G.

Statistically significant.

ANOVA = analysis of variance; CN = cerebellar nuclei; GSWD = generalized spike‐and‐wave discharge; IN = interposed nuclei; LCN = lateral cerebellar nuclei; MCN = medial cerebellar nuclei.

Data Analyses

Offline GSWD Detection

To accurately determine start and end of absence GSWDs and the locations of ECoG spikes (negative ECoG peaks during episodes of GSWDs), a custom‐written GSWD detection algorithm (LabVIEW, National Instruments, Austin, TX) was used. In short, we detected those time points in the ECoG for which the first derivative of the filtered ECoG traces (3rd order Butterworth 1Hz high pass) changed polarity. The amplitude differences between each point and both its neighbors were summed to detect fast, continuous amplitude changes and potential GSWDs with a manually set amplitude threshold. Series of GSWDs were marked when: (1) 5 threshold‐exceeding data points appeared within 1 second and (2) each of the intervals between the points was <300 milliseconds. Furthermore, we separated GSWDs by applying the following 4 rules: (1) a point is the first spike of a GSWD episode if there are no other spikes in the previous 300 milliseconds, (2) a point is the last spike of a GSWD episode if there are no other spikes in the next 350 milliseconds, (3) the inter‐GSWD episode interval is ≥1 second, and (4) the minimal GSWD duration is 1 second.

GSWD Definition

An ictal period is defined as starting at the first ECoG spike of a GSWD and ending at the last ECoG spike. Unless stated otherwise, spike‐and‐wave discharges that lasted >1 second and appeared in both M1 and S1 were considered GSWDs. An interictal period is defined as the time in between GSWDs starting 2 seconds after 1 GSWD and ending 2 seconds before the next GSWD.

Detection of Action Potentials in Extracellular Recordings

Extracellular recordings were included if activity was well isolated and held stable for >100 seconds. Action potential detection in extracellular traces was performed using threshold‐based analyses with customized MATLAB (MathWorks, Natick, MA) routines incorporating principal component analysis of the spike waveform or with the MATLAB‐based program SpikeTrain (Neurasmus, Erasmus MC Holding, Rotterdam, the Netherlands).

GSWD‐Related Firing Pattern Modulation

A custom‐written algorithm in LabVIEW was used to assess whether CN neurons showed GSWD‐modulated firing patterns during GSWDs in the ECoG of the contralateral primary sensory cortex (in the case of medial CN neurons) or primary motor cortex (in the case of interposed or lateral CN neurons). The minimum duration per episode was set at 2 seconds to construct GSWD‐triggered raster plots and peri‐GSWD time histograms (PSTHs) with a 5‐millisecond bin width, which allowed us to determine: (1) modulation amplitude: the amplitude difference between the peak and trough near t = 0; (2) modulation frequency: frequency of the sine wave that fits the PSTH best; and (3) mean power at GSWD frequency: a fast Fourier transform (fft) between 6 and 9Hz (GSWD frequency range). Next, the interspike intervals (ISIs) used for this PSTH were randomly shuffled 500 times and converted into a new PSTH with 5‐millisecond bin width to create normal distributions of modulation amplitude and mean power at GSWD frequency. Z scores were calculated for the real and shuffled data by applying: Z = (X − µ)/σ, where X = the value based on the original PSTH, µ = the mean of the bootstrapped normal distribution, and σ = its standard deviation (SD). Cells were identified as GSWD modulated if: (1) the modulation amplitude was significantly higher than expected by chance (Z ≥ 1.96, p ≤ 0.05), (2) the cell modulated at GSWD frequency (6–9Hz), and (3) the mean power at GSWD frequency was significantly higher than expected by chance (Z ≥ 1.96, p ≤ 0.05). Because all CN neurons that showed significant Z scores of mean power at GSWD frequency also showed significantly higher modulation amplitudes, the former was used for further analyses. The term Z score refers to mean power at GSWD frequency unless stated otherwise.

Coherence

To determine the spectral coherence between the activity of a CN neuron and the ECoG signal during GSWDs, a custom‐written MATLAB routine was used. The extracellular signal was time‐binned at 1‐millisecond precision, convolved with a sinc(x)‐kernel (cutoff frequency = 50Hz) and downsampled to 290 Hz. The ECoG signal was directly downsampled to 290 Hz. The magnitude squared coherence was calculated per GSWD episode using Welch's averaged, modified periodogram method and is defined as: C with the following parameters: window = 290 (Hamming), noverlap = 75%, length of fft (nfft) = 290, sampling frequency = 290 (due to the window size, only GSWDs > 1.5 seconds were considered). The coherence value per GSWD was defined as the maximum coherence in the 6 to 9Hz frequency band; a weighted average per cell based on GSWD duration was used.

Firing Pattern Parameters

Firing patterns parameters were assessed using custom‐written LabVIEW‐based programs calculating firing frequency, coefficient of variation (CV) of ISIs = σISI/µISI, CV2 = 2|ISI − ISI|/(ISI + ISI), and burst index = number of action potentials within bursts/total number of action potentials in a recording, where a burst is defined as ≥3 consecutive action potentials with an ISI ≤ 10 milliseconds. CV reports regularity of firing throughout the whole recording and CV2 quantifies the regularity of firing on a spike‐to‐spike basis.38 Firing pattern parameters were specifically calculated for ictal and interictal periods.

Regression Analyses of Interictal CN Activity

To evaluate whether there is a type of CN neuron that is predisposed for ictal phase‐locking during GSWDs, we analyzed the neurons’ interictal activity using a custom‐made MATLAB routine, aiming to probe the predictability of the ictal activity. We used Gaussian process regression,39 which is considered to be among the best nonlinear regression methods, to determine whether the GSWD modulation of the activity was predictable from the interictal activity of the neurons. The measures that enabled the prediction of the modulation amplitude most accurately were CV, log‐interval entropy, firing frequency, and permutation entropy. The interictal parts of the extracellular recordings were divided into 1‐second bins. To calculate the log‐interval entropy, in which entropy measures the predictability of a system, first a natural logarithm of the intervals, in milliseconds, was taken to construct a histogram with a bin width of 0.02 log (time). Furthermore, a Gaussian convolution was performed using a kernel of one‐sixth SD of the log(ISIs). The entropy of the ISI histogram p(I was calculated by: Furthermore, we analyzed the permutation entropy, which is calculated as the predictability of the order of neighboring ISIs rather than the actual values of the ISIs.40

Normalized GSWD Occurrence and Duration

GSWDs were detected using the offline ECoG detection algorithm described above. Total number of GSWDs and average GSWD duration were calculated and normalized to baseline values.

Assessment of Cellular Responses to Optogenetic Stimulation

Action potentials were detected as described above. A custom‐written LabVIEW program was used to construct light‐triggered raster plots and peri–stimulus time histograms with a 5‐millisecond bin width. Changes in CN neuronal firing rate upon optical stimulation were subsequently determined by calculating the total number of action potentials during light pulses divided by the total length of the pulse and compared with the baseline firing rate (calculated from the total recording time excluding the optogenetic stimulation). In the current study, we consider differences in action potential firing rate exceeding 25% as responsive.

Assessment of Impact of Optogenetic cerebellar output Stimulation on GSWDs

The start and end of seizures were identified using the offline GSWD detection method described above. A custom‐written LabVIEW program was used to assess the effectiveness of optogenetic stimulation in stopping GSWDs. Only light pulses triggered prior to the natural end of the seizure were used for analysis. The time difference between the light pulse and the end of the seizure was calculated. The seizure was considered "stopped by the optogenetic stimulation" when this time difference did not exceed 150 milliseconds. Mean power at GSWD frequency (6–9Hz) was calculated using FFT of the ECoG signal recorded during 1‐second or 0.5‐second (in the case of closed‐loop optogenetic stimulation) time periods before and after the light pulse. Averaged responses to light pulses are represented per animal and per stimulus condition by averaging complex Morlet wavelets of 4‐second windows ranging from 2 seconds before to 2 seconds after the stimulus.

