Efflux-mediated fluoroquinolone resistance in the multidrug-resistant Pseudomonas aeruginosa clinical isolate PA7: identification of a novel MexS variant involved in upregulation of the mexEF-oprN multidrug efflux operon.

The emergence of multidrug-resistant Pseudomonas aeruginosa has become a serious problem in medical settings. P. aeruginosa clinical isolate PA7 is resistant to fluoroquinolones, aminoglycosides, and most β-lactams but not imipenem. In this study, enhanced efflux-mediated fluoroquinolone resistance of PA7 was shown to reflect increased expression of two resistance nodulation cell division (RND) -type multidrug efflux operons, mexEF-oprN and mexXY-oprA. Such a clinical isolate has rarely been reported because MexEF-OprN-overproducing mutants often increase susceptibility to aminoglycosides apparently owing to impairment of the MexXY system. A mutant of PA7 lacking three RND-type multidrug efflux operons (mexAB-oprM, mexEF-oprN, and mexXY-oprA) was susceptible to all anti-pseudomonas agents we tested, supporting an idea that these RND-type multidrug efflux transporters are molecular targets to overcome multidrug resistance in P. aeruginosa. mexEF-oprN-upregulation in P. aeruginosa PA7 was shown due to a MexS variant harboring the Valine-155 amino acid residue. This is the first genetic evidence shown that a MexS variant causes mexEF-oprN-upregulation in P. aeruginosa clinical isolates.

Introduction

Pseudomonas aeruginosa is a metabolically versatile bacterium that can cause a wide range of severe opportunistic infections in patients with serious underlying medical conditions (Gellatly and Hancock, 2013). Infections caused by P. aeruginosa often are hard to treat; inappropriate chemotherapy readily selects multidrug-resistant P. aeruginosa against which very few agents are effective (Morita et al., 2014; Poole, 2014). This so-called “antibiotic resistance crisis” has been compounded by the lagging in antibiotic discovery and development programs occurred in recent years, and is jeopardizing the essential role played by antibiotics in current medical practices (Rossolini et al., 2014). To combat this organism, it is very useful to understand its antimicrobial resistance mechanisms (see reviews such as Breidenstein et al., 2011; Poole, 2011; Morita et al., 2015).

The complete genome sequence of the multiresistant P. aeruginosa PA7 has been determined (Roy et al., 2010). The sequence of this strain, which exhibits resistance to fluoroquinolones (FQs), aminoglycosides, and various β-lactams but is susceptible to carbapenems (imipenem), includes typical FQ-resistance mutations in gyrA (Thr83Ile) and parC (Ser87Leu) (Roy et al., 2010). PA7 has additionally acquired a mutated aacA4 gene, the product of which (AAC(6′)-II) endows the strain with aminoglycoside (gentamicin and tobramycin) resistance (Roy et al., 2010). This clinical isolate is amenable to the construction of gene knock-out mutations, thereby facilitating the analysis of molecular mechanisms of multidrug antimicrobial resistance in this isolate. Previously we showed that the effect of the modifying enzyme is enhanced by the MexXY resistance nodulation cell division (RND) -type multidrug efflux system, especially in the presence of divalent cations, providing high-level aminoglycoside resistance in P. aeruginosa (Morita et al., 2012b). This observation emphasizes the importance of the MexXY multidrug efflux system for aminoglycoside resistance in multidrug-resistant P. aeruginosa clinical isolates (Morita et al., 2012a).

Four members of the RND family of multidrug efflux systems, MexAB-OprM, MexCD-OprJ, MexEF-OprN, and MexXY have been implicated in FQ resistance in P. aeruginosa clinical isolates (Poole, 2011). As in other organisms, these RND family drug efflux transporters in P. aeruginosa operates as three-component pumps with an RND cytoplasmic membrane (CM) protein (MexB, MexD, MexF, and MexY) linked to an outer membrane channel-forming protein (OprM, OprJ, and OprN) by a CM-tethered periplasmic protein (MexA, MexC, MexE, and MexX) (Poole, 2013). Intriguingly PA7 possesses the mexXY-oprA multidrug efflux operon of which oprA is missing in most P. aeruginosa strains (Roy et al., 2010). We showed that the MexXY can utilize either the OprA or OprM as an outer membrane component of the tripartite efflux pump (Morita et al., 2012b). Multidrug-resistant P. aeruginosa clinical isolates, including carbapenem-resistant P. aeruginosa, often have been reported to be MexXY and/or MexAB-OprM overproducers (e.g., Hocquet et al., 2007; Cabot et al., 2011; Fuste et al., 2013; Khuntayaporn et al., 2013; Vatcheva-Dobrevska et al., 2013). FQ efflux is mediated by the MexAB-OprM system constitutively produced at moderate levels in wild-type P. aeruginosa PAO1 (Morita et al., 2001; Poole, 2013). Expression of mexAB-oprM is controlled directly or indirectly by three repressors encoded by the mexR, nalC and nalD genes, with inactivating mutations in any of these resulting in increased mexAB-oprM expression (Poole, 2011, 2013). In addition, nfxB and nfxC mutants (which overproduce components of the MexCD-OprJ and MexEF-OprN systems, respectively) are well-known as efflux-mediated FQ-resistant mutants of laboratory and clinical isolates of P. aeruginosa, although nfxB mutations appear to be rare in clinical settings (Poole, 2011). nfxC mutants also show increased resistance to carbapenems such as imipenem, not because MexEF-OprN accommodates these agents but because of a coordinated, MexT-dependent reduction of OprD production in such mutants (Poole, 2011, 2013). Hyperexpression of mexEF-orpN (and reduction in oprD expression) is also seen in laboratory isolates disrupted in the mexS gene, which encodes a putative oxidoreductase (a.k.a qrh) of unknown function (Sobel et al., 2005; Lamarche and Deziel, 2011). There are, however, no reports (to our knowledge) with experimental evidence of mexEF-oprN-expressing clinical isolates harboring mutations in mexS (Poole, 2013), although some studies suggested possible mutation of mexS in nfxC-type clinical isolates (e.g., Llanes et al., 2011; Fournier et al., 2013). The incidence of MexXY overproducers among clinical isolates has shown to be linked to the use of ciprofloxacin (Hocquet et al., 2008) and MexXY overproducers have been often reported to be one of major phenotypes in multidrug resistant clinical isolates (Morita et al., 2012a; Poole, 2013). However, MexXY-expressing FQ-resistance or its contribution to FQ-resistance in clinical settings has not well been studied compared to the other three pumps. In this study, we used reverse genetics to investigate the role of efflux-mediated FQ resistance in multidrug-resistant P. aeruginosa clinical isolate PA7.

