Literature DB >> 25659774

A preliminary exploration on DNA methylation of transgene across generations in transgenic rats.

Qiling Li1, Wei Xu2, Ye Cui3, Li Ma2, Jendai Richards2, Wenzhi Li2, Yamin Ma2, Guoxing Fu2, Tameka Bythwood2, Yueling Wang4, Xu Li4, Qing Song1.   

Abstract

Epigenetic heritability is an important issue in the field of genetics and also in the development of many human diseases. In this study, we created a transgenic rat model and investigated the transgenerational methylation patterns in these animals. The transgene DNA fragment was unmethylated before it was injected into the pronucleus, so it is a good model to study the inheritance of DNA methylation patterns. We performed bisulfite sequencing on 23 CpG dinucleotides on the transgene across three generations in two tissues. We observed that the transgene was heavily methylated in the liver (87.53%) from the founder generation, whereas its methylation rate was much lower in the kidney (70.47%). Spearman correlation analysis showed that there was a strong correlation on the methylation status between different generations in the same tissue, which was observed in both liver and kidney, and among all individuals in this pedigree. This study provided some evidence that DNA methylation patterns acquired in the founder animal can be passed to the offspring.

Entities:  

Mesh:

Year:  2015        PMID: 25659774      PMCID: PMC4321119          DOI: 10.1038/srep08292

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Since the discovery of the double-helix structure 60 years ago, it has been known that genetic information can be passed from generation to generation using DNA molecules as the carrier. However, accumulating evidence has showed that some acquired phenotypic traits from environmental stresses can also be inherited from parents to offspring across the generations123. For example, it has been reported that specific acquired alterations of gene expression can be transmitted through the germline to most of the offspring4, and may confer a high risk of developing a disease5. The cytosine of mammalian DNA can be chemically modified to methylated cytosine or hydroxymethylated cytosine. These chemical modifications can determine the three-dimensional conformation of chromosomal DNA, and thus the accessibility of DNA to transcription factors and other DNA-binding proteins, which is critical in the regulation of gene expression. There are many key questions yet to be answered regarding DNA methylation, especially about the transgenerational epigenetic heritability6. Transgenic animals provide us an opportunity to gain insight on the issue. In the process of generating the transgenic animals, the DNA fragment was released from a plasmid in which the cytosines are unmethylated. After these unmethylated DNA molecules were microinjected into the pronucleus, they are incorporated into the host genome and subjected to changes on their methylation status. In this study, we monitored the DNA methylation status in our transgenic rat model across generations.

Results

Validation of bisulfite conversion rate

We carried out bisulfite DNA sequencing specifically targeted at the nucleotide sequence of the human CRP transgene that was integrated into the rat genome. This region contains 31 CpG dinucleotides, the common targets for cytosine methylation. We successfully measured the methylation status of 23 CpG dinucleotides among the CpGs in this study. First, we determined the conversion rate in our bisulfite treatment experiments, which is regarded as the control experiment to confirm if the chemical conversion is successful. Because those cytosines that are not on the CpG dinucleotides are rarely methylated, by comparing the sequence results between the DNA templates before and after the bisulfite treatment on those non-CpG cytosines, we can measure the bisulfite conversion rate. In our experiments, we observed that about 99.4% of cytosine residues were successfully converted to thymidine, which confirmed that our bisulfite sequencing can reliably read out the methylation status on those CpG dinucleotides. Previous studies have shown the presence of non-CpG methylation phenomenon78; DNA methylation at cytosines in the context of CpA, CpT and CpC have been reported in embryonic stem cells, sensory neurons9 and plants7. Those non-CpG methylated cytosines (~0.6% observed in our result) may either represent true methylation on those CpA, CpT or CpG dinucleotides, or leaking in the bisulfite reactions. Nevertheless, this conversion rate is high and sufficient for the following methylation analysis.

Differential methylation in the liver and kidney

We measured the methylation status of 23 CpG dinucleotides on the transgene in the liver and the kidney. Among these 5 rats, we observed that the overall methylation rates were quite different between the liver and kidney (Figure 1, and Figure 2). In the liver, the transgene was methylated at 87.5% of CpG dinucleotides, but in the kidney, the transgene was methylated at a substantially lower level (70.5%). No significant difference was found between Watson and Crick strands among 115 CpG sites.
Figure 1

Overall methylation rates of transgene.

About 87.53% CpG dinucleotides were methylated in the liver, and 70.47% in the kidney, there is a statistically significant difference between these two tissues (P < 0.001).