Assessment of Onset of Optical Cerebellar Nuclei Stimulation relative to GSWD Cycle

The time difference between the onset of stimulation and the last spike before stimulation was calculated and divided by the median length of 1 GSWD during that episode, representing 1 cycle of 360°. The outcome was subsequently multiplied by 360. Note that the optogenetic stimuli were not initiated with a fixed delay after the occurrence of an ECoG spike; the delay depended on the visual interpretation and reaction speed of the experimenter (for manual activation of the LED) or on the closed‐loop detection system for which the delay depends on the variability of the ECoG directly prior to the GSWDs (see below and van Dongen et al41).

Closed‐Loop GSWD Detection

The GSWD detection system has been implemented using a real‐time, digital wavelet‐filter setup. The analog pre‐filter used for digitization has 4 functions: (1) amplification, (2) offset injection to match the signal to the input range of the analog to digital converter (ADC), (3) artifact removal by using a second‐order 0.4Hz high‐pass filter, and (4) antialiasing by means of a second‐order 23.4Hz low‐pass filter. The filter is realized using discrete components on a prototype printed circuit board (PCB). Following the PCB, the wavelet filter functionality is implemented on a TI Sitara AM335x ARM microprocessor (Texas Instruments, Dallas, TX). It first digitizes the signal from the analog filter with its integrated ADC using a sampling frequency of 100Hz. Subsequently the signal is filtered using a wavelet filter and the GSWD episode is detected using signal thresholding. Upon detection an output LED is switched on to stimulate the target area in the cerebellum. Wavelet filters have previously been successfully applied for real‐time GSWD detection.42 Here we applied a complex Morlet wavelet at 6.7Hz that resembled a GSWD. The wavelet filter was implemented as a finite impulse response filter by truncating the ideal complex Morlet wavelet as described earlier.43 Using the 2 thresholds that are set manually during a recording session, the GSWDs are detected during a positive, high‐threshold crossing and the detection is ended upon a negative, low‐threshold crossing.

Statistical Analyses

Statistical differences in firing pattern parameters between independent groups of CN neuronal recordings (eg, from tg mice, their wild‐type littermates, GSWD‐modulated and non–GSWD‐modulated, before and after gabazine injection) were determined using multivariate analyses of variance (MANOVAs) with firing frequency, CV, CV2, and burst index as dependent variables and group as independent variable. When a MANOVA showed a significant result, post hoc analyses of variance (ANOVAs) were used to assess contributions of individual firing pattern parameters with Bonferroni corrected p‐values. Differences in coherence value between GWSD‐modulated and non–GWSD‐modulated cells were assessed using unpaired samples t tests. Cochran and Cox adjustment for the standard error of the estimate and the Satterthwaite adjustment for the degrees of freedom were used because equality of variances was not assumed. Differences in normalized number of GSWD episodes and their duration between traces pre‐ and postinjection of either muscimol, gabazine, or saline were tested by using nonparametric Friedman ANOVAs with 1 within‐subjects factor (ie, time period) with 2 levels (baseline and postinjection). Differences in mean power at 6 to 9Hz before and after a light pulse were tested using values from all individual pulses by use of repeated measures analysis of covariance (ANCOVA) with 1 within‐subjects factor (ie, period) with 2 levels (before and after light pulse) and mouse number added as covariate to correct for variance in the within‐subject factor explained by variance between mice. To test whether the time difference between the last ECoG spike before optogenetic stimulation and the subsequent spike deviates from the median interval between 2 ECoG spikes in "stopped seizures," a similar statistical approach was used. A repeated measures ANCOVA was used with 1 within‐subject factor with 2 levels, both and ECoG spike intervals. Mouse number was again added as covariate. Because the number of seizures not terminated by the optogenetic stimulation was low, a nonparametric Friedman ANOVA was used to test the same difference. To determine whether the phase angle of the optogenetic stimulation onset was related to the success rate of stopping GSWDs, we compared the phase angle distribution of successful attempts to that of the unsuccessful attempts. We tested for significant differences between these distributions using the nonparametric 2‐sample Kuiper test. A p‐value ≤ 0.05 (α) was considered significant unless Bonferroni correction was used; in that case, a p‐value of α/n was considered significant. Two‐tailed testing was used for all statistical analyses and all were performed using SPSS 20.0 software (IBM, Armonk, NY). Exact information and outcomes regarding statistical testing are depicted in Tables 1 to 7. CN Action Potential Firing Corresponds to Figure 1.
Figure 1

Cerebellar nuclei (CN) neuronal action potential firing patterns are modulated during generalized spike‐and‐wave discharges (GSWDs). (A) Schematic of recording sites for electrocorticogram (ECoG) from primary motor (M1) and sensory (S1) cortices and extracellular single unit CN neuronal (CNN) recordings (Th = thalamus, hpc = hippocampus). (B) ECoG from M1 and S1 with GSWD episodes (horizontal lines), indicating absence seizures. (C) Zoom of M1 episode outlined in B and simultaneously recorded action potential firing of a single CN neuron. (D; top panel) Zoom of outlined M1 and CNN recording in C. Red lines align ECoG spike with pause in CNN action potential firing. Bottom panel: Compass plot of phase difference between ECoG spike and modulated CNN action potential firing. IN = interposed nuclei; LCN = lateral CN; MCN = medial CN. (E) Raster plot and accompanying peri–spike‐and‐wave discharge time histogram of CNN action potentials (AP) for 3 consecutive seizures (t = 0 is aligned with each ECoG spike). (F) Distribution of absolute Z scores of mean power at GSWD frequency as determined by fast Fourier transform for MCN, IN, and LCN. Note that none of the negative Z scores was below −1.96, and therefore showing absolute Z scores does not change the number of data points below and above the 1.96 cutoff score (corresponding to p < 0.05; horizontal dashed line). Total number of recorded neurons: MCN, n = 100; IN, n = 67; LCN, n = 43. (G) Bar plots representing firing frequency, coefficient of variation, coefficient of variation 2 (CV2), and burst index for CN neurons recorded in wild‐type littermate (n = 94; black) and seizure‐modulated (n = 103; light gray) and non‐modulated CN neurons recorded in tg (n = 107; dark gray). For clarity, we truncated the negative error bars. **p < 0.01, ***p < 0.001 (multivariate analysis of variance, post hoc analyses of variance with Bonferroni correction; see Table 1). (H) Result of the Gaussian process regression to predict the Z score from interictal activity parameters (CV, firing frequency, log‐interval entropy, and permutation entropy) represented as a confusion matrix. The prediction is characterized as being a true positive (tp) when the predicted Z score is >1.96 (dotted line) and the actual Z score is >1.96. A true negative (tn) is scored when both predicted and actual Z scores are <1.96. False positive (fp) and false negative (fn) refer to neurons that have been incorrectly predicted as GSWD modulated and GSWD non‐modulated, respectively. Note that we were able to achieve a precision of 0.70 and a recall of 0.94, which means that 70% of CN neurons (n = 210) that were predicted as GSWD modulated actually were GSWD modulated, and 94% of all GSWD‐modulated neurons have been identified correctly by the model. The Pearson correlation coefficient (r) between the predicted Z score and the actual Z score was 0.56 with p ≤ 0.05.

Statistically significant. ANOVA = analysis of variance; CN = cerebellar nuclei; GSWD = generalized spike‐and‐wave discharge; IN = interposed nuclei; LCN = lateral cerebellar nuclei; MANOVA = multivariate analysis of variance; MCN = medial cerebellar nuclei.