Materials and methods

Bacterial strains, plasmids, and growth conditions

The bacterial strains and plasmids used in this study are listed in Table 1. Bacterial cells were grown in Luria (L) broth and on L agar (1.5%) under aerobic conditions at 37°C as previously described, unless otherwise indicated, with antibiotics as necessary (Morita et al., 2010). Bacterial growth was quantified by measuring the optical density at 600 nm on an Ultrospec 2100 Pro Spectrophotometer (GE Healthcare Corp., Tokyo, Japan), unless otherwise indicated. The plasmids pEX18Tc (Hoang et al., 1998), pYM101 (Morita et al., 2010), and their derivatives were maintained and selected using medium supplemented with 2.5-10 μg tetracycline ml−1 for E. coli or 50–150 μg tetracycline ml−1 for P. aeruginosa. The plasmids pUCP20T (Schweizer et al., 1996) and pFLP2 (Hoang et al., 1998) and their derivatives were maintained and selected using medium supplemented with 100 μg ampicillin ml−1 for E. coli or 200 μg carbenicillin ml−1 for P. aeruginosa.

Table 1

Bacterial strains and plasmids.

Strains or plasmids	Relevant characteristics	References
E. COLI
DH5α (PAGUg121)	For recombinant DNA manipulation	Morita et al., 2010
KAM3 (PAGUg846)	For recombinant DNA manipulation	Morita et al., 1998
S17-1 (PAGUg856)	For conjugational transfer	Morita et al., 2006
P. AERUGINOSA
PAO1 (PAGU 974)	Wild type	Morita et al., 2006
PA7 (PAGU 1498)	Multi-resistant clinical isolate	Roy et al., 2010
PAGUg1565	PA7 ΔmexXY-oprA	Morita et al., 2012b
PAGUg1603	PA7 ΔmexAB-oprM	Morita et al., 2012b
PAGUg1748	PA7 ΔmexEF-oprN	This study
PAGUg1641	PA7 ΔmexXY-oprA ΔmexAB-oprM	Morita et al., 2012b
PAGUg1751	PA7 ΔmexXY-oprA ΔmexEF-oprN	This study
PAGUg1753	PA7 ΔmexAB-oprM ΔmexEF-oprN	This study
PAGUg1756	PA7 ΔmexXY-oprA ΔmexAB-oprM ΔmexEF-oprN	This study
PAGUg1793	PA7 ΔmexS	This study
PAGUg1789	PA7 ΔmexT	This study
PAGUg1867	PA7 mexS(V155A)	This study
DSM 1128 (PAGU 1504)	Taxonomically PA7-related strain, wild-type	Kiewitz and Tummler, 2000
K2153 (PAGU 1741)	Clinical isolate	Sobel et al., 2003
K2376 (PAGUg1834)	K2153 ΔmexS	Fetar et al., 2011
PAGUg1850	K2153 ΔmexS attB::lacIq-PT7	This study
PAGUg1851	K2153 ΔmexS attB::lacIq-PT7-mexSPA7	This study
PAGUg1844	K2153 ΔmexS attB::lacIq-PT7-mexSDSM 1128	This study
PAGUg1854	K2153 ΔmexS pUCP20T	This study
PAGUg1855	K2153 ΔmexS pUCP20T::mexSPA7	This study
PAGUg1856	K2153 ΔmexS pUCP20T::mexSDSM 1128	This study
PAGUg1835	K2153 ΔmexT	Fetar et al., 2011
PAGUg1836	K2153 ΔmexF	Fetar et al., 2011
K2942 (PAGUg1837)	K2153 ΔmexS ΔmexT	Fetar et al., 2011
PAGUg1852	K2153 ΔmexS ΔmexT attB::lacIq-PT7	This study
PAGUg1846	K2153 ΔmexS ΔmexT attB::lacIq-PT7-mexTPA7	This study
PAGUg1845	K2153 ΔmexS ΔmexT attB::lacIq-PT7-mexTDSM 1128	This study
PLASMID
pEX18Tc	Broad-host-range gene replacement vector	Hoang et al., 1998
pYM133	pEX18Tc::ΔmexEF-oprN	This study
pYM134	pEX18Tc::ΔmexS	This study
pYM135	pEX18Tc::ΔmexT	This study
pYM136	pEX18Tc::ΔmexST	This study
pYM137	pEX18Tc::mexSPA7	This study
pYM138	pEX18Tc::mexSPA7(V155A)	This study
pYM101	P. aeruginosa chromosome integration vector	Morita et al., 2010
pYM139	pYM101::mexSPA7	This study
pYM140	pYM101::mexSDSM 1128	This study
pYM141	pYM101::mexTPA7	This study
pYM142	pYM101::mexTDSM 1128	This study
pUCP20T	Broad-host-range cloning vector	Schweizer et al., 1996
pYM143	pUCP20T::mexSPA7	This study
pYM144	pUCP20T::mexSDSM 1128	This study
pFLP2	Flp recombinase-producing plasmid	Hoang et al., 1998

