Literature DB >> 25695155

Rickettsia rickettsii in Amblyomma patinoi ticks, Colombia.

Álvaro A Faccini-Martínez, Francisco B Costa, Tatiana E Hayama-Ueno, Alejandro Ramírez-Hernández, Jesús A Cortés-Vecino, Marcelo B Labruna, Marylin Hidalgo.   

Abstract

Entities:  

Mesh:

Year:  2015        PMID: 25695155      PMCID: PMC4344264          DOI: 10.3201/eid2013.140721

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


× No keyword cloud information.
To the Editor: Rickettsia rickettsii is the etiologic agent of Rocky Mountain spotted fever (RMSF), a highly lethal tick-borne rickettsioses restricted to the Western Hemisphere (,). In Colombia, R. rickettsii was first reported during the 1930s, when 62 (95%) of 65 affected persons died of RMSF in Tobia town (Cundinamarca Department) (), from where highly virulent strains of R. rickettsii were isolated through the inoculation of patient blood or of Amblyomma cajennense sensu lato (s.l.) extracts into guinea pigs (). Thereafter, RMSF remained unnoticed in Colombia until the 21st century, when new outbreaks with high case-fatality rates were reported in different regions, including Villeta, a nearby locality of Tobia (). Recent studies have shown that A. cajennense s.l., widely distributed from the southern United States to Argentina, is actually a complex of 6 different species: A. cajennense sensu stricto (Amazonian region), A. mixtum (from Texas, USA, to western Ecuador), A. sculptum (northern Argentina, Bolivia, Paraguay, Brazil), A. interandinum (inter-Andean valley of Peru), A. tonelliae (dry areas of northern Argentina, Bolivia, and Paraguay), and A. patinoi (eastern cordillera of Colombia) (). With this new classification, A. patinoi, originally described from Villeta, is the only species of this complex known to occur in the RMSF-endemic area of Cundinamarca, Colombia (). In August 2013, we collected 15 A. patinoi adult ticks from cattle in Naranjal village (5°3′31.52′′N, 74°26′50.24′′W), Villeta town, an area of Cundinamarca, Colombia, to which RMSF is endemic. Ticks were taken alive to the laboratory, where they were frozen at –80°C for further analysis. The 15 ticks were defrosted, surface sterilized with iodine alcohol, and processed individually by the shell vial technique for isolation of rickettsiae in Vero cells, as described (). Infected cells were always incubated at 28°C. Rickettsiae were observed by Gimenez staining within cells (Technical Appendix Figure 1) from only 1 (inoculated from a female tick) of the 15 inoculated shell vials. This isolate was subjected to at least 7 Vero cell passages, each achieving >90% infected cells. DNA was extracted from an aliquot of first passage–infected cells and tested by a battery of PCR protocols targeting fragments of the rickettsial genes gltA, ompA, and ompB and the intergenic regions RR0155-rpmB, RR1240-tlc5, and cspA-ksgA (Table). We sequenced 1,106 bp, 512 bp, and 799 bp of the gltA, ompA, and ompB genes, respectively. By BLAST analyses (http://www.ncbi.nlm.nih.gov/blast), these sequences were 100% identical to corresponding sequences of R. rickettsii from Colombia and Brazil (GenBank accession nos. CP003306, CP003305). Generated sequences for 2 intergenic regions, RR0155-rpmB (228 bp) and RR1240-tlc5 (306 bp), were 100% identical to corresponding sequences of the same 2 R. rickettsii isolates from Colombia and Brazil. A 337-bp sequence of the cspA-ksgA intergenic region was 100% (337/337 nt) identical to R. rickettsii from Brazil (CP003305) and 99.7% (336/337) to R. rickettsii from Colombia (CP003306). Partial sequences from R. rickettsii generated in this study were deposited into GenBank and assigned nucleotide accession nos. KJ735644–KJ735649.
Table

Primer pairs used for amplification of rickettsial genes or intergenic regions, Colombia, August 2013

Target, primer pairs, primersPrimer sequences, 5′ → 3′Fragment size, bpReference
gltA
1
CS-78GCAAGTATCGGTGAGGATGTAAT401(6)
CS-323GCTTCCTTAAAATTCAATAAATCAGGAT(6)
2
CS-239GCTCTTCTCATCCTATGGCTATTAT834(6)
CS-1069
CAGGGTCTTCGTGCATTTCTT

(6)
ompA
3
Rr190.70pATGGCGAATATTTCTCCAAAA530(7)
Rr190.602n
AGTGCAGCATTCGCTCCCCCT

(7)
ompB
4
120-M59CCGCAGGGTTGGTAACTGC862(8)
120–807
CCTTTTAGATTACCGCCTAA

(8)
RR0155-rpmB
5
ForwardTTTCTAGCAGCGGTTGTTTTATCC290(9)
Reverse
TTAGCCCATGTTGACAGGTTTACT

(9)
RR1240-tlc5b
6
ForwardCGGGATAACGCCGAGTAATA357(10)
Reverse
ATGCCGCTCTGAATTTGTTT

