Identification of Leishmania species by kinetoplast DNA-polymerase chain reaction for the first time in Khaf district, Khorasan-e-Razavi province, Iran.

CONTEXT: Cutaneous leishmaniasis (CL) is an endemic parasitic skin disease in many parts of Iran including Khorasan province. Both clinical forms of the disease, anthroponotic cutaneous leishmaniasis (ACL) and zoonotic cutaneous leishmaniasis (ZCL) are present in this province. However, leishmaniasis molecular map is determined in four cities of Khorasan, but several foci still are remained unknown. AIM: The aim was to identify the species of Leishmania causing CL in Khaf, a District in Khorasan-e-Razavi province.
MATERIALS AND METHODS: Slide smears obtained from skin lesions of 120 patients suspected to leishmaniasis. Direct microscopy and polymerase chain reaction (PCR) performed using specific kinetoplast DNA primers. Data were analyzed with the use of SPSS.
RESULTS: Among 120 persons with skin ulcers suspected to CL, the results of direct smear of 54 (45%) samples were positive. PCR band were observed in 66 (55%) of examined samples in which 46 bands identified for Leishmania tropica and 20 for Leishmania major.
CONCLUSION: Both ACL and ZCL are present in Khaf. L. tropica is the dominant causative species for ACL. Further study is recommended to discover probable reservoir and vector for L. major in Khaf.

INTRODUCTION

Cutaneous leishmaniasis (CL) is an endemic parasitic skin disease in 98 countries worldwide, with more than 350 million people at risk.[1] Two clinical forms of the disease are present in more than 15 provinces of Iran. At least 20,000 cases/year have been reported in Iran.[2] Anthroponotic cutaneous leishmaniasis (ACL) caused by Leishmania tropica usually in urban areas and zoonotic cutaneous leishmaniasis (ZCL) caused by Leishmania major mostly in rural regions.[34] Both L. major and L. tropica are intracellular parasites transmitted through the bite of the female phlebotomine sand flies.[5] The Proven or suspected vectors of various leishmanias have reported 13 species of sand flies in Iran. Phlebotomus papatasi and Phlebotomus sergenti identified repeatedly as vector of L. major and L. tropica respectively in Khorasan-e-Razavi.[6]

Identification of Leishmania species is important for planning control measures and using treatment protocols.[1] However previous epidemiologic studies have been very useful to identify different foci in Khorasan, but there is not a perfect leishmaniasis map and exact data about the etiologic agents in many districts of this province. Although both L. tropica and L. major have reported from Mashhad and Sabzevar, previous Epidemiologic studies have indicated that ACL is the dominant only form of CL which is present in central and south Khorasan.[78]

Many different polymerase chain reaction (PCR)-based techniques have been used for Leishmania diagnosis. However, the kinetoplast DNA (kDNA) PCR is considered to be the most sensitive method for diagnosis of leishmaniasis.[9] kDNA has a variable region which is known for most Leishmania species. Therefore, it is an ideal target for discrimination between species.[10] The other studies have been carried out for diagnosis of leishmaniasis by kDNA-PCR.[7111213] We also used this method in current study.

To identify the species of Leishmania causing different clinical presentations of CL in Khaf, a district in Khorasan province, a study was undertaken over a period of 2 years (April 2011 to March 2013), at health center and 22-Bahman Hospital of Khaf and Departments of Parasitology and Immunology, School of Medicine, Mashhad University of Medical Sciences.

MATERIALS AND METHODS

Study area

Khaf district is located between the longitude 59° 28' to 60° 56' and the latitude 33° 40' to 35° 05' with 9,228 km2. Khaf is bordered from east with Afghanistan. Khaf altitude is 970 m above sea level with warm and dry climates and situated 260 km south of Mashhad, the capital of Khorasan-e-Razavi province [Figure 1]. The population of this county is about 110,000 included 56% inhabit in rural areas and 44% urban areas.

Figure 1

Geographical map of Khaf district, Khorasan-e-Razavi province, Iran

Sampling

In this cross-sectional study, the study population was those peoples who had at least one skin ulcer suspected to CL and introduced to clinical laboratories of health center and 22-Bahman Hospital in Khaf city for direct examination.

In order to collect demographic and clinical information by a questionnaire, an informed consent form was obtained from each individual or his/her attendant. To prepare two direct Giemsa stained smears (for direct examination and DNA extraction), samples obtained by scraping from the center and edge of each skin lesion using a sterile scalpel. Each smear examined by an expert microscopist and then kept for DNA extraction.

Parasitological test

Giemsa stained slides were observed under a light microscope with high magnification (×1000) by an expert individual. The results of microscopic test recorded. The slides kept in the boxes for DNA extraction.

DNA extraction

For DNA extraction, each slide smear was scraped and DNA extraction was carried out by DNA extraction kit (GeNet Bio, Korea). Briefly, the tissues on the slides should be suspended in lysis buffer (TL buffer). Then DNA extraction performed according to manufacturer's instructions step by step. DNA was stored in the freezer for the PCR test.[11]

Polymerase chain reaction amplification

Polymerase chain reaction performed with specific primers of kDNA pattern of L. donovani (F: 5'TCGCAGAACGCCCCTACC3') and (R: 5'AGGGGTTGGTGTAAAATAGG3') (Tuba-Negin, Iran) that produced 615 bp fragment for L. major and 744 bp fragment for L. tropica. Amplification reaction mixture (25 μl) contained 20 μl PCR mixtures (dNTP's, MgCl2, primers and Taq DNA polymerase) and 5 μl extracted DNA.[13]

Amplification performed by a PCR Thermal Cycler-PC 818 (ASTEC, Japan) under the following conditions: Initial denaturation for 5 min at 95°C, followed by 38 cycles of 94°C for 30 s, 60°C for 45 s, 72°C for 60 s, ending by final extension at 72°C for 7 min. In every round of PCR two standard sample for L. major (strain MRHO/IR/75/ER) and for L. tropica (strain MHOM/01/IR/YAZA) as a positive control and distilled water as negative control were used.