Molecular biology techniques

Plasmid DNA isolation from E. coli, DNA purification, measuring DNA concentration, DNA digestion with restriction enzymes, DNA dephosphorylation, DNA ligation, isolation of chromosomal DNA from P. aeruginosa, PCR conditions, nucleotide sequencing, competent cell preparation from E. coli, transformation of E. coli, and transfer of plasmids into P. aeruginosa via conjugation were performed as described previously (Morita et al., 2010), unless otherwise indicated. DNA sequences and amino acid sequences were analyzed through 2012 to 2013 with Pseudomonas Genome Database (Winsor et al., 2011), Basic Local Alignment Search Tool (BLAST) (Boratyn et al., 2013), SWISS-MODEL (Bordoli et al., 2009), Sorting Tolerant From Intolerant (SIFT) BLink (Kumar et al., 2009), and the software DNASIS Pro (Ver. 2.1; Hitachi, Japan).

Cloning of mexS and mexT from P. aeruginosa

mexS and mexT from P. aeruginosa (without endogenous promoters) were amplified by PCR using the primers listed in Table 2. The purified mexS PCR product, digested with BamHI and HindIII, was cloned into similarly digested, dephosphorylated pUCP20T and pYM101, yielding pUCP20T::mexS and pYM101::mexS. The purified mexT PCR product, digested with EcoRI and BamHI, was cloned into similarly digested, dephosphorylated pUCP20T and pYM101, yielding pUCP20T::mexT and pYM101::mexT.

Table 2

Primers used in this study.