Results

GSWD‐Related CN Neuronal Activity

We first investigated whether CN neuronal activity and ECoG were correlated during spontaneous episodes of GSWDs in awake head‐fixed homozygous tg mice (Fig 1). We found no significant differences in GSWD occurrence (t 24 = −0.002, p = 0.998) and GSWD duration (t 24 = 0.195, p = 0.847) between male and female tg mice, which is in line with data from other experimental animal models of absence epilepsy (reviewed by van Luijtelaar et al44). Therefore, we grouped data of both genders. GSWDs appeared simultaneously in bilateral primary motor (M1) and sensory cortices (S1) at 7.6 ± 0.6Hz with an average duration of 3.6 ± 1.4 seconds (n = 17 mice). The GSWD frequency and appearance were comparable to earlier reports of awake tg and other rodent models of absence epilepsy.30, 32, 34, 45 During these GSWDs, action potential firing of a subset of CN neurons was phase‐locked to GSWDs. A typical GSWD‐modulated CN neuron showed oscillatory action potential firing at GSWD frequency; repetitive firing was observed during the wave in the ECoG, whereas the spike was accompanied by a pause in CN neuronal activity. These GSWD‐modulated CN neurons showed significantly increased coherence with ECoG during seizures (p ≤ 0.001; see Table 1). In each CN type (MCN, IN, and LCN), a substantial portion of the recorded CN neurons showed GSWD‐modulated firing, with the highest percentage (73%; 49 of 67 neurons) in the IN and 35% (35 of 100 neurons) and 44% (19 of 43 neurons) in the MCN and LCN, respectively. We found no statistical difference (p = 0.512) in the phase of modulation of neuronal firing relative to the GSWD cycle for these 3 nuclei. Optogenetic stimulation of cerebellar nuclei reliably stops generalized spike‐and‐wave discharges (GSWDs). (A) Confocal image of sagittal brain section showing channelrhodopsin‐2 (ChR2) expression in cerebellar nuclei (CN) with projections to the thalamus (M1, S1 represent primary motor and sensory cortex, respectively). (B) Representative electrocorticogram (ECoG) of bilateral M1 (left M1 [lM1], right [rM1], and left S1 [lS1] recording), which exemplifies how bilateral optogenetic stimulation (470nm light pulse of 100 milliseconds indicated by the vertical blue bar) stops GSWDs in all recorded cortices. (C) Mean ECoG wavelet spectrogram of contralateral M1 for all bilateral (n = 25; left panel) and unilateral stimuli (n = 11; right panel) presented to a single mouse at 470nm. (D) As in C for (left) 590nm stimuli (n = 36) and (right) stimulation at 470nm outside of CN (n = 18). (E; right) Typical example of the effect of bilateral closed‐loop stimulation on GSWD recorded in contralateral M1 and S1 and (left) mean ECoG wavelet spectrogram of all unilateral stimuli (n = 44) presented to 1 mouse. (F) ECoG theta‐band power before and after open‐loop (bilateral: 3 females, 1 male, n = 178; unilateral: 3 female, n = 43) stimulations with the wrong wavelength (590nm; 3 females, n = 107) and stimulations outside the CN (3 females; n = 185) as well as the responses to closed‐loop stimulation at 470nm in the CN (bilateral: 3 females, n = 227; unilateral: 3 females, n = 49). ***p < 0.001 (repeated measures analysis of covariance; see Table 5).
Table 5

Effect of Optogenetic CN Stimulation on GSWD‐Related Power

Tested DataCompared Groups N p F‐valueStatistical Test
Open‐loop bilateral 470nm tg prestimulation178<0.001a F(1,176) = 74.87Repeated measures ANCOVA
tg poststimulation
Open‐loop unilateral 470nm tg prestimulation43<0.001a F(1,41) = 35.25Repeated measures ANCOVA
tg poststimulation
590nm tg prestimulation1070.367 F(1,65) = 0.82Repeated measures ANCOVA
tg poststimulation
470nm outside CN tg prestimulation1850.283 F(1,65) = 1.16Repeated measures ANCOVA
tg poststimulation
Closed‐loop bilateral 470nm tg prestimulation227<0.001a F(1,65) = 456.3Repeated measures ANCOVA
tg poststimulation
Closed‐loop unilateral 470nm tg prestimulation49<0.001a F(1,65) = 97.58Repeated measures ANCOVA
tg poststimulation

Corresponds to Figure 3.

Statistically significant.

ANCOVA = analysis of covariance; CN = cerebellar nuclei; GSWD = generalized spike‐and‐wave discharge.

To assess whether GSWD‐modulated CN neurons differed from non‐modulating CN neurons in baseline activity, we compared their interictal firing patterns. During interictal periods GSWD‐modulated CN neurons showed a higher firing frequency and a more irregular, burstlike firing pattern compared with non‐modulated neurons (p‐values < 0.01), and both modulated and non‐modulated groups showed a more irregular firing pattern and increased burst index compared to CN neurons recorded from wild‐type littermates (p‐values < 0.01; see Fig 1G, Table 1). Gaussian process regression39 revealed that in tg mice interictal CN neuronal firing was correlated with the ictal firing pattern; 94% of neurons that phase‐locked their activity to GSWDs could be predicted correctly, based on their interictal firing pattern (see Fig 1H). These data indicate that a large subset of neurons within each CN consistently shows seizure‐modulated activity, that is, that these GSWD‐modulated CN neurons are different from non‐modulated neurons in basic, interictal firing patterns and that GSWD‐related modulation can be predicted based on these interictal firing patterns.

Impact on GSWD Occurrence of Pharmacological Interventions That Modulate CN Action Potential Firing

CN neurons provide excitatory input to thalamic neurons4, 6, 23, 24, 25, 26, 27, 28, 29 and thereby potentially contribute to the excitation–inhibition balance that sets thalamic activity patterns. Excess tonic inhibition of thalamic activity has been linked to the occurrence of absence seizures,3, 7, 8 and therefore we hypothesized that a decrease in CN output in tg should increase the occurrence of GSWDs, whereas increased CN output should have the opposite effect. To test this, we locally applied (see Fig 2, Supplementary Fig) either GABAA‐agonist muscimol, which stopped CN neuronal action potential firing (no statistical comparison was possible due to complete cessation of action potential firing), or GABAA‐antagonist gabazine (SR‐95531), which consistently increased the frequency (p < 0.01) and regularity of CN neuronal firing (p < 0.001; see Table 2). Upon bilateral CN injections with muscimol, the occurrence of GSWDs increased by 160 to 3,700% postinjection (p < 0.01; recorded for 60 minutes; peak of seizure occurrence 34.5 ± 16.5 minutes after injection; n = 10). In contrast, bilateral CN injections with gabazine significantly reduced the occurrence of GSWDs (p < 0.05; first seizure occurred 32.5 ± 17.4 minutes after injection; n = 10) and bilateral sham injections did not change GSWD occurrence (p = 0.18). The duration of GSWDs was not significantly changed following muscimol, gabazine, or saline injections in the CN (muscimol: p = 0.21; gabazine: p = 0.32; saline: p = 0.41). As a control, we also injected similar quantities of gabazine or muscimol into the cerebellar cortex; this had no significant effect on the GSWD occurrence (p = 0.66 and 0.32, respectively) or duration (p = 0.66 for both gabazine and muscimol injections). Thus, pharmacological manipulation of neuronal activity in the CN, but not the cerebellar cortex, is highly effective in modulating the occurrence of GSWDs in tg mice. Notably, we observed that muscimol and gabazine were most effective when the injections were in the IN and/or LCN (no statistical difference in impact on GSWD‐occurrence after IN and/or LCN injections; p = 0.70; Mann–Whitney U test) compared to injections in the MCN (p = 0.07 for muscimol and p < 0.05 for gabazine; see Supplementary Fig, Table 3). To study whether these differences in impact of pharmacological interventions aimed at the MCN or the IN and LCN were due to a variable effect on neuronal activity, we also performed single unit recordings in the injected CN. Regardless of the injected nucleus, muscimol effectively silenced all action potential firing and gabazine consistently increased the firing frequency and the regularity of action potential firing (all p‐values < 0.01 for firing frequency, CV, and CV2; see Table 4). These findings indicate that although effects of muscimol and gabazine on the neuronal activity were similar throughout all CN, the effect of manipulating activity in the IN and LCN seems to exert a larger impact on GSWD‐occurrence in the mutants than targeting the MCN. Instead, pharmacological interventions in the CN of wild‐type littermates (n = 2) did not evoke GSWD‐episodes (data not shown).
Figure 2