Figure 2

Quantitation of methylation status of transgene in the liver and kidney.

Totally 23 CpG dinucleotides of 5 rats in three generations were studied in these two tissues. Each circle represents the methylation status on one CpG site of one DNA strand. The rate of DNA methylation of each CpG on each strand was quantitated from the peaks of Sanger bisulfite sequencing. The data of methylation status were shown on two strands (Watson and Crick) separately. Totally about 250 ng of genomic DNA was input into each experiment, which was equivalent to about 38,000 pooled DNA molecules. The average percentage of methylation on each CpG dinucleotide was measured by Sanger sequencing. In each circle, the blue color represents the percentage of unmethylated CpG at this site; the yellow color represents the percentage of methylated CpG at this site.

Transgenerational similarity on the methylation status

We systematically analyzed the correlation of methylation status of the transgene in different generations. The overall methylation rates of three generations were not significantly different between three generations in both liver and kidney (Figure 2). We found that even though the original transgene was “naked” without any methylation before it was injected into the fertilized eggs, it was remarkably methylated in vivo in the founder rat and the offspring. To determine the correlation of methylation status at the same CpG sites on the transgene across generations, we performed the Pearson's correlation analysis. In the liver, we observed high correlations on all CpG dinucleotides, except in Rat-2 vs. Rat-4 in the kidney, and between different rats of different generations on the same CpG dinucleotides on both of the Watson strand and the Crick strand (Table 1). Although the overall methylation rates in the kidney were quite different from the overall rate in the liver (Figure 2), we observed that the correlation on CpG methylation status between different generations of rats was also strong in the kidney (Table 2). Our results indicated a high similarity of methylation status between different generations.
Table 1

Spearman correlation analysis of the CpG methylation status between different generations of rats in the liver

StrandVariableWith VariableSample CorrelationFisher's zBias AdjustmentCorrelation Estimate95% Confidence LimitsP-Value
WatsonRat-1Rat-20.67750.82450.01540.66910.35470.84750.0002
 Rat-1Rat-30.73370.93660.01670.72590.44760.8760<.0001
 Rat-1Rat-40.67680.82330.01540.66840.35360.84720.0002
 Rat-1Rat-50.62170.72780.01410.61300.26870.81840.0011
 Rat-2Rat-30.74640.96470.01700.73880.46950.8823<.0001
 Rat-2Rat-40.50290.55320.01140.49430.10310.75310.0134
 Rat-2Rat-50.46640.50550.01060.45810.05660.73210.0238
 Rat-3Rat-40.79751.09180.01810.79080.56180.9073<.0001
 Rat-3Rat-50.59790.68980.01360.58910.23360.80570.0020
 Rat-4Rat-50.70280.87280.01600.69460.39570.8604<.0001
CrickRat-1Rat-20.57210.65060.01300.56330.19680.79170.0036
 Rat-1Rat-30.59670.68810.01360.58790.23190.80500.0021
 Rat-1Rat-40.70480.87680.01600.69670.39910.8615<.0001
 Rat-1Rat-50.78711.06380.01790.78020.54250.9023<.0001
 Rat-2Rat-30.71500.89740.01630.70700.41600.8666<.0001
 Rat-2Rat-40.66010.79290.01500.65150.32720.83850.0004
 Rat-2Rat-50.61230.71260.01390.60350.25470.81340.0014
 Rat-3Rat-40.83441.20250.01900.82860.63230.9249<.0001
 Rat-3Rat-50.58230.66600.01320.57350.21120.79720.0029
 Rat-4Rat-50.76070.99790.01730.75330.49470.8894<.0001
Table 2

Spearman correlation analysis of the CpG methylation status between different generations of rats in the kidney