Primer	Sequence(5′–3′)	Purpose	References
EcoRI-mexEPA7-UF	GAT CGA ATT CTG GCC TCG GGG GAA ATC T	mexEF-oprN genes disruption of P. aeruginosa PA7	This study
BamHI-mexEPA7-UR	CTG AGG ATC CAT GCT TGA CTC CGC CAG TC	mexEF-oprN genes disruption of P. aeruginosa PA7	This study
BamHI-oprNPA7-DF	CTG AGG ATC CTG AAC CGG CTA TCC CCG G	mexEF-oprN genes disruption of P. aeruginosa PA7	This study
XhoI-oprNPA7-DR	GAT CCT CGA GCG CCG ACA GCG ATT GCC A	mexEF-oprN genes disruption of P. aeruginosa PA7	This study
BamHI-mexSPA7-F	GAT CGG ATC CGA TGC ACT GCA GAG GTT TGC	mexS gene cloning of P. aeruginosa PA7 and DSM 1128	This study
HindIII-mexSPA7-R	CTA GAA GCT TCA ATC GGC GAC GTG GAT	mexS gene cloning of P. aeruginosa PA7 and DSM 1128	This study
EcoRI-mexSPA7-UF	GCT AGA ATT CAG TTC GTC GGT GTA GCT GA	mexS gene disruption of P. aeruginosa PA7	This study
BamHI-mexSPA7-UR	CTA GGG ATC CGG ACA TCG CAA ACC TCT G	mexS gene disruption of P. aeruginosa PA7	This study
BamHI-mexSPA7-DF	GCT AGG ATC CGT CGC CGA TTG AGG ACG AC	mexS gene disruption of P. aeruginosa PA7	This study
HindIII-mexSPA7-DR	CTA GAA GCT TAG TAC ATC CAC GCG CAC CT	mexS gene disruption of P. aeruginosa PA7	This study
EcoRI-mexTPA7-F	GAT CGA ATT CCC CTG GAA ACG AGG AAC	mexT gene cloning of P. aeruginosa PA7 and DSM 1128	This study
BamHI-mexTPA7-R	GAT CGG ATC CTC AGA GGC TGT CCG GGT C	mexT gene cloning of P. aeruginosa PA7 and DSM 1128	This study
SacI-mexTPA7-UF	GCT AGA GCT CTG GAA ACG ATC ACC CGC G	mexT gene disruption of P. aeruginosa PA7	This study
BamHI-mexTPA7-UR	CTG AGG ATC CAT GGC GTT CCT CGT TTC C	mexT gene disruption of P. aeruginosa PA7	This study
BamHI-mexTPA7-DF	GCT AGG ATC CGG ACA GCC TCT GAG TCA TCC ACG	mexT gene disruption of P. aeruginosa PA7	This study
HindIII-mexTPA7-DR	CTA GAA GCT TGC GAC CGC CGC CCT GGC TT	mexT gene disruption of P. aeruginosa PA7	This study
mexSPA7(V155A)-F	CTG ATC ACC GAG GCG GCG CGC ATG TAC GGG CC	mexS(V155A) site directed mutagenesis of P. aeruginosa PA7	This study
mexSPA7(V155A)-R	GGC CCG TAC ATG CGC GCC GCC TCG GTG ATC AG	mexS(V155A) site directed mutagenesis of P. aeruginosa PA7	This study
mexTS intergenic seq	GCA CCA GGA CTT CCC CTG	DNA sequencing of mexT-mexS intergenic region	This study
uvrD-F	ATCGACTTCTCCGAGCTGCTG	RT-PCR for uvrD gene of P. aeruginosa	Morita et al., 2012b
uvrD-R	CTGGAACTCGTCCACCAGGAT	RT-PCR for uvrD gene of P. aeruginosa	Morita et al., 2012b
mexE-F (RT)	CCA CCC TGA TCA AGG ACG AAG	RT-PCR for mexE gene of P. aeruginosa	This study
mexE-R (RT)	CGG TAG ACG GTC TTG TTG TCG	RT-PCR for mexE gene of P. aeruginosa	This study
mexS-F (RT)	AGG GCG TCA ATG TCA TCC TC	RT-PCR for mexS gene of P. aeruginosa	This study
mexS-R (RT)	CTG CAG GTG CTT CTT GAA CG	RT-PCR for mexS gene of P. aeruginosa	This study
mexT-F (RT)	TAT TGA TGC CGA ACC TGC TG	RT-PCR for mexT gene of P. aeruginosa	This study
mexT-R (RT)	GGA GGA TCT TCG GCT TGC TG	RT-PCR for mexT gene of P. aeruginosa	This study
oprD-F (RT)	ATT GCA CTG GCG GTT TCC	RT-PCR for oprD gene of P. aeruginosa	This study
oprD-R (RT)	ATG AAC CCC TTC GCT TCG	RT-PCR for oprD gene of P. aeruginosa	This study
mexA-F (RT)	GAC AAC GCT ATG CAA CGA ACG	RT-PCR for mexA gene of P. aeruginosa	This study
mexA-R (RT)	AGC TCG GTA TTC AGC GTC ACC	RT-PCR for mexA gene of P. aeruginosa	This study

Construction of in-frame deletion mutants from P. aeruginosa

In-frame deletion mutants of mexEF-oprN, mexS, and mexT from P. aeruginosa PA7 and its derivatives were constructed using the previously described sacB-based strategy (Morita et al., 2006, 2010). The plasmids and resulting P. aeruginosa mutants are listed in Table 1, while the primer pairs are listed in Table 2. The selection concentrations of tetracycline for the first homologous recombination event were adjusted to reflect the endogenous tetracycline MICs for the P. aeruginosa strains. These constructs were confirmed by colony PCR.

Construction of the ΦCTX-based site-specific integrants in P. aeruginosa

For gene complementation experiments in P. aeruginosa, Φ CTX phage-based site-specific integrants were constructed using the integration-proficient, tightly controlled expression vector pYM101 and associated techniques (conjugative transfer, gene replacement at the chromosomal attB site, and curing of the unwanted plasmid backbone from the chromosome via the pFLP2-encoded Flp recombinase) as previously described (Morita et al., 2010).

Site-directed mutagenesis of mexS in the chromosome of P. aeruginosa PA7

An amino acid substitution (Val155Ala) mutation was introduced into the mexS gene of the insert in the plasmid pUC20T::mexS. Site-directed mutagenesis within a target plasmid was carried out according to Geiser et al. (2001) and Morita et al. (2009). A 50-μl mixture consisting of 50 ng of plasmid DNA, 0.25 μM of each mutagenic primer pair (Table 2), 0.2 mM each deoxynucleoside triphosphate, 1 mM MgSO4, 2.5 U of KOD Hot Start DNA polymerase -Plus- Ver.2 (TOYOBO Co. Ltd., Osaka, Japan), 1× KOD buffer, and 4.0% (vol/vol) dimethyl sulfoxide was heated to 94°C for 2 min followed by 18 cycles of 0.5 min at 94°C, 1 min at 60°C, and 5 min at 68°C. The resulting DNA products were purified as above, digested overnight with 10 U DpnI (Roche Diagnostics K.K., Tokyo, Japan) to eliminate template plasmid), and used to transform E. coli DH5α. Plasmids were recovered from individual transformants, and the mexS insert was sequenced to identify plasmids bearing the desired mutation. The mexS insert carrying the mutation was digested with BamHI and HindIII and cloned into similarly digested and dephosphorylated pEX18Tc to yield pEX18Tc::mexS. The mexS mutation was gene replaced onto the chromosome of P. aeruginosa PA7 using the previously described sacB-based strategy (Morita et al., 2009, 2012b).