Bimodal modulation of generalized spike‐and‐wave discharge (GSWD) occurrence by pharmacological manipulation of cerebellar nuclei (CN) neuronal (CNN) action potential firing. (A) Confocal image of coronal cerebellar slice with bilateral muscimol injections (blue = 4′,6‐diamidino‐2‐phenylindole (DAPI); red = Evans blue indicating the injection sites; IN = interposed nucleus; IV = 4th ventricle; LCN = lateral CN; MCN = medial CN). (B) Examples of CNN recordings before and after bilateral muscimol (top) and gabazine (bottom) injections. (C) Bar plots for the impact of gabazine on CNN firing as quantified by the difference between pre‐ and postgabazine injections (n = 81 and n = 55, respectively) in firing frequency, coefficient of variation, median CV2, and burst index; **p < 0.01, ***p < 0.001 (multivariate analysis of variance, post hoc analyses of variance [ANOVAs] with Bonferroni corrections; see Table 2). (D; top) Representative electrocorticogram (ECoG) of primary motor cortex (M1) ECoG before and after muscimol injection; (bottom) representative M1 ECoG before and after gabazine injection. (E) Time course of the effects of muscimol (left) and gabazine (right) on the average number of GSWD episodes (bin size = 5 minutes). (F, G) Normalized number of seizures (F) and normalized seizure duration (G) before and after muscimol (left) and gabazine (right) injections (1 hour each) for bilateral injections in all CN (n = 10 for both gabazine and muscimol), in IN/LCN (n = 6 for muscimol and 5 for gabazine), and in MCN (n = 4 for muscimol and 5 for gabazine). Note that for quantification of the seizure duration after gabazine injection, only 9 mice are included in all CN and 4 mice in the IN/LCN group, because 1 mouse did not show any GSWDs postinjection. Blue dots indicate data recorded from male mice and red dots from female. *p < 0.05, **p < 0.01 (Friedman ANOVAs and Mann–Whitney U tests; see Tables 2 and 3). (H) Normalized number of GSWD episodes (left) and normalized GSWD episode duration (right) for control experiments; saline injections in the CN and muscimol and gabazine injections in superficial cerebellar cortical areas.

Table 4

Impact of Local Pharmacological Manipulations on CN Spiking Activity

Tested DataCompared Groups N p F‐valueStatistical Test
Overall tg pregabazine IN/LCN40<0.001a F(4,62) = 12.41MANOVA (Pillai's trace)
tg postgabazine IN/LCN27
Firing frequency tg pregabazine IN/LCN40<0.01a F(1,65) = 8.80ANOVA (Bonferroni)
tg postgabazine IN/LCN27
Coefficient of variation tg pregabazine IN/LCN40<0.001a F(1,65) = 23.18ANOVA (Bonferroni)
tg postgabazine IN/LCN27
CV2 tg pregabazine IN/LCN40<0.001a F(1,65) = 25.13ANOVA (Bonferroni)
tg postgabazine IN/LCN27
Burst index tg pregabazine IN/LCN40<0.01a F(1,65) = 10.22ANOVA (Bonferroni)
tg postgabazine IN/LCN27
Overall tg pregabazine MCN41<0.001a F(4,64) = 40.55MANOVA (Pillai's trace)
tg postgabazine MCN28
Firing frequency tg pregabazine MCN41<0.001a F(1,67) = 37.53ANOVA (Bonferroni)
tg postgabazine MCN28
Coefficient of variation tg pregabazine MCN41<0.001a F(1,67) = 60.04ANOVA (Bonferroni)
tg postgabazine MCN28
CV2 tg pregabazine MCN41<0.001a F(1,67) = 153.36ANOVA (Bonferroni)
tg postgabazine MCN28
Burst index tg pregabazine MCN410.614 F(1,67) = 0.61ANOVA (Bonferroni)
tg postgabazine MCN28
Overall tg pregabazine IN/LCN40<0.001a F(4,76) = 6.28MANOVA (Pillai's trace)
tg pregabazine MCN41
Firing frequency tg pregabazine IN/LCN400.438 F(4,79) = 0.61ANOVA (Bonferroni)
tg pregabazine MCN41
Coefficient of variation tg pregabazine IN/LCN400.037 F(4,79) = 4.51ANOVA (Bonferroni)
tg pregabazine MCN41
CV2 tg pregabazine IN/LCN400.494 F(4,79) = 0.47ANOVA (Bonferroni)
tg pregabazine MCN41
Burst index tg pregabazine IN/LCN40<0.001a F(4,79) = 13.53ANOVA (Bonferroni)
tg pregabazine MCN41
Overall tg postgabazine IN/LCN27<0.001a F(4,50) = 4.29MANOVA (Pillai's trace)
tg postgabazine MCN28
Firing frequency tg postgabazine IN/LCN270.344 F(4,53) = 0.91ANOVA (Bonferroni)
tg postgabazine MCN28
Coefficient of variation tg postgabazine IN/LCN27≤0.001a F(4,53) = 13.55ANOVA (Bonferroni)
tg postgabazine MCN28
CV2 tg postgabazine IN/LCN27<0.01a F(4,53) = 10.16ANOVA (Bonferroni)
tg postgabazine MCN28
Burst index tg postgabazine IN/LCN270.801 F(4,53) = 0.64ANOVA (Bonferroni)
tg postgabazine MCN28

Statistically significant.

ANOVA = analysis of variance; IN = interposed nuclei; LCN = lateral cerebellar nuclei; MANOVA = multivariate analysis of variance; MCN = medial cerebellar nuclei.

Impact of Pharmacological Manipulations on CN Firing and GSWD Occurrence Corresponds to Figure 2C, F–H. Statistically significant. ANOVA = analysis of variance; CN = cerebellar nuclei; CNN = CN neuronal; GSWD = generalized spike‐and‐wave discharge; MANOVA = multivariate analysis of variance. Impact of Local Pharmacological Manipulations on GSWD Occurrence Corresponds to Figure 2F–G. Statistically significant. ANOVA = analysis of variance; CN = cerebellar nuclei; GSWD = generalized spike‐and‐wave discharge; IN = interposed nuclei; LCN = lateral cerebellar nuclei; MCN = medial cerebellar nuclei. Impact of Local Pharmacological Manipulations on CN Spiking Activity Statistically significant. ANOVA = analysis of variance; IN = interposed nuclei; LCN = lateral cerebellar nuclei; MANOVA = multivariate analysis of variance; MCN = medial cerebellar nuclei. Although it has been shown that pharmacological interventions can have sex‐specific differences in animal models of epilepsy46 that may contribute to the variability of the current results, our ECoG recordings did not show a trend toward a sex‐specific impact of CN‐specific muscimol or gabazine application (see Fig 2F–H). This finding was corroborated by the finding that muscimol was equally effective in stopping CN action potential firing in both male and female mice. Together, these effects indicate that in the tg animal model of absence epilepsy CN output forms an integral component of the neuronal networks involved in generalized epilepsy and may operate as a potent modulator of GSWD occurrence, irrespective of the gender.

Optogenetic Stimulation of Cerebellar Nuclei

The promising impact of long‐lasting pharmacological interventions at the level of the cerebellar output prompted us to explore whether short‐lasting neuromodulation would be equally effective in stopping GSWDs, that is, whether disrupting oscillatory CN neuronal activity immediately stops GSWDs. To test this hypothesis, we virally expressed light‐sensitive ChR2 cation channels in CN neurons (see Fig 3). The optically evoked alteration of CN neuronal firing (see below; Fig 5A) had a robust effect on GSWD occurrence, in that most if not all episodes abruptly stopped within 150 milliseconds of the onset of bilateral stimulation (n = 4; presented per mouse: 76% [male], 84% [female], 92% [female], and 100% [female] stopped) and in that the power at GSWD frequency was significantly reduced (p < 0.001; see Fig 3, Table 5). Moreover, unilateral optical stimulation of CN neurons proved equally effective in stopping GSWDs in all recorded cortices, regardless of the laterality (n = 3 females; presented per mouse: 89%, 92%, and 100% stopped; power reduction: p < 0.001). Bilateral cerebellar stimulation was ineffective when a different wavelength (590nm) was applied (n = 3 females; presented per mouse: 0%, 0%, and 5% stopped; power reduction: p = 0.37) or when the optical fiber was placed outside the CN region (n = 3 females; presented per mouse: 0%, 5%, and 8% stopped; power reduction: p = 0.28).
Figure 3

