| Literature DB >> 25663891 |
Boding Tong1, Jiexi Zeng1, Yujie Wu1, Wei Xiong1.
Abstract
The present study aimed to investigate the association between the expression of sex-determining region Y box 2 (SOX2) in retinoblastoma (Rb) tissues and peripheral blood, and the clinicopathological characteristics of Rb. The expression of SOX2 in Rb tissues was detected by immunohistochemical staining and western blot analysis. SOX2 expression in the peripheral blood of children with Rb was determined using quantitative real-time polymerase chain reaction. The correlation between SOX2 expression and the clinicopathological characteristics of Rb was analyzed using χ2 tests. The positive rate of SOX2 in Rb tissues was 82.2%, while the expression of SOX2 in the control group tissues was negative. Western blot analysis detected a higher expression of SOX2 in the Rb tissues than in the control group tissues. Poorly differentiated Rb tissues exhibited significantly higher levels of SOX2 expression compared with the well-differentiated Rb tissues. SOX2 expression was higher in the peripheral blood of children with Rb than in individuals from the control group. The level of SOX2 expression in the peripheral blood of the poorly differentiated group was higher than that of the well-differentiated group. Enhanced SOX2 expression in Rb tissues and peripheral blood was closely associated with the clinicopathological characteristics of Rb. Therefore, SOX2 may be a novel target biomarker for the clinical diagnosis and treatment of Rb.Entities:
Keywords: SOX2; immunohistochemistry staining; retinoblastoma
Year: 2015 PMID: 25663891 PMCID: PMC4315024 DOI: 10.3892/ol.2015.2857
Source DB: PubMed Journal: Oncol Lett ISSN: 1792-1074 Impact factor: 2.967
Primers for quantitative reverse transcription polymerase chain reaction.
| Primer | Sequence (5′ to 3′) |
|---|---|
| SOX2, forward | GAGAGTGTTTGCAAAAGGGGG |
| SOX2, reverse | GCTTCTCCGTCTCCGACAAA |
| GAPDH, forward | CTCTGCTCCTCCTGTTCGAC |
| GAPDH, reverse | GCGCCCAATACGACCAAATC |
SOX2, sex-determining region Y box 2.
Figure 1Immunohistochemical analysis revealing the expression of sex-determining region Y box 2 (SOX2) protein in retinoblastoma tissues (magnification, ×10). (A) Strong positive expression of SOX2. (B) Positive expression of SOX2. (C) Weak positive expression of SOX2 in the cytoplasm. (D) Positive expression of SOX2 in the nucleus.
Correlation of sex-determining region Y box 2 (SOX2) expression and clinicopathological features of retinoblastoma.
| Variables | n | Percentage of positive SOX2 expression | χ2 | P-value |
|---|---|---|---|---|
| Gender | ||||
| Male | 28 | 100 | ||
| Female | 17 | 100 | ||
| Optic nerve invasion | 29.152 | 0.000 | ||
| N0–1 | 11 | 0 | ||
| N2 | 16 | 25 | ||
| N3 | 18 | 94 | ||
| Differentiation | 23.226 | 0.000 | ||
| Well | 31 | 23 | ||
| Poor | 14 | 100 | ||
Percentage of strong positive SOX2 expression.
Figure 2Sex-determining region Y box 2 (SOX2) protein expression in retinoblastoma (Rb) tissues, as detected by western blot analysis. The quantification of western blots were plotted into histograms. (A) SOX2 protein expression in Rb and control tissues. *P<0.05, compared with the control group. (B) SOX2 protein expression in the poorly and well-differentiated groups. *P<0.05, compared with the poorly differentiated group. (C) SOX2 protein expression in Rb tissues at stages N0, N1, N2 and N3. *P<0.05, compared with the N0 group. All data are presented as the mean ± standard error of the mean.
Figure 3Sex-determining region Y box 2 (SOX2) gene expression in the peripheral blood of children with retinoblastoma (Rb). The quantification of the quantitative reverse transcription polymerase chain reactions were plotted into histograms. (A) Relative expression of SOX2 mRNA in the peripheral blood of control individuals and Rb patients. *P<0.05, compared with the control group. (B) Expression of SOX2 mRNA in the peripheral blood of the poorly and well-differentiated groups. *P<0.05, compared with the poorly differentiated group. All data are presented as the mean ± standard error of the mean.