Antibiotic susceptibility assay

The susceptibility of P. aeruginosa to antimicrobial agents in cation-adjusted Mueller–Hinton broth was assessed using the 2-fold serial microtiter broth dilution method described previously (Morita et al., 2012b). Minimal inhibitory concentrations (MICs) were defined as the lowest concentration of antibiotic resulting in visible inhibition of growth after 18 h of incubation at 37°C. MICs for the Φ CTX-based site-specific integrants were determined in the presence of the inducer 5 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG). The categorization in susceptible, intermediate, and resistant was performed according to the interpretive standards of the Clinical and Laboratory Standards Institute (CLSI) (Patel et al., 2011).

Antimicrobial agents

Amikacin, ampicillin, carbenicillin, chloramphenicol, ciprofloxacin, norfloxacin, and tetracycline were purchased from Wako Pure Chemicals Industries, Ltd (Osaka, Japan). Moxifloxacin and levofloxacin were purchased from LKT Laboratories, Inc. (St. Paul, MN, USA). Imipenem/cilastatin was purchased from Sandoz K.K. (Tokyo, Japan).

Real-time quantitative reverse transcriptase (qRT)-PCR

Overnight cultures of P. aeruginosa strains were diluted 1:100 in 10 ml, incubated with vigorous shaking at 37°C for 3–4 h, and harvested. Total RNA was stabilized with the RNA Protect Bacteria Reagent (Qiagen) and isolated with the RNeasy Mini Kit (Qiagen). The RNA samples were further treated with RQ1 RNase-Free DNase (Promega) and purified by using the RNeasy Mini Kit (Qiagen). Real-time qRT-PCR was performed with primer pairs internal to uvrD, mexE, mexS, mexT, and oprD (Table 2) using the One Step SYBR PrimeScript RT-PCR kit II (TaKaRa) in a Thermal Cycler Dice real-time system (TaKaRa). The transcript levels of the target gene in a given strain were normalized to levels of uvrD and expressed as a ratio (fold change) to that observed in the parental PA7 strain. Gene expression values were calculated based on triplicate experiments.

Nucleotide sequence accession number

The nucleotide sequences of DNA regions containing mexT and mexS in P. aeruginosa DSM 1128 have been deposited in GenBank/EMBL/DDBJ with the accession number AB889539.

Results

Contribution of RND multidrug efflux systems to FQ resistance in P. aeruginosa PA7

FQ resistance in P. aeruginosa PA7 was compared with the two FQ-susceptible strains, PAO1 (the standard laboratory strain) and DSM 1128 (a strain taxonomically related to PA7) (Morita et al., 2012b). The MICs of the FQs (ciprofloxacin, levofloxacin, moxifloxacin, and norfloxacin) for P. aeruginosa PA7, PAO1, and DSM 1128 are shown in Table 3. P. aeruginosa PA7 exhibited increased resistance (ca. 256-fold) to these FQs compared to P. aeruginosa PAO1 and DSM 1128. P. aeruginosa DSM 1128 showed the same level of resistance to the FQs as P. aeruginosa PAO1. Based on the interpretive standards of the CLSI (Patel et al., 2011), P. aeruginosa PA7 was considered highly resistant to these FQs. This observation is not surprising, because P. aeruginosa PA7 possesses typical target mutations, one in gyrA (Thr83Ile) and one in parC (Ser87Leu), well-known to be associated with FQ resistance (Lomovskaya et al., 1999). However, target mutations alone are not sufficient to explain high-level FQ resistance in P. aeruginosa; the additional effect of up-regulation of one of the four RND efflux pumps (MexXY-OprA, MexAB-OprM, MexCD-OprJ, or MexEF-OprN) is necessary (Lomovskaya et al., 1999; Bruchmann et al., 2013).

Table 3

Contribution of three RND efflux pumps to antimicrobial resistance of .

Strain	Genotype	MIC (μg/ml) of
		CIP	NOR	LVX	MXF	AMK	CHL	IPM
PA7 (PAGU 1498)	Parent	64	128	128	256	32	1024	2
PAGUg1565	PA7 ΔmexXY-oprA	32	64	64	128	1	1024	2
PAGUg1603	PA7 ΔmexAB-oprM	64	128	64	256	32	1024	2
PAGUg1748	PA7 ΔmexEF-oprN	32	64	64	256	32	128	2
PAGUg1641	PA7 ΔmexXY-oprA ΔmexAB-oprM	32	64	32	64	1	1024	2
PAGUg1751	PA7 ΔmexXY-oprA ΔmexEF-oprN	8	16	8	32	1	256	2
PAGUg1753	PA7 ΔmexAB-oprM ΔmexEF-oprN	32	64	32	128	32	16	2
PAGUg1756	PA7 ΔmexXY-oprA ΔmexAB-oprM ΔmexEF-oprN	0.5	0.5	0.5	2	1	4	2
DSM 1128 (PAGU 1504)	Wild type	0.125	0.25	0.25	1	0.5	32	1
PAO1 (PAGU 974)	Wild type	0.125	0.25	0.25	1	0.5	32	1

AMK, amikacin; CHL, chloramphenicol; CIP, ciprofloxacin; IPM, imipenem; LVX, levofloxacin; MXF, moxifloxacin; NOR, norfloxacin.