Optogenetic stimulation of cerebellar nuclei reliably stops generalized spike‐and‐wave discharges (GSWDs). (A) Confocal image of sagittal brain section showing channelrhodopsin‐2 (ChR2) expression in cerebellar nuclei (CN) with projections to the thalamus (M1, S1 represent primary motor and sensory cortex, respectively). (B) Representative electrocorticogram (ECoG) of bilateral M1 (left M1 [lM1], right [rM1], and left S1 [lS1] recording), which exemplifies how bilateral optogenetic stimulation (470nm light pulse of 100 milliseconds indicated by the vertical blue bar) stops GSWDs in all recorded cortices. (C) Mean ECoG wavelet spectrogram of contralateral M1 for all bilateral (n = 25; left panel) and unilateral stimuli (n = 11; right panel) presented to a single mouse at 470nm. (D) As in C for (left) 590nm stimuli (n = 36) and (right) stimulation at 470nm outside of CN (n = 18). (E; right) Typical example of the effect of bilateral closed‐loop stimulation on GSWD recorded in contralateral M1 and S1 and (left) mean ECoG wavelet spectrogram of all unilateral stimuli (n = 44) presented to 1 mouse. (F) ECoG theta‐band power before and after open‐loop (bilateral: 3 females, 1 male, n = 178; unilateral: 3 female, n = 43) stimulations with the wrong wavelength (590nm; 3 females, n = 107) and stimulations outside the CN (3 females; n = 185) as well as the responses to closed‐loop stimulation at 470nm in the CN (bilateral: 3 females, n = 227; unilateral: 3 females, n = 49). ***p < 0.001 (repeated measures analysis of covariance; see Table 5).

Figure 5

Excitatory impact of optical cerebellar nuclei (CN) stimulation on cortical activity stops generalized spike‐and‐wave discharge (GSWD) episodes. (A; left panels) Peri–stimulus time histogram and raster plot indicating increased (top) or decreased (bottom) action potential (AP) firing for individual CN neurons evoked by 470nm light pulses (blue bars). Right panels: Scatterplots represent the individual changes in CN neuronal firing following optical stimulation: (left) increased firing (n = 33); (right) decreased firing (n = 17). Black and blue bars indicate mean firing frequency when the 470nm light‐emitting diode was turned off or on, respectively. (B) Examples of stopped (left) and continuing (right) GSWD episodes upon optogenetic stimulation. Black horizontal arrows represent the median time interval between electrocorticogram (ECoG) spikes, which correspond to 1 cycle of cortical oscillation, here represented as 360°. Green and red vertical arrows represent the onset of the light stimulus. (C) Rose plots of the start of successful and unsuccessful optical stimulation in the 360° GSWD cycle for both primary motor cortex (left) and primary sensory cortex (right). (D) Comparison between the median and the last interval (between the last 2 ECoG spikes) for stopped and continuing GSWD episodes. ***p < 0.001 (repeated measures ANCOVA; see Table 7). (E) Scatterplot representing the predictability of the stimulus‐related time interval between GSWDs by the phase of stimulation onset. p < 0.001 (linear regression analysis; see Table 7).

Modulation of phase‐locked cerebellar nuclei (CN) neuronal (CNN) activity stops generalized spike‐and‐wave discharges (GSWDs) in C3H/HeOuJ mice. (A) Simultaneously recorded primary motor (M1) and sensory (S1) cortex electrocorticograms (ECoGs) and CNN activity. (B) Raster plot and peri–stimulus time histogram of single CNN activity (t = 0 indicates each ECoG spike). AP = action potential; SWD = spike‐and‐wave discharge. (C) Summary bar plots representing the mean differences in firing pattern parameters between interictal and ictal periods (n = 28). ***p < 0.001 (repeated measures analysis of variance [ANOVA] with Bonferroni corrections; see Table 6). (D) Representative M1 ECoG before and after muscimol injection and (E) corresponding normalized seizure occurrence and duration. *p < 0.05 (Friedman ANOVA; see Table 6). (F–H) Open‐loop (top) and closed‐loop (bottom) optogenetic stimulation stops GSWDs as shown by: (F) typical example trace; (G) ECoG wavelet spectrogram averaged over all bilateral open‐loop (n = 11; top panel) stimuli in a single mouse and over all unilateral closed‐loop stimuli (n = 18; bottom panel) in another mouse; and (H) ECoG theta‐band power before and after optical stimulation for bilateral open‐loop stimuli (n = 3 mice, n = 19 stimulations; top left panel), unilateral open‐loop stimuli (n = 3 mice, n = 19 stimulations), bilateral closed‐ loop stimuli (n = 3 mice, n = 46 stimulations), and unilateral closed‐loop stimuli (n = 3 mice, n = 30 stimulations). *p < 0.05, **p < 0.01 ***p < 0.001 (repeated measures ANCOVA; see Table 6).
Table 6

Neuronal Firing and Effect of CN Manipulations on GSWD Occurrence

Tested DataCompared Groups N p t or F‐valueStatistical Test
Differences in CN neuronal action potential firing
Coherence C3H/HeOuJ GSWD‐modulated28<0.001a t(66.6) = 5.92Independent samples t test
C3H/HeOuJ non‐modulated51
Firing frequency C3H/HeOuJ GSWD‐modulated ictal280.138 F(1,27) = 2.34Repeated measures ANOVA (Bonferroni)
C3H/HeOuJ GSWD‐modulated interictal
Coefficient of variation C3H/HeOuJ GSWD‐modulated ictal280.708 F(1,27) = 0.14Repeated measures ANOVA (Bonferroni)
C3H/HeOuJ GSWD‐modulated interictal
CV2 C3H/HeOuJ GSWD‐modulated ictal28<0.001a F(1,27) = 21.35Repeated measures ANOVA (Bonferroni)
C3H/HeOuJ GSWD‐modulated interictal
Burst index C3H/HeOuJ GSWD‐modulated ictal28<0.001a F(1,27) = 15.64Repeated measures ANOVA (Bonferroni)
C3H/HeOuJ GSWD‐modulated interictal
Effects of pharmacological manipulations of CN neurons on GSWDs
GSWD occurrence C3H/HeOuJ premuscimol4<0.05a Friedman's ANOVA
C3H/HeOuJ postmuscimol
GSWD duration C3H/HeOuJ premuscimol40.317Friedman's ANOVA
C3H/HeOuJ postmuscimol
Effects of optogenetic CN stimulation on GSWD‐related power
Open‐loop bilateral 470nm C3H/HeOuJ prestimulation37<0.01a F(1,35) = 8.17Repeated measures ANCOVA
C3H/HeOuJ poststimulation
Open‐loop unilateral 470nm C3H/HeOuJ prestimulation19<0.001a F(1,17) = 20.32Repeated measures ANCOVA
C3H/HeOuJ poststimulation
590nm in CN C3H/HeOuJ prestimulation470.809 F(1,45) = 0.06Repeated measures ANCOVA
C3H/HeOuJ poststimulation
470nm outside CN C3H/HeOuJ prestimulation560.425 F(1,54) = 0.65Repeated measures ANCOVA
C3H/HeOuJ poststimulation
Closed‐loop bilateral 470nm C3H/HeOuJ prestimulation46<0.001a F(1,44) = 14.20Repeated measures ANCOVA
C3H/HeOuJ poststimulation
Closed‐loop unilateral 470nm C3H/HeOuJ prestimulation30<0.05a F(1,28) = 4.60Repeated measures ANCOVA
C3H/HeOuJ poststimulation

Corresponds to Figure 4.

Statistically significant.

ANCOVA = analysis of covariance; ANOVA = analysis of variance; CN = cerebellar nuclei; GSWD = generalized spike‐and‐wave discharge.