StrandVariableWith VariableSample CorrelationFisher's zBias AdjustmentCorrelation Estimate95% Confidence LimitsP-Value
WatsonRat-1Rat-20.68170.83220.01550.67330.36140.84970.0002
 Rat-1Rat-30.93921.73100.02130.93660.85420.9731<.0001
 Rat-1Rat-40.66260.79730.01510.65400.33110.83980.0004
 Rat-1Rat-50.81481.14130.01850.80850.59440.9156<.0001
 Rat-2Rat-30.63390.74790.01440.62520.28690.82480.0008
 Rat-2Rat-40.32530.33750.00740.3186-0.10770.64600.1312
 Rat-2Rat-50.57980.66220.01320.57100.20770.79590.0031
 Rat-3Rat-40.62910.73990.01430.62040.27970.82230.0009
 Rat-3Rat-50.84211.22840.01910.83650.64750.9285<.0001
 Rat-4Rat-50.62750.73720.01430.61880.27730.82140.0010
CrickRat-1Rat-20.70460.87630.01600.69640.39860.8613<.0001
 Rat-1Rat-30.95261.85880.02170.95050.88510.9791<.0001
 Rat-1Rat-40.94371.77060.02150.94130.86450.9751<.0001
 Rat-1Rat-50.77051.02140.01750.76320.51220.8941<.0001
 Rat-2Rat-30.63240.74540.01440.62370.28470.82410.0009
 Rat-2Rat-40.68870.84560.01570.68040.37280.85330.0002
 Rat-2Rat-50.63850.75560.01450.62980.29390.82730.0007
 Rat-3Rat-40.94571.78900.02150.94330.86910.9760<.0001
 Rat-3Rat-50.77841.04120.01770.77130.52650.8980<.0001
 Rat-4Rat-50.76951.01900.01750.76220.51040.8937<.0001

Discussion

In this study, we examined the correlation of methylation status across three generations. The transgene DNA fragment in vitro had no DNA methylation before it was injected into the pronucleus of the fertilized eggs; thus, monitoring the methylation status of the transgene gave us an opportunity to investigate the inheritance of DNA methylation in different generations. We observed that after the transgene DNA was integrated into the host genome, it started to be heavily methylated since the founder generation. The transgene showed quite different methylation rates between the liver (87.53%) and the kidneys (70.47%). The correlation of the CpG methylation status between different generations is very strong in both the liver and the kidney. This study provided some data for the research community to investigate transgenerational heritability of DNA methylation. Recent studies have suggested the heritability of acquired phenotypes. For example, it was reported that paternal high-fat diet consumption could induce common changes in the transcriptomes of retroperitoneal adipose and pancreatic islet tissues in female rat offspring10. In another example, an epigenetic event associated with the heterochromatic disruption induced by heat shock or osmotic stress was transmitted to the next generation in a non-Mendelian fashion11. When embryos were exposed to heat stress over multiple generations, the defective chromatin state was maintained over multiple generations and gradually returned to the normal state11. It has been proposed that DNA methylation may subsidize the heritability of these acquired traits. Full methylation rates were also significantly different between the liver and the kidney (P < 0.001). It has been shown in plants that CpG methylation can be maintained not only in promoters but also in the body of transgene12, this is consistent with our results observed in animals. In our study, all of the 23 CpGs were located in both promoter and gene body regions of the transgene; our results showed that the methylation status of CpGs in the gene body can be maintained across generations. It has been estimated that the failure of maintenance was estimated to occur at a frequency of ~5% per CpG site per cell division13. In summary, this study provided some evidence on the heritability of DNA methylation across generations.

Methods

Creation of human CRP transgenic rats

The transgene contained human CRP gene (21 bp fragment before the transcription starting site, the exons and intron, and 1.2 kb of 3′-flanking region), and mouse albumin promoter (from +22 to −305 bp) and enhancer (from −12.171 kb to −9.469 kb)14. Purified DNA was microinjected into fertilized eggs of Sprague-Dawley (SD) rats (Charles River Laboratory, Wilmington, MA). Pronuclear microinjection was performed at the University of Michigan Transgenic Animal Model Core Facility. Transgenic rats were identified by PCR with transgene-specific primers (Forward 5′-ACATACGCAAGGGATTTAGTC-3′; Reverse 5′-AACAGCTTCTCCATGGTCAC-3′) using genomic DNA samples obtained from tail biopsies. Founder rats were bred with non-transgenic SD rats to establish transgenic lines. Animals were housed in the Center for Laboratory Animal Resources of Morehouse School of Medicine. Transgenic CRP rats were given water ad libitum and a standard rat chow diet (Laboratory Rodent Diet 5001, LabDiet, USA). All animal experiments were performed with the approval of the Animal Care Committee of Morehouse School of Medicine, and conformed to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health. Five transgenic rats at 15–16 weeks old in three generations were chosen in this study (Figure 3). Among these 5 rats, Rat-1 was a founder rat, Rats 2–4 were the second generation of heterozygous offspring, and Rat-5 was the third generation heterozygous offspring.
Figure 3

The three-generation pedigree of rats in this study.

SD, Sprague-Dawley. Squares indicate male rats; circles indicate female rats. Rat ID was labeled in the squares or circles.