Previously we showed that the ΔmexXY-oprA ΔmexAB-oprM double mutant of PA7 was slightly more susceptible (ca. 2- to 4-fold) to ciprofloxacin, while retaining high-level resistance (MIC = 32 μg/ml) to this antibiotic when compared to its parental strain (Morita et al., 2012b). That observation was inconsistent with data, derived via similar genetic analyses, in which a PAO1-derived ΔoprM gyrA parC triple mutant (i.e., a strain deleted for oprM and carrying the target mutations) exhibited increased susceptibility (64-fold) to levofloxacin compared to an isogenic MexAB-OprM overexpressing (nalB) mutant, while exhibiting an MIC (0.5 μg/ml) of levofloxacin similar to that of the wild-type PAO1 (0.25 μg/ml) (Lomovskaya et al., 1999). We noted that deletion of oprM in PAO1 was expected to inactivate any efflux pumps that require OprM as an outer membrane factor (e.g., MexAB-OprM, MexXY-OprM, MexVW-OprM) (Morita et al., 2001; Li et al., 2003). We therefore hypothesized that overexpression of other RND pumps such as MexCD-OprJ and MexEF-OprN was compensating for the effects of the mexAB-oprM mexXY-oprA double deficiency in PA7. As a first step in testing our hypothesis, we examined the primary sequences of the efflux system-encoding genes of PA7. Sequence analysis revealed the presence of mexCD-oprJ (PSPA7_0540- 0539- 0538) and mexEF-oprN (PSPA7_2745-2744-2743) homologs in P. aeruginosa PA7 (Roy et al., 2010), with predicted amino acid lengths (in PA7) and amino acid sequence identity and similarity [respectively; via BLAST of PA7 vs. PAO1-UW (Winsor et al., 2011)] as follows: MexC (387 aa; 88 and 95%), MexD (1043 aa; 95 and 98%,), OprJ (475 aa; 89 and 93%); MexE (414 aa; 99 and 99%), MexF (1062 aa; 99 and 99%), and OprN (472 aa; 97 and 99%). As a second step in testing our hypothesis, we examined the regulation of these genes in PA7. qRT-PCR showed that expression of mexE was increased (ca. 22-fold) in PA7 compared to the wild-type strain DSM 1128. This observation indicated that FQ resistance in P. aeruginosa can be mediated by overexpression of the mexEF-oprN operon, in addition to the previously reported overexpression of mexXY-oprA due to mutation of the local repressor gene (mexZ) (Morita et al., 2012b).

We also observed that a ΔmexXY-oprA ΔmexAB-oprM ΔmexEF-oprN triple mutant derived from PA7 exhibited increased susceptibility to FQs (32–128-fold) compared to an isogenic ΔmexXY-oprA ΔmexAB-oprM double mutant, while exhibiting only mild elevation of FQ MIC (0.5–2 μg/ml) compared to wild-type PAO1 and DSM 1128 (0.125–1 μg/ml) (Table 3). Moreover, the triple mutant was much more sensitive (512-fold) to chloramphenicol than the double mutant, a further indicator of MexEF-OprN-mediated resistance (Sobel et al., 2005) (Table 3). We excluded a role for overexpression of mexCD-oprJ in PA7, as judged by the susceptibilities of the mutant (ΔmexXY-oprA ΔmexAB-oprM ΔmexEF-oprN construct) to not only FQs but also to tetracycline and chloramphenicol, which are substrates of MexCD-OprJ (Poole et al., 1996).

To clarify the roles of MexXY-OprA, MexAB-OprM and MexEF-OprN multidrug efflux pumps in the FQ resistance of P. aeruginosa PA7, we constructed a series of deletion mutants of the three mex operons and examined their drug susceptibility profiles (Table 3). We observed that the ΔmexXY-oprA ΔmexEF-oprN double deletion mutant was more susceptible (4-fold) than the ΔmexAB-oprM ΔmexXY-oprA double mutant and the ΔmexAB-oprM ΔmexEF-oprN double mutant (Table 3). These data suggested that the MexXY-OprA and MexEF-OprN systems make similar contributions to FQ resistance in P. aeruginosa PA7, each having an effect larger than that of MexAB-OprM. The apparent modest MexAB-OprM contribution to resistance of FQs and chloramphenicol in PA7 [PA7 ΔmexXY-oprA ΔmexEF-oprN vs. PA7 ΔmexXY-oprA ΔmexAB-oprM ΔmexEF-oprN (Table 3)] is typically observed in wild type P. aeruginosa such as PAO1 already shown in the previous results (e.g., PAO1 ΔmexXY vs. PAO1 ΔmexXY ΔmexAB-oprM) (e.g., Morita et al., 2001), implying that mexAB-oprM is expressed at moderate levels in PA7. We concluded that high-level FQ resistance in P. aerguinosa PA7 was due to overproduction of MexXY-OprA and MexEF-OprN, in addition to the typical target mutations.