Polymerase chain reaction products were analyzed by 1.5% agarose gel electrophoresis and visualized by  Uvitec System DOC-008.XD (UVItec Ltd, Cambridge, UK) after staining with ethidium bromide. 100 bp DNA Ladder was also used as the DNA size marker. Single fragments of 615 bp and 744 bp are indicative of the species L. major and L. tropica, respectively [Figure 2]. Statistical data analysis was performed using Chi-square tests in the software  SPSS 11.5 software for Windows, (SPSS Inc., Chicago, IL, USA).

Figure 2

Electrophoresis of DNA samples obtained from direct smears of patients with cutaneous leishmaniasis from Khaf

RESULTS

A total of 120 cases aged 1-70 years old, comprising 81 (67.5%) males and 39 (32.5%) females were included in this study. Amastigotes of Leishmania recognized by Giemsa stained smears obtained from 54 (45%) patients. All the samples were examined by PCR method. PCR band observed in 66 (55%) cases included 46 L. tropica and 20 L. major. The result of PCR and direct stained smears compared with each other [Table 1].

Table 1

Comparison between the result of PCR and direct stained smears obtained from 120 patients from Khaf with skin lesions suspected to CL

About 80% of lesions caused by L. major are ulcerative while 74% of lesions caused by L. tropica are nodular and not ulcerative. Furthermore, according to questionnaires, all of the patients suffering from L. major infection had a history of travel to endemic areas [Table 2].

Table 2

Clinical presentation and place of infection in patients from Khaf district suffering from CL according to species of Leishmania

DISCUSSION

One of the challenges regarding the CL control and diagnosis is inadequate data of the healthcare system about epidemiological conditions.[14] Characterization and identification of Leishmania species is necessary, because different forms of CL caused by different species may require special control measures and treatment programs. In addition, epidemiological studies, the distribution of Leishmania species in human, reservoirs, and vectors is a prerequisite for designing appropriate control programs.[1516]

Based on previous experiments, we used PCR method for diagnosis and characterization of Leishmania species on extracted DNA obtained from Giemsa stained smears.[16171819]

Direct microscopy of scrapings taken from the margins of skin lesions is a common method for clinical diagnosis of leishmaniasis in most of the clinical laboratories. Comparison of PCR method and Direct microscopy on Giemsa stained slides indicate the higher sensitivity of PCR method.[711] Furthermore, the results of the current study showed that PCR is a high sensitive method for identification of Leishmania species. Of the 120 Giemsa stained smears prepared from the skin ulcer of patients suspected to CL, 54 (45%) were positive by microscopic method, whereas 66 (55%) of these were positive by PCR.

In the current study, DNA extraction performed by scraping direct stained smears. These samples are proper for DNA extraction in comparison with promastigotes obtained from RPMI culture.[202122]

Kinetoplast DNA is one of the genetic targets that has been applied and proved to be useful for detection of Leishmania species in clinical specimens.[14202122] The minicircle of kDNA is an ideal target, since there are approximately 10,000 copies of minicircles per parasite that are distributed among about 10 different sequence classes and are between 600 and 800 bp in size in members of the genus Leishmania.[9] The minicircle is divided into a conserved region and a variable region. The first region is conserved throughout the genus Leishmania and in some other trypanosomatids as well. These conserved sequences have high potential for PCR primer designing. These primers can amplify various minicircle classes from all Leishmania species. The high copy number of the Leishmania minicircles makes them an ideal target for diagnostic tools.[23]

Hence far it has seemed that the only form of leishmaniasis is ACL in the study area. Result of this study provides new insight about treatment and control measures of CL for clinicians and public health authorities. Treatment of patients with CL has performed based on clinical manifestations alone whereas differentiation of CL forms is impossible in this way. Clinical presentation of the skin lesions did not show categorical relation with the species of parasite. Among the patients with ACL, 20% had exudative ulcers, while, in those who ZCL, 20% presented dry lesions in the shape of papule and nodule [Table 2]. This indicates that Clinical appearance of Skin ulcers does not determine the clinical form of CL as discussed by many investigators.[2425]

In this study, all of patients suffering from L. major infection had a history of travel to endemic areas. These patients were workers who had traveled and stayed in Damghan, Golestan province and Sarakhs, the known foci for ZCL.[24252627] However both L. tropica and L. major isolated from the residence of Khaf district, but this indicates that the native and original etiologic agent for CL in the study area is L. tropica.

CONCLUSION

However both L. tropica and L. major isolated from the residence of Khaf district, but we believe that the dominant and original species of Leishmania is L. tropica. All victims of L. major are the residents who have travelled to ZCL foci. To identify Probable animal reservoirs for approved original ZCL of Khaf further study is recommended.