DNA extraction

After the transgenic rats were anesthetized with 70% CO2, liver and kidney were collected. Genomic DNA was extracted using DNeasy blood& tissue kit following the manufacture's protocol (Qiagen). DNA concentration was measured using the Nanodrop spectrophotometer (Thermo Scientific, DE, USA).

Genomic DNA bisulfite conversion

Bisulfite conversion is now the "gold standard" for assessment of DNA methylation status. Bisulfite treatment can deaminate specifically those unmethylated cytosine and convert them into uracil in DNA, while those methylated cytosines are protected by the methyl group in this chemical reaction from being converted into uracil. By comparing sequencing results of the original DNA molecules before the bisulfite treatment and the sequencing results after bisulfite treatment, the locations of unmethylated cytosines and 5-methylcytosines can be specifically determined at single-nucleotide resolution. In these experiments, genomic DNA (250 ng) was bisulfite-converted using EZ DNA Methylation-Direct Kit following the manufacture's protocol (Zymo Research). About 20 μl of sample was added to 130 μl of CT Conversion Reagent solution in a PCR tube, and then incubated in a thermal cycler with the cycling protocol: 98°C for 8 minutes and 64°C for 7 hours. Then the samples were processed with a series of buffers and the Zymo-SpinIC Column following the manufacturer's protocol.

Purification of bisulfite converted DNA

Purification of PCR products was completed using QIAquick PCR purification kit (QIAGEN, 28106). Five volumes of Buffer PB was added to 1 volume of the PCR sample and mixed. A QIAquick spin column was placed into a 2-ml collection tube. To bind DNA, the sample was applied to the QIAquick column and centrifuged for 30–60 seconds. The flow-through was discarded, and the QIAquick column was placed back into the same tube. To wash, 0.75 ml of Buffer PE was added to the QIAquick column and centrifuged 30–60 seconds. The flow-through was discarded and the QIAquick column was placed back in the same tube. The QIAquick column was placed in a clean 1.5 ml microcentrifuge tube. To elute DNA, 50 μl of H2O was added to the center of the QIAquick membrane and the column was centrifuged at maximum speed for 1 minute.

Amplification of bisulfite converted DNA

After bisulfite conversion, two complementary DNA strands are no longer complementary; one is usually called the Watson strand, and the other is called the Crick strand. Primers were designed for amplifying the bisulfite-converted DNA sequences. The PCR primer information is listed in Table 3. PCR was performed in20-μl reactions, containing 5 ng of converted DNA, 5 μM of each primer, 4 mM dNTPs, 2 μl of 10xPCR buffer, and 1 unit of Taq DNA polymerase. Amplification was performed for 45 cycles using a GeneAmp PCR System 9600 (PE Applied Biosystems, Foster City, CA). PCR products were analyzed by 1% agarose gel electrophoresis to confirm successful amplifications.
Table 3