Molecular mechanisms of mexEF-oprN-upregulation in P. aeruginosa PA7

The mexEF-oprN operon is quiescent in wild-type P. aeruginosa cells grown under standard laboratory conditions. In contrast, this operon is expressed in so-called nfxC mutants and in mutants defective in the mexS gene (previously known as qrh), a locus that encodes a putative oxidoreductase of as yet unknown function (Poole, 2013). Expression of mexEF-oprN is regulated by a transcriptional activator, MexT, a LysR family regulator (Kohler et al., 1999; Poole, 2013). mexT occurs upstream of mexEF-oprN and downstream of mexS, the latter gene also positively regulated by MexT (Kohler et al., 1999). Unusually, many so-called wild type strains possess inactive MexT (e.g., 8 bp insertion in mexT present in some PAO1 strains) (Maseda et al., 2000; Poole, 2013). The induction of mexEF-oprN contributes to multidrug resistance, albeit against a rather narrow range of antimicrobials including FQs, trimethoprim, and chloramphenicol (Poole, 2013). The enhanced resistance to imipenem of nfxC mutants or mexS deficient mutants results not from mexEF-oprN expression but the concomitant decrease in the level of outer membrane protein OprD (Poole, 2013), because OprD is an imipenem channel and serves as the primary route of entry of this antibiotic in P. aeruginosa (Trias and Nikaido, 1990). However, P. aeruginosa PA7 was reported to be susceptible to carbapenems, with MICs of 2 and 1 μg/ml for imipenem and meropenem, respectively (Roy et al., 2010). This observation of carbapenem susceptibility is somewhat paradoxical, given that a typical nfxC mutant or a mexS deficient mutant is expected to exhibit carbapenem resistance due to a coordinate, MexT-dependent reduction of OprD levels. We found that P. aeruginosa PA7 exhibited slight but reproducible elevation (2-fold) of resistance to imipenem compared to wild-type P. aeruginosa strains PAO1 and DSM 1128 (Table 4). Deletion of mexS in a PA7 background resulted in slightly increased expression of mexE (2-fold) and increased resistance to imipenem (4-fold) compared to PA7. Thus, PA7 appeared to exhibit susceptibility intermediate between that of wild type and a typical nfxC mutant. Deletion of mexT in a PA7 background resulted in drastically (>200-fold) decreased expression of mexE and mexS compared to PA7 (Table 4). Notably, expression of mexS in PA7 ΔmexT was more than 96-fold reduced compared to the wild-type DSM 1128 and PA7 mexS (V155A). This observation was consistent with a previous report (using β-galacotosidase reporter assays) indicating that mexS (qrh) is constitutively expressed at a moderate level (Kohler et al., 1999; Poole, 2013).

Table 4

Relationship between antimicrobial resistance and .

Strains	Genotype	MIC (μg/ml) of			Relative mRNA level
		CIP	CHL	IPM	mexE	mexS	mexT
PA7 (PAGU 1498)	Parent	128	1024	2	1	1	1
PAGUg1793	PA7 ΔmexS	>128	>1024	8	2.0	nd	0.84
PAGUg1867	PA7 mexS(V155A)	64	256	1	0.053	0.57	0.74
PAGUg1789	PA7 ΔmexT	64	128	1	<0.005	<0.005	nd
DSM 1128 (PAGU 1504)	Wild type	0.125	32	1	0.046	0.48	1.1
PAO1 (PAGU 974)	Wild type	0.125	32	1	nd	nd	nd

CHL, chloramphenicol; CIP, ciprofloxacin; IPM, imipenem; nd, not done.

We therefore determined the nucleotide sequences (ca. 2.4 kb) upstream of the mexEF-oprN operon in P. aeruginosa DSM 1128 (accession no. AB889539). This interval corresponds to the operon's cognate regulatory region, and includes the mexS and mexT loci. Comparison to the corresponding sequences from P. aeruginosa PA7 (data not shown) revealed that MexSPA7 is encoded as an A155V variant, and MexTPA7 as an A256T variant, compared to the DSM 1128 genome. In contrast, alanine-155 of MexS and alanine-256 of MexT are conserved among multiple laboratory and clinical strains, including PAO1, PA14, PAK, and K2153 (Sobel et al., 2005; Jin et al., 2011; Lamarche and Deziel, 2011). To test the function of the mexS and mexT loci, we amplified and cloned the individual mexS and mexT genes (without endogenous promoters) from P. aeruginosa PA7 and DSM 1128, and expressed the relevant genes in P. aeruginosa K2153 ΔmexS (Fetar et al., 2011) for a mexS complementation test or in K2153 ΔmexS ΔmexT (Sobel et al., 2005; Fetar et al., 2011) for a mexT complementaton test (Table 5). [As demonstrated by other researchers, P. aeruginosa K2153 and its derivatives are useful for the analysis of mexEF-oprN-dependent antimicrobial resistance as regulated by the MexT activator and MexS function (Sobel et al., 2005; Fetar et al., 2011)]. Interestingly, introduction of mexS or mexS into the chromosome of K2153 ΔmexS did not provide complementation of ΔmexS (Table 5). These data contrast previous instances in which we observed attB-site (i.e., single-copy) complementation for several other genes (Morita et al., 2010, 2012b). Presumably, in the present studies, failure to complement reflected insufficient mexS expression from the P promoter in PAGUg1844, given that MexSDSM 1128 is expected to be functional. Introduction of pUCP20T::mexS into P. aeruginosa K2153 ΔmexS yielded MICs identical to those of the K2153 mexS parent; introduction of pUCP20T::mexS yielded parent-like resistance to imipenem, but only partially restored resistance to ciprofloxacin and chloramphenicol (Table 5). Taken together, these results suggested that MexSPA7 provides reduced function compared to MexSDSM 1228. Additionally it appears that the high levels of mexS expression are required to overcome the nfxC-type antimicrobial resistance.