Effect of Optogenetic CN Stimulation on GSWD‐Related Power Corresponds to Figure 3. Statistically significant. ANCOVA = analysis of covariance; CN = cerebellar nuclei; GSWD = generalized spike‐and‐wave discharge. The type of seizure detection and on‐demand stimulation described above renders the procedure conceptually unsuitable for clinical implementation in that it would require constant online evaluation and decision making by medics.47 Therefore, we developed a brain–machine interface (BMI) approach by engineering a closed‐loop system for online detection of GSWDs and subsequent optogenetic stimulation.41 Using offline analysis, we optimized the performance of a wavelet‐based GSWD detection filter up to an accuracy of 96.5% and a median latency of 424 milliseconds. When applied online, this on‐demand, closed‐loop stimulation proved efficient in detecting and stopping GSWDs; bilateral optical stimulation of ChR2‐expressing CN neurons stopped 93.4% of GSWDs and unilateral stimulation stopped 91.8% of GSWDs, which is also represented by the GSWD frequency power reduction (n = 3 female; p < 0.001; see Fig 3E, F, Table 5). Together, these data highlight that in a clinically applicable BMI setting single pulse stimulation of CN neurons suffices to stop GSWDs and that unilateral stimulation is sufficiently powerful to disrupt bilateral thalamocortical oscillations.

Key Findings Are Replicated in an Unrelated Mouse Model of Absence Epilepsy

To exclude the possibility that our current findings in tg are unique to their pathophysiology,30, 48, 49 we repeated key experiments in C3H/HeOuJ, an inbred strain with an absence epilepsy phenotype33 that is unrelated to tg. Extracellular recordings in awake ECoG‐monitored C3H/HeOuJ mice confirmed that a smaller but substantial portion (35%) of CN neurons showed phase‐locked action potential firing and significant coherence with ECoG (p < 0.001) during GSWDs and that this oscillatory firing was more irregular than their interictal firing pattern (p < 0.001; Fig 4, Table 6). Similar to tg mutants (see Fig 2), C3H/HeOuJ mice showed significantly more seizures following local muscimol injections into CN (p < 0.05; see Fig 4, Table 6). Moreover, also in C3H/HeOuJ mice optogenetic stimulation reliably stopped GSWD episodes (n = 3; presented per mouse: 82%, 87%, and 91% stopped) and both bilateral and unilateral stimuli significantly reduced power at GSWD frequency (p < 0.01 and p < 0.001, respectively); the closed‐loop detection and intervention system reduced the GSWD frequency power (p < 0.001 for bilateral and p < 0.05 for unilateral stimulation); and neither optical stimulation at 590nm nor stimulation outside of CN significantly reduced the GSWD frequency power (p = 0.43 and p = 0.81, respectively). Thus, the main findings from CN treatment of absence seizures in tg could be replicated in C3H/HeOuJ mutants.
Figure 4

Modulation of phase‐locked cerebellar nuclei (CN) neuronal (CNN) activity stops generalized spike‐and‐wave discharges (GSWDs) in C3H/HeOuJ mice. (A) Simultaneously recorded primary motor (M1) and sensory (S1) cortex electrocorticograms (ECoGs) and CNN activity. (B) Raster plot and peri–stimulus time histogram of single CNN activity (t = 0 indicates each ECoG spike). AP = action potential; SWD = spike‐and‐wave discharge. (C) Summary bar plots representing the mean differences in firing pattern parameters between interictal and ictal periods (n = 28). ***p < 0.001 (repeated measures analysis of variance [ANOVA] with Bonferroni corrections; see Table 6). (D) Representative M1 ECoG before and after muscimol injection and (E) corresponding normalized seizure occurrence and duration. *p < 0.05 (Friedman ANOVA; see Table 6). (F–H) Open‐loop (top) and closed‐loop (bottom) optogenetic stimulation stops GSWDs as shown by: (F) typical example trace; (G) ECoG wavelet spectrogram averaged over all bilateral open‐loop (n = 11; top panel) stimuli in a single mouse and over all unilateral closed‐loop stimuli (n = 18; bottom panel) in another mouse; and (H) ECoG theta‐band power before and after optical stimulation for bilateral open‐loop stimuli (n = 3 mice, n = 19 stimulations; top left panel), unilateral open‐loop stimuli (n = 3 mice, n = 19 stimulations), bilateral closed‐ loop stimuli (n = 3 mice, n = 46 stimulations), and unilateral closed‐loop stimuli (n = 3 mice, n = 30 stimulations). *p < 0.05, **p < 0.01 ***p < 0.001 (repeated measures ANCOVA; see Table 6).

Excitatory impact of optical cerebellar nuclei (CN) stimulation on cortical activity stops generalized spike‐and‐wave discharge (GSWD) episodes. (A; left panels) Peri–stimulus time histogram and raster plot indicating increased (top) or decreased (bottom) action potential (AP) firing for individual CN neurons evoked by 470nm light pulses (blue bars). Right panels: Scatterplots represent the individual changes in CN neuronal firing following optical stimulation: (left) increased firing (n = 33); (right) decreased firing (n = 17). Black and blue bars indicate mean firing frequency when the 470nm light‐emitting diode was turned off or on, respectively. (B) Examples of stopped (left) and continuing (right) GSWD episodes upon optogenetic stimulation. Black horizontal arrows represent the median time interval between electrocorticogram (ECoG) spikes, which correspond to 1 cycle of cortical oscillation, here represented as 360°. Green and red vertical arrows represent the onset of the light stimulus. (C) Rose plots of the start of successful and unsuccessful optical stimulation in the 360° GSWD cycle for both primary motor cortex (left) and primary sensory cortex (right). (D) Comparison between the median and the last interval (between the last 2 ECoG spikes) for stopped and continuing GSWD episodes. ***p < 0.001 (repeated measures ANCOVA; see Table 7). (E) Scatterplot representing the predictability of the stimulus‐related time interval between GSWDs by the phase of stimulation onset. p < 0.001 (linear regression analysis; see Table 7).
Table 7

Effect of Optogenetic CN Stimulation on ECoG

Tested DataCompared Groups N p F or t‐valueStatistical Test
Effects of optogenetic CN stimulation on the time interval between ECoG spikes in M1
Stopped seizuresMedian interval153<0.001a F(1,151) = 99.80Repeated measures ANCOVA
Stimulus‐related interval
Continuing seizuresMedian interval250.088Friedman's ANOVA
Stimulus‐related interval
Effects of optogenetic CN stimulation on the time interval between ECoG spikes in S1
Stopped seizuresMedian interval153<0.01a F(1,151) = 7.22Repeated measures ANCOVA
Stimulus‐related interval
Continuing seizuresMedian interval250.201Friedman's ANOVA
Stimulus‐related interval
Predictability of stimulus‐related time interval by phase of stimulation onset
Stopped seizures153<0.001a t(152) = 3.87Linear regression

Corresponds to Figure 5.

Statistically significant.

ANCOVA = analysis of covariance; ANOVA = analysis of variance; CN = cerebellar nuclei; ECoG = electrocorticogram.

Neuronal Firing and Effect of CN Manipulations on GSWD Occurrence Corresponds to Figure 4. Statistically significant. ANCOVA = analysis of covariance; ANOVA = analysis of variance; CN = cerebellar nuclei; GSWD = generalized spike‐and‐wave discharge.

Optogenetic Stimulation of Presumptively Excitatory CN Neurons Affects GSWDs

To investigate the mechanism underlying the potent interruption of GSWDs by optogenetic stimulation of CN in tg and C3H/HeOuJ, we quantified the responses of CN neurons to bilateral optical stimulation. In C3H/HeOuJ and tg injected with AAV2‐hSyn‐ChR2(H134R)‐EYFP, 33 of 50 responsive cells (66%) showed increased action potential firing, whereas 17 (34%) showed decreased firing (see Fig 5A). A further 16 recorded neurons showed no response to optical stimulation. This variety of responses is in line with the properties of the construct that was used to transfect CN neurons with ChR2. Because human synapsin (hSyn) is not specific to a certain type of neuron,50 both excitatory and inhibitory CN neurons expressed ChR2. Excitatory responses can be recorded from neurons that express ChR2, and inhibitory responses can be recorded from neurons that do not express ChR2 but that receive input from ChR2‐positive inhibitory neurons, but neurons devoid of ChR2 expression either in their membrane or synaptic afferents will not show any response. Next, we questioned to what extent the impact of optogenetic stimulation of CN neuronal action potential firing depends on the phase of the thalamocortical oscillations, that is, to what extent the disruption of GSWD‐modulated CN firing was evoked during cortical excitation (the ECoG spike) and/or cortical inhibition (the ECoG wave).51 Because we did not design our stimulation protocol to be activated with a fixed delay relative to the GSWDs, we could answer this question by comparing the phase values of the onset of effective stimuli relative to the spike‐and‐wave cycle in M1 and S1 cortices with those of ineffective stimuli (see Fig 5). For both M1 and S1, success rates were lowest when the stimulus was applied up to 60° before the peak of a spike (ie, 300°–360° in Fig 5C lower panels), but the overall differences of these distributions did not reach statistical significance (M1: p = 0.13; S1: p = 0.29). However, effective stimuli evoked a significant shortening (p < 0.01) of the interval between the last 2 ECoG spikes, which is indicative of an excitatory effect on cortical activity (Fig. 5D),51 and the timing of the last ECoG spike could be predicted by the time of the stimulus onset relative to the spike‐and‐wave cycle (p < 0.001; see Fig 5E, Table 7). Together, our combined electrophysiological and optogenetic data indicate that optogenetic CN stimulation is most effective when applied during the "wave" of the GSWD, during which cortical neurons are normally silent. Effect of Optogenetic CN Stimulation on ECoG Corresponds to Figure 5. Statistically significant. ANCOVA = analysis of covariance; ANOVA = analysis of variance; CN = cerebellar nuclei; ECoG = electrocorticogram.