Primers

Primers NameFor Bisulfite sequencingFor genomic sequence
ashCRPtg96m1FGGTTTTTGTATTATTGGTAGTAGGGGCCCTTGTATCACTGGCAGCAGG
ashCRPtg366m1RAAAAAACAAACTAACCCCTTCTCGAGAAGGGGTCAGTCTGTTTCTC
ashCRPtg360m2FAATTGGAGAAGGGGTTAGTTTGAACTGGAGAAGGGGTCAGTCTG
ashCRPtg666m2RACTATATCCTATATCCTTAAACCGGTCTAAGGATATAGGATACAGT
ashCRPtg665m3FTGGTTTAAGGATATAGGATATAGTGGTCTAAGGATATAGGATACAG
ashCRPtg895m3RACTAACTTCCTTCAAAATTCCCGGGAACTTTGAAGGAAGCCAGT
ashCRPtg894m4FTGGGAATTTTGAAGGAAGTTAGTGGGAACTTTGAAGGCAGCCAG
ashCRPtg1087m4RCTTCAAAACCCACAACTAAACCGGCCCAGCTGTGGGTCCTGAAG
ashCRPtg1087m5FGGTTTAGTTGTGGGTTTTGAAGGGCCCAGCTGTGGGTCCTGAAG
ashCRPtg1321m5RCAAAACACCTCAAATTCTAATTCGAATCAGAATTTGAGGTGTTTTG
ashCRPtg1321m6FGAATTAGAATTTGAGGTGTTTTGGAATCAGAATTTGAGGTGTTTTG
ashCRPtg1557m6RACACCTAACCAATATCCTAATTCGAATCAGGACACTGGCCAGGTGT
ashCRPtg1560m7FTTAGGATATTGGTTAGGTGTTTGTCAGGACACTGGCCAGGTGTCTG
ashCRPtg1779m7RAACACTACAAACAAACAAAAACCGGTTTTTGTTTGCTTGCAGTGCT
ashCRPtg1797m8FTTGGTTTTTGTTTGTTTGTAGTGCTGGTTTTTGTTTGCTTGCAGTG
ashCRPtg1950m8RATAAACTCCTCTAACAAAACACCGGTGTCCTGTCAGAGGAGCCCAT
ashCRPtg1945m9FATAGGGTGTTTTGTTAGAGGAGACAGGGTGTCCTGTCAGAGGAG
ashCRPtg2359m9RTCACAACTTCTAAAACAACTATCGATAGTTGCTTTAGAAGTTGTGA
sshCRPtg25m1FAATGGGAAGTGTAAATTTATAGGGAATGGGAAGTGTAAACTTACAGGG
sshCRPtg446m1RCATCTCCCCAACTCCCTATCGATAGGGAGCTGGGGAGATG
sshCRPtg443m2FTTTTAGATAGGGAGTTGGGGAGCTCCAGATAGGGAGCTGGGGAG
sshCRPtg714m2RTTACCCCAACAAAACAAATCTACGCAGATCTGCTCTGCTGGGGCAA
sshCRPtg714m3FGTAGATTTGTTTTGTTGGGGTAAGCAGATCTGCTCTGCTGGGGCAA
sshCRPtg895m3RACCCACATTCACAAAACTCTTCGAAGAGCCCTGTGAATGTGGGC
sshCRPtg894m4FTGAAGAGTTTTGTGAATGTGGGTGAAGAGCCCTGTGAATGTGGG
sshCRPtg1199m4RTACATTACAAACCTACTCCACCGGTGGAGCAGGCCTGCAATGCA
sshCRPtg1206m5FGTAGGTTTGTAATGTATATAGGGGCAGGCCTGCAATGCATATAGGG
sshCRPtg1457m5RCACCAAATAAAATTAACACCATCGATGGTGTTAATCTCATCTGGTG
sshCRPtg1457m6FGATGGTGTTAATTTTATTTGGTGGATGGTGTTAATCTCATCTGGTG
sshCRPtg1701m6RATTCCTAAAATCACAATAACTCCGGAGCTACTGTGACTTCAGGAAC
sshCRPtg1698m7FATTGGAGTTATTGTGATTTTAGGACTGGAGCTACTGTGACTTCAGG
sshCRPtg1991m7RTCTAAAAAACCTCTCACATTTACGCAAATGTGAGAGGTTTCTCAGA
sshCRPtg1990m8FAGTAAATGTGAGAGGTTTTTTAGAGCAAATGTGAGAGGTTTCTCAG
sshCRPtg2239m8RACAAATAAAAACCACCCCAAACGCCTGGGGTGGCCCTTACCTGT
sshCRPtg2228m9FATTTTTTTTATAGTTTGGGGTGGATCTCTCCCATAGCCTGGGGTGG
sshCRPtg2394m9RAAAAATCTAAAACTTCTAACCCCGGGGCTAGAAGTCCTAGATCTCT

Analysis of DNA methylation

The purified DNA was subjected to DNA sequencing on the automated sequencer (ABI PRISM 3100 genetic analyzer) using Genescan 3.7 software (Applied Biosystems). Products were sequenced from both directions to validate each other. The methylation status at each CpG site was read out from a comparison between the sequences of the unconverted DNA, the converted Watson strand, and the converted Crick strand. The methylation percentage was quantitated from the Sanger sequencing results. Correlations between methylation patterns in different generations were analyzed by the spearman's rank correlation coefficient. The significance levels were set at 0.05 for all tests. The SAS statistical package 9.3 (SAS Institute, Inc., Cary, North Carolina) was used for all data managements and analyses.

Author Contributions

Q.L. performed the experiments and wrote the first version of the manuscript. Y.C. and G.F. performed the statistical analysis. Y.M., J.R., W.L., W.X., L.M. and T.B. participated in the experiments. Y.W. and X.L. participated in study design. Q.S. and Q.L designed the work.
  14 in total

Review 1.  Understanding transgenerational epigenetic inheritance via the gametes in mammals.