(10)
cspA-ksgA
7
ForwardCATCACTGCTTCGCTTATTTT405(9)
ReverseATTTCTTTTCTTCCTCTTCATCAA(9)
Whole-body remnants of the 15 ticks used to inoculate shell vials were also subjected to DNA extraction and processed by PCR for the rickettsial gltA gene (Table); only 1 tick (the one that provided the rickettsial isolate) contained rickettsial DNA, indicating a 6.6% (1/15) infection rate. We confirmed the taxonomic identification of this tick as A. patinoi by generating mitochondrial 16S rRNA partial sequences from it and from an A. patinoi paratype that is deposited in the tick collection of the University of São Paulo (Brazil) (accession no. CNC-1585) (). Both sequences were 100% identical to each other (deposited into GenBank under accession nos. KP036466–KP036467). A 3 mL-aliquot of the second infected cell passage was inoculated intraperitoneally into an adult male guinea pig, in which high fever (rectal temperature >40.0°C) developed during days 5–8 days post inoculation. A total of 3 guinea pig passages were performed, always followed by high fever. A second passage animal survived; scrotal necrosis developed (Technical Appendix Figure 2), and this animal seroconverted to R. rickettsii with 32,768 endpoint IgG titer through the immunofluorescence assay, as described (). A highly pathogenic strain of R. ricketsii was isolated from an A. patinoi specimen collected at Villeta, where recent human cases of RMSF have been reported (). More than 70 years ago, the only previous R. rickettsii tick isolates in Colombia were obtained from A. cajennense s.l. in Tobia, only 20 km from Villeta (). At that time, ticks of the A. cajennense complex were considered natural vectors of R. rickettsii in Tobia (). Because the A. cajennense s.l. complex was recently found to be represented in the eastern cordillera of Colombia (which includes Tobia and Villeta) by the species A. patinoi (), the tick isolates obtained >70 years ago also are highly likely to have been obtained from A. patinoi. Therefore, A. patinoi ticks should be considered the main vector of R. rickettsii to humans in this region of Colombia.

Technical Appendix

Testing of Rickettsia rickettsii isolated from an Amblyomma patinoi tick, Villeta, Colombia, August 2013.
  8 in total

1.  Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB).

Authors:  V Roux; D Raoult
Journal:  Int J Syst Evol Microbiol       Date:  2000-07       Impact factor: 2.747

2.  Molecular typing of isolates of Rickettsia rickettsii by use of DNA sequencing of variable intergenic regions.

Authors:  Sandor E Karpathy; Gregory A Dasch; Marina E Eremeeva
Journal:  J Clin Microbiol       Date:  2007-06-06       Impact factor: 5.948

3.  Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA.

Authors:  M Eremeeva; X Yu; D Raoult
Journal:  J Clin Microbiol       Date:  1994-03       Impact factor: 5.948

4.  Use of highly variable intergenic spacer sequences for multispacer typing of Rickettsia conorii strains.

Authors:  Pierre-Edouard Fournier; Yong Zhu; Hiroyuki Ogata; Didier Raoult
Journal:  J Clin Microbiol       Date:  2004-12       Impact factor: 5.948

5.  Reassessment of the taxonomic status of Amblyomma cajennense () with the description of three new species, Amblyomma tonelliae n. sp., Amblyomma interandinum n. sp. and Amblyomma patinoi n. sp., and reinstatement of Amblyomma mixtum, and Amblyomma sculptum (Ixodida: Ixodidae).

Authors:  Santiago Nava; Lorenza Beati; Marcelo B Labruna; Abraham G Cáceres; Atilio J Mangold; Alberto A Guglielmone
Journal:  Ticks Tick Borne Dis       Date:  2014-02-18       Impact factor: 3.744

6.  Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic.

Authors:  Marcelo B Labruna; Ted Whitworth; Maurício C Horta; Donald H Bouyer; Jere W McBride; Adriano Pinter; Vsevolod Popov; Solange M Gennari; David H Walker
Journal:  J Clin Microbiol       Date:  2004-01       Impact factor: 5.948

7.  Rickettsial infection in Amblyomma cajennense ticks and capybaras (Hydrochoerus hydrochaeris) in a Brazilian spotted fever-endemic area.

Authors:  Felipe S Krawczak; Fernanda A Nieri-Bastos; Fernanda P Nunes; João F Soares; Jonas Moraes-Filho; Marcelo B Labruna
Journal:  Parasit Vectors       Date:  2014-01-05       Impact factor: 3.876

8.  Rocky Mountain spotted fever, Colombia.

Authors:  Marylin Hidalgo; Leonora Orejuela; Patricia Fuya; Pilar Carrillo; Jorge Hernandez; Edgar Parra; Colette Keng; Melissa Small; Juan P Olano; Donald Bouyer; Elizabeth Castaneda; David Walker; Gustavo Valbuena
Journal:  Emerg Infect Dis       Date:  2007-07       Impact factor: 6.883

  8 in total
  10 in total

Review 1.  Ticks (Acari: Ixodoidea) associated with mammals in Colombia: a historical review, molecular species confirmation, and establishment of new relationships.