Discussion

In this study, we show that in 2 unrelated mouse models of absence epilepsy the activity of CN neurons can be utilized to modulate the occurrence of GSWDs. We provide evidence that pharmacological interventions at the level of CN can exert slow, but long‐term, effects and that optogenetic stimulation of CN neurons can exert fast, short‐term control. The different dynamics of these experimental approaches, with converging outcomes, align with the hypothesis that CN neurons can control the balance of excitation and inhibition in the thalamus, thereby resetting the oscillatory activity in thalamocortical loops. In both tg and C3H/HeOuJ strains of mice, a substantial subset of CN neurons showed phase‐locked action potential firing during GSWDs, which is in line with a previous study of oscillating cerebellar activity during GSWDs in WAG/Rij and F344/BN rats.32 We observed that 35% of neuronal recordings in the MCN showed GSWD‐modulated patterns, whereas the portions of GSWD‐modulated neurons in the IN and LCN were higher (73% and 44%, respectively). Except for an anatomical evaluation of the local density of large and small soma‐diameter CN neurons in the mouse brain52 and computational studies on the clustering analysis of CN neuronal action potential firing in tg,53, 54 few experimental data are available that allow us to unequivocally pinpoint the type(s) of CN neurons responsible for modification of GSWD activity. With respect to the extracellular recordings, we presumably recorded mostly from CN neurons with a large soma‐diameter,55 which incorporates mainly excitatory glutamatergic neurons,56 but in the MCN also inhibitory glycinergic projection neurons.57 Interestingly, GSWD‐modulated CN neurons also showed characteristic firing patterns during the periods in between seizures. During these interictal periods, they fired at higher frequencies with a more irregular and burstlike pattern than the CN neurons that did not comodulate with GSWDs. Thus, the interictal firing pattern of CN neurons in tg and C3H/HeOuJ mice appears to reliably predict whether these cells will show oscillations phase‐locked to GSWDs during seizures. Pharmacological manipulation of neuronal activity in the cerebellum proved effective when the injections of muscimol or gabazine were aimed at the CN, but not when the cerebellar cortex was targeted. We found that gabazine application was effective in reducing GSWD occurrence in all CN, with the most pronounced effects in IN and LCN. Along the same line, muscimol injections in IN and LCN evoked the biggest increase in GSWD occurrence. Effects of MCN injections were smaller but still significant. Because we know little about the density of individual types of neurons throughout the murine MCN, IN, and LCN,52, 56 and considering the similarity in effects of gabazine and muscimol on neuronal activity in these nuclei, we cannot draw a firm conclusion about a potentially differential effect of either gabazine or muscimol on the respective nuclei. These data raise the possibility that the difference in impact on GSWD occurrence between manipulation of MCN versus that of IN and LCN does not reflect a difference in intrinsic activity, but rather a difference in their efferent projections to the brainstem, midbrain, and thalamus.24 Although all CN have been shown to project to a wide range of thalamic subnuclei, such as the ventrolateral, ventromedian, centrolateral, centromedian, and parafascicular nuclei,24, 58 and thereby connect to a variety of thalamocortical networks, the impact of IN and LCN has been shown to focus on the primary motor cortex, whereas MCN impact more diffusely on thalamocortical networks.59 CN axons that project to the thalamus have been shown to originate from glutamatergic neurons, which synapse predominantly perisomatically and evoke substantial excitatory responses.4, 6, 23, 24, 25, 26, 27, 28, 29 Upon CN injections with muscimol, we must in effect have substantially reduced the level of excitation of thalamic neurons and thereby disturbed the balance of inhibition and excitation in thalamocortical networks in favor of inhibition. One of the main consequences of hyperpolarizing the membrane potential of thalamic neurons through this inhibition is activation of hyperpolarization‐activated depolarizing cation currents (I) and CaV3.1 (T‐type) Ca2+ channel currents, which typically results in the burstlike action potential firing that can drive GSWDs in thalamocortical networks.7, 8, 60, 61 Moreover, in tg thalamic relay neurons show increased T‐type Ca2+ channel currents,62 which probably act synergistically with the decreased excitation following muscimol treatment, likely further increasing GSWD occurrence. In contrast, when we applied gabazine to CN, the balance of inhibition and excitation in the thalamocortical networks probably shifted toward excitation and thereby may have prevented the activation of I and T‐type Ca2+ channel currents, reducing the occurrence of burst firing and GSWDs. The successful application of short periods of optogenetic excitation of CN neurons not only confirmed the deoscillating impact of gabazine, but further refined it by revealing that GSWDs can be most efficiently stopped when the interval between ECoG spikes, that is, wavelength of the oscillations, is instantly shortened and thereby reset. Given the relatively low success rate of optogenetic stimulation in the period just preceding the "spike" state of the GSWDs, which reflects the excitation state of the thalamocortical relay neurons, it is parsimonious to explain the effective resetting through optimal interference during the inhibitory or "wave" state of the GSWD.51 This explanation centered on the resetting hypothesis argues against the possibility that GSWDs were terminated by optogenetic activation of the CN neurons that were inhibited. Regardless of the net effect of CN stimulation on thalamocortical networks, the current approach proved equally effective when applied bilateral or unilateral. Most likely, instantly resetting the balance of excitation and inhibition in thalamocortical relay neurons on one side of the brain will also engage the other side through combined ipsi‐ and contralateral projections from the CN to the thalamus and through interthalamic and intercortical connections.6, 24, 63 It remains to be established to what extent the current findings for absence epilepsy can help to treat epileptic patients suffering from other types of seizures. Our findings on the impact of optogenetic manipulation of CN firing patterns on GSWD occurrence seem to support the (pre)‐clinical studies that apply deep brain stimulation (DBS)64, 65 in the CN may be an option to treat epilepsy patients. So far, only 3 clinical studies applying electrical DBS to the CN have been reported, which is in contrast to the dozens of studies performed to investigate the therapeutic use of cerebellar surface stimulation (as reviewed by Krauss and Koubeissi66). Although initially promising, the clinical studies on the effects of cerebellar surface stimulation reported inconsistent results,12, 13, 14, 15, 16, 17, 18, 19, 20, 21 which may partially be due to suboptimal placement of electrodes. Unlike the current results, which show a regional preference for the effect of lateral CN stimulation on GSWD occurrence, it was recently shown that manipulating Purkinje cells in the medial cerebellum is most effective in controlling kainate‐induced temporal lobe epilepsy.67 So far, the studies that applied DBS at the level of CN in an uncontrolled fashion report highly effective decreases in the level of seizures (corresponding to class IC and IIIA of the Engel scale68) in a low number of patients characterized with various types of epilepsy.69, 70, 71 Apart from the coherence in location of stimulation (laterally located nucleus dentatus), these studies used a wide variety in CN stimulus regimes, ranging from 3 minutes per day to continuous electrical stimulation for 12 to 14 hours per day. It appears that high‐frequency stimulation (>50Hz), but not low‐frequency stimulation (1–40Hz), is most effective when applied to the cerebellar dentate nucleus. In the present study, we found that the increase in CN neuronal action potential firing frequency upon optogenetic stimulation was highly variable (see Fig 4), and thus our current results do not provide any ground for a conclusion on whether low‐ or high‐frequency stimulation would be advantageous to stop GSWD episodes. However, our results do provide sufficient data to conclude that the temporal precision determines the level of efficiency, for example, by stimulating with short pulses as soon as an epileptic event starts to occur and if possible in a proper temporal relation with respect to the inhibitory wave of the GSWDs. Because absence epilepsy is a commonly prevalent but in essence a benign form of generalized epilepsy,1 DBS will not very likely be considered as a serious option. However, patients diagnosed with other forms of epilepsy who do not benefit sufficiently from medication may be eligible for (cerebellar) DBS.47 Currently, the options for applying DBS are limited; only the anterior thalamic nucleus is currently described in the US Food and Drug Administration guidelines to treat intractable epilepsy, and although promising, the outcome is limited and can result in cognitive and emotional problems.72, 73 Given the powerful impact of CN stimulation on thalamocortical activity that is shown in the present study, we hypothesize that CN stimulation may also exert very positive effects in these other, more severe kinds of epilepsies.