Authors:  Lucia Daxinger; Emma Whitelaw
Journal:  Nat Rev Genet       Date:  2012-01-31       Impact factor: 53.242

2.  Interchromosomal interactions and olfactory receptor choice.

Authors:  Stavros Lomvardas; Gilad Barnea; David J Pisapia; Monica Mendelsohn; Jennifer Kirkland; Richard Axel
Journal:  Cell       Date:  2006-07-28       Impact factor: 41.582

Review 3.  Methylation dynamics, epigenetic fidelity and X chromosome structure.

Authors:  A D Riggs; Z Xiong; L Wang; J M LeBon
Journal:  Novartis Found Symp       Date:  1998

4.  Heritability: The family roots of obesity.

Authors:  Cassandra Willyard
Journal:  Nature       Date:  2014-04-17       Impact factor: 49.962

5.  Inheritance of stress-induced, ATF-2-dependent epigenetic change.

Authors:  Ki-Hyeon Seong; Dong Li; Hideyuki Shimizu; Ryoichi Nakamura; Shunsuke Ishii
Journal:  Cell       Date:  2011-06-24       Impact factor: 41.582

6.  Early prenatal stress epigenetically programs dysmasculinization in second-generation offspring via the paternal lineage.

Authors:  Christopher P Morgan; Tracy L Bale
Journal:  J Neurosci       Date:  2011-08-17       Impact factor: 6.167

7.  Epigenetic inheritance in the mouse.

Authors:  I Roemer; W Reik; W Dean; J Klose
Journal:  Curr Biol       Date:  1997-04-01       Impact factor: 10.834

8.  Genome-wide demethylation of Arabidopsis endosperm.

Authors:  Tzung-Fu Hsieh; Christian A Ibarra; Pedro Silva; Assaf Zemach; Leor Eshed-Williams; Robert L Fischer; Daniel Zilberman
Journal:  Science       Date:  2009-06-12       Impact factor: 47.728

9.  Shotgun bisulphite sequencing of the Arabidopsis genome reveals DNA methylation patterning.

Authors:  Shawn J Cokus; Suhua Feng; Xiaoyu Zhang; Zugen Chen; Barry Merriman; Christian D Haudenschild; Sriharsa Pradhan; Stanley F Nelson; Matteo Pellegrini; Steven E Jacobsen
Journal:  Nature       Date:  2008-02-17       Impact factor: 49.962

10.  Sex-specific, male-line transgenerational responses in humans.

Authors:  Marcus E Pembrey; Lars Olov Bygren; Gunnar Kaati; Sören Edvinsson; Kate Northstone; Michael Sjöström; Jean Golding
Journal:  Eur J Hum Genet       Date:  2006-02       Impact factor: 4.246

View more
  6 in total

1.  The mirror RNA expression pattern in human tissues.

Authors:  Tameka N Bythwood; Wei Xu; Wenzhi Li; Weinian Rao; Qiling Li; Xue Xue; Jendai Richards; Li Ma; Qing Song
Journal:  Precis Med       Date:  2015-10-01

2.  References for Haplotype Imputation in the Big Data Era.

Authors:  Wenzhi Li; Wei Xu; Qiling Li; Li Ma; Qing Song
Journal:  Mol Biol (Los Angel)       Date:  2015-10-31

Review 3.  Profiling genome-wide DNA methylation.

Authors:  Wai-Shin Yong; Fei-Man Hsu; Pao-Yang Chen
Journal:  Epigenetics Chromatin       Date:  2016-06-29       Impact factor: 4.954

4.  DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

Authors:  Chunrong Yang; Xueying Shang; Lei Cheng; Lei Yang; Xuefei Liu; Chunling Bai; Zhuying Wei; Jinlian Hua; Guangpeng Li
Journal:  PLoS One       Date:  2017-02-03       Impact factor: 3.240

5.  Presence of multimeric isoforms of human C-reactive protein in tissues and blood.

Authors:  Qiling Li; Wei Xu; Xue Xue; Qi Wang; Lu Han; Wenzhi Li; Shulan Lv; Dong Liu; Jendai Richards; Zhujun Shen; Li Ma; Qing Song
Journal:  Mol Med Rep       Date:  2016-11-03       Impact factor: 2.952

6.  Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish.

Authors:  Napo K M Cheung; Ryohei Nakamura; Ayako Uno; Masahiko Kumagai; Hiroto S Fukushima; Shinichi Morishita; Hiroyuki Takeda
Journal:  PLoS Genet       Date:  2017-12-21       Impact factor: 5.917

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.