Authors:  Mateo Ortíz-Giraldo; William D Tobón-Escobar; Daniela Velásquez-Guarín; María F Usma-Marín; Paula A Ossa-López; Héctor E Ramírez-Chaves; Juan D Carvajal-Agudelo; Fredy A Rivera-Páez
Journal:  Parasitol Res       Date:  2021-01-15       Impact factor: 2.289

2.  Germ cells: a useful tool for the taxonomy of Rhipicephalus sanguineus s.l. and species of the Amblyomma cajennense complex (Acari: Ixodidae).

Authors:  Erika M Ospina-Pérez; Lorys Y Mancilla-Agrono; Fredy A Rivera-Páez
Journal:  Parasitol Res       Date:  2020-04-07       Impact factor: 2.289

3.  A Cluster of Cases of Rocky Mountain Spotted Fever in an Area Of Colombia Not Known to be Endemic for This Disease.

Authors:  Andrés F Londoño; Catalina Arango-Ferreira; Leidy Y Acevedo-Gutiérrez; Luis E Paternina; Carlos Montes; Iván Ruiz; Marcelo B Labruna; Francisco J Díaz; David H Walker; Juan D Rodas
Journal:  Am J Trop Med Hyg       Date:  2019-08       Impact factor: 2.345

4.  Hard tick species (Acari: Ixodidae) and infestation in two livestock agroecosystems from Antioquia, Colombia.

Authors:  Juan A Segura; Luis Javier Saldarriaga; Juan Manuel Cerón; Leonardo Ríos Osorio; Zulma V Rueda; Lina A Gutiérrez
Journal:  Exp Appl Acarol       Date:  2022-02-10       Impact factor: 2.132

5.  Epidemiology of Spotted Fever Group Rickettsioses and Acute Undifferentiated Febrile Illness in Villeta, Colombia.

Authors:  Álvaro A Faccini-Martínez; Alejandro Ramírez-Hernández; Christian Barreto; Elkin Forero-Becerra; Diego Millán; Elkin Valbuena; Andrea C Sánchez-Alfonso; Wilson O Imbacuán-Pantoja; Jesús A Cortés-Vecino; Luis J Polo-Terán; Néstor Yaya-Lancheros; Jorge Jácome; Ana M Palomar; Sonia Santibáñez; Aránzazu Portillo; José A Oteo; Marylin Hidalgo
Journal:  Am J Trop Med Hyg       Date:  2017-07-19       Impact factor: 2.345

6.  Rhipicephalus microplus and Amblyomma sculptum (Ixodidae) infestation of Nellore cattle (Bos taurus indicus) in a farm of the Brazilian Cerrado: seasonality and infestation patterns.

Authors:  Samantha Maciel de Siqueira; Rodrigo da Costa Maia; Vanessa do Nascimento Ramos; Vinicius da Silva Rodrigues; Matias Pablo Juan Szabó
Journal:  Exp Appl Acarol       Date:  2021-06-17       Impact factor: 2.132

7.  CONTRIBUTIONS TO RICKETTSIOSES RESEARCH IN COLOMBIA (1917-1943), LUIS B. PATIÑO CAMARGO.

Authors:  Álvaro A Faccini-Martínez; Carlos A Botero-García; Marylin Hidalgo
Journal:  Rev Inst Med Trop Sao Paulo       Date:  2016-04-08       Impact factor: 1.846

8.  Descriptions of two new cases of Rocky Mountain spotted fever in Panama, and coincident infection with Rickettsia rickettsii in Rhipicephalus sanguineus s.l. in an urban locality of Panama City, Panama.

Authors:  A Martínez-Caballero; B Moreno; C González; G Martínez; M Adames; J V Pachar; J B Varela-Petrucelli; J Martínez-Mandiche; J A Suárez; L Domínguez; Y Zaldívar; S Bermúdez
Journal:  Epidemiol Infect       Date:  2018-04-05       Impact factor: 4.434

9.  Eco-epidemiological analysis of rickettsial seropositivity in rural areas of Colombia: A multilevel approach.

Authors:  Juan C Quintero V; Luis E Paternina T; Alexander Uribe Y; Carlos Muskus; Marylin Hidalgo; Juliana Gil; Astrid V Cienfuegos G; Lisardo Osorio Q; Carlos Rojas A
Journal:  PLoS Negl Trop Dis       Date:  2017-09-18

10.  Amblyomma mixtum free-living stages: Inferences on dry and wet seasons use, preference, and niche width in an agroecosystem (Yopal, Casanare, Colombia).

Authors:  Elkin Forero-Becerra; Alberto Acosta; Efraín Benavides; Heidy-C Martínez-Díaz; Marylin Hidalgo
Journal:  PLoS One       Date:  2022-04-06       Impact factor: 3.240

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.