Authorship

L.K., O.H.J.E.R., and F.E.H. conceived and designed the study and performed all recordings; L.K., O.H.J.E.R., P.A., J.K.S., E.A.T., C.S., N.D., B.H.J.W., M.N., V.S., C.I.D.Z., and F.E.H. designed the analyses; L.K., O.H.J.E.R., P.A., J.K.S., and F.E.H. performed the analyses; M.N.v.D., A.K., C.S., and W.A.S. designed the closed‐loop circuit; W.A.S, V.S., A.M.J.M.v.d.M., C.I.D.Z., and F.E.H contributed financial support; L.K., O.H.J.E.R., P.A., E.A.T, V.S., A.M.J.M.v.d.M., C.I.D.Z., and F.E.H. cowrote the manuscript. L.K. and O.H.J.E.R. contributed equally. C.I.D.Z. and F.E.H. contributed equally and are co‐senior authors.

Potential Conflicts of Interest

Nothing to report. supplementary Figure Legend Click here for additional data file. supplementary Figure Click here for additional data file.
  63 in total

1.  Topography of cerebellar nuclear projections to the brain stem in the rat.

Authors:  T M Teune; J van der Burg; J van der Moer; J Voogd; T J Ruigrok
Journal:  Prog Brain Res       Date:  2000       Impact factor: 2.453

2.  Preliminary evaluation of cerebellar stimulation by double-blind stimulation and biological criteria in the treatment of epilepsy.

Authors:  J M Van Buren; J H Wood; J Oakley; F Hambrecht
Journal:  J Neurosurg       Date:  1978-03       Impact factor: 5.115

3.  Some observations in treatment stimulation of epilepsy.

Authors:  M Sramka; G Fritz; M Galanda; P Nádvornik
Journal:  Acta Neurochir (Wien)       Date:  1976       Impact factor: 2.216

4.  Effects of fastiginal stimulation on thalamic neurones belonging to the diffuse projection system.

Authors:  A Bava; T Manzoni; A Urbano
Journal:  Brain Res       Date:  1967-04       Impact factor: 3.252

5.  Double-blind, randomized controlled pilot study of bilateral cerebellar stimulation for treatment of intractable motor seizures.

Authors:  Francisco Velasco; José D Carrillo-Ruiz; Francisco Brito; Marcos Velasco; Ana Luisa Velasco; Irma Marquez; Ross Davis
Journal:  Epilepsia       Date:  2005-07       Impact factor: 5.864

6.  Chronic cerebellar stimulation in the treatment of epilepsy.

Authors:  L F Levy; W C Auchterlonie
Journal:  Epilepsia       Date:  1979-06       Impact factor: 5.864

7.  Quantitative morphological analysis of the cerebellar nuclei in normal and lurcher mutant mice. I. Morphology and cell number.

Authors:  J A Heckroth
Journal:  J Comp Neurol       Date:  1994-05-01       Impact factor: 3.215

Review 8.  Sex-specific consequences of early life seizures.

Authors:  Ozlem Akman; Solomon L Moshé; Aristea S Galanopoulou
Journal:  Neurobiol Dis       Date:  2014-05-27       Impact factor: 5.996

Review 9.  Genetic absence epilepsy in rats from Strasbourg--a review.

Authors:  C Marescaux; M Vergnes; A Depaulis
Journal:  J Neural Transm Suppl       Date:  1992

10.  Closed-loop optogenetic control of thalamus as a tool for interrupting seizures after cortical injury.

Authors:  Jeanne T Paz; Thomas J Davidson; Eric S Frechette; Bruno Delord; Isabel Parada; Kathy Peng; Karl Deisseroth; John R Huguenard
Journal:  Nat Neurosci       Date:  2012-11-07       Impact factor: 24.884

View more
  39 in total

Review 1.  Resolving the Micro-Macro Disconnect to Address Core Features of Seizure Networks.

Authors:  Jordan S Farrell; Quynh-Anh Nguyen; Ivan Soltesz
Journal:  Neuron       Date:  2019-03-20       Impact factor: 17.173

2.  Dynamic brain glucose metabolism identifies anti-correlated cortical-cerebellar networks at rest.

Authors:  Dardo G Tomasi; Ehsan Shokri-Kojori; Corinde E Wiers; Sunny W Kim; Şukru B Demiral; Elizabeth A Cabrera; Elsa Lindgren; Gregg Miller; Gene-Jack Wang; Nora D Volkow
Journal:  J Cereb Blood Flow Metab       Date:  2017-05-23       Impact factor: 6.200

Review 3.  Optogenetics: the new molecular approach to control functions of neural cells in epilepsy, depression and tumors of the central nervous system.

Authors:  Bruno Camporeze; Bruno Alcântara Manica; Gabriel Alves Bonafé; Jivago Jordão Camargos Ferreira; Aurélio Lourenço Diniz; Carlos Tadeu Parisi de Oliveira; Luis Roberto Mathias Junior; Paulo Henrique Pires de Aguiar; Manoela Marques Ortega
Journal:  Am J Cancer Res       Date:  2018-10-01       Impact factor: 6.166

4.  One Site to Rule Them All: Toward a Master Regulator of Ictal Activity.

Authors:  Zachary Zeidler; Esther Krook-Magnuson
Journal:  Epilepsy Curr       Date:  2016 May-Jun       Impact factor: 7.500

5.  PRRT2-dependent dyskinesia: cerebellar, paroxysmal and persistent.

Authors:  Lieke Kros; Chris I De Zeeuw
Journal:  Cell Res       Date:  2017-11-17       Impact factor: 25.617

Review 6.  What goes up must come down: homeostatic synaptic plasticity strategies in neurological disease.

Authors:  Emily A André; Patrick A Forcelli; Daniel Ts Pak
Journal:  Future Neurol       Date:  2018-01-17

7.  Excitation, but not inhibition, of the fastigial nucleus provides powerful control over temporal lobe seizures.

Authors:  Martha L Streng; Esther Krook-Magnuson
Journal:  J Physiol       Date:  2019-12-09       Impact factor: 5.182

8.  Seizures and Sleep in the Thalamus: Focal Limbic Seizures Show Divergent Activity Patterns in Different Thalamic Nuclei.

Authors:  Li Feng; Joshua E Motelow; Chanthia Ma; William Biche; Cian McCafferty; Nicholas Smith; Mengran Liu; Qiong Zhan; Ruonan Jia; Bo Xiao; Alvaro Duque; Hal Blumenfeld
Journal:  J Neurosci       Date:  2017-10-24       Impact factor: 6.167

Review 9.  Optogenetic Approaches for Controlling Seizure Activity.

Authors:  Jack K Tung; Ken Berglund; Robert E Gross
Journal:  Brain Stimul       Date:  2016-07-14       Impact factor: 8.955

10.  Seizing Control: From Current Treatments to Optogenetic Interventions in Epilepsy.

Authors:  Anh D Bui; Allyson Alexander; Ivan Soltesz
Journal:  Neuroscientist       Date:  2016-07-09       Impact factor: 7.519

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.