Table 5

Functional characterization of .

Strains	Genotype	MIC (μg/ml)
		CIP	CHL	IPM
K2153 (PAGU 1741)	Parent	0.5	64	2
K2376 (PAGUg1834)	ΔmexS	2	2048	8
PAGUg1850	ΔmexS attB::lacIq-PT7	2	2048	8
PAGUg1851	ΔmexS attB::lacIq-PT7-mexSPA7	2	2048	8
PAGUg1844	ΔmexS attB::lacIq-PT7-mexSDSM 1128	2	1024	8
PAGUg1854	ΔmexS pUCP20T	2	2048	8
PAGUg1855	ΔmexS pUCP20T::mexSPA7	1	256	4
PAGUg1856	ΔmexS pUCP20T::mexSDSM 1128	0.5	64	2
K2942 (PAGUg1837)	DmexS ΔmexT	0.5	64	2
PAGUg1852	ΔmexS ΔmexT attB::lacIq-PT7	0.5	64	2
PAGUg1846	ΔmexS ΔmexT attB::lacIq-PT7-mexTPA7	2	2048	8
PAGUg1845	ΔmexS ΔmexT attB::lacIq-PT7-mexTDSM 1128	2	2048	8

CHL, chloramphenicol; CIP, ciprofloxacin; IPM, imipenem.

5 mM IPTG was added to allow expression controlled by the P.

Slightly increased expression of mexS was observed in P. aeruginosa PA7 compared to P. aeruginosa DSM 1128 (ca. 2-fold), while expression levels of mexT in P. aeruginosa PA7 were similar to those in P. aeruginosa DSM 1128 (c.a. 0.9-fold) (Table 4). Introduction of mexT or mexT into the chromosome of K2153 ΔmexS ΔmexT yielded the nfxC phenotype (Table 5), suggesting that the A256T substitution in MexT is not a primary reason for overexpression of mexEF-oprN in P. aeruginosa PA7. Using site-specific mutagenesis, we altered the plasmid-borne mexS locus to encode a V155A version of the protein and replaced the endogenous PA7 chromosomal locus with the mutated gene. The PA7 mexS strain showed decreased mexE expression (0.053-fold compared to that of the PA7 parent), a value similar to that seen in DSM 1128 (0.034-fold compared to that of PA7) (Table 4). The PA7 mexS strain also showed decreased MICs for chloramphenicol (0.25-fold) (Table 4). Taken together with the complementation experiments, these data strongly suggested that the A155V substitution in MexSPA7 is the primary reason for increased expression of mexEF-oprN and increased antimicrobial resistance in the PA7 strain.

Discussion

In this study, the multidrug-resistant clinical isolate PA7 was shown to exhibit increased expression of mexEF-oprN as well as mexXY-oprA. Although multidrug-resistant P. aeruginosa clinical isolates have often been reported to be MexXY overproducers (Morita et al., 2012a), clinical strains of P. aeruginosa overproducing MexEF-OprN and MexXY(-OprA) efflux pumps simultaneously have rarely been reported. In fact, PA7 was not a typical nfxC mutant (i.e., a MexEF-OprN overproducer), and instead expressed intermediate levels of mexEF-oprN. We assume that simultaneous overproduction of MexEF-OprN and MexXY(-OprA) impairs P. aeruginosa growth, based on our observation that our PA7 ΔmexS construct (i.e., a simultaneous overproducer of MexEF-OprN and MexXY-OprA compared to the PA7 parent) was unstable even on L agar plates: colonies of the construct exhibited a non-uniform phenotype during growth on plates (data not shown). This observation is consistent with the increased susceptibility to aminoglycosides previously observed in MexEF-OprN-overproducing nfxC mutants, apparently owing to impairment of the MexXY system (Sobel et al., 2005).

Valine-155 of MexSPA7 also was shown as the likely primary reason for increased production of MexEF-OprN in PA7. With the exception of mexS, sequenced P. aeruginosa mexS genes (including those from PAO1, K2153, PA14, PAK, and DSM 1128) encode proteins with an alanine at residue 155 (Sobel et al., 2005; Jin et al., 2011; Lamarche and Deziel, 2011). The Ala155Val substitution is predicted by the SIFT algorithm (Kumar et al., 2009) not to affect the protein's function (data not shown). We hypothesize that MexSPA7 retains function, albeit with decreased activity and/or altered regulation (e.g., allostery), compared with the other MexS orthologs. In fact, there were few differences among the whole structures of MexSPA7, MexSPAO1, and MexSDSM 1128 models developed by using the SWISS-MODEL program (data not shown) (Bordoli et al., 2009). MexS is a member of the cd08268: MDR2 family of the Conserved Domains Database (CDD) of the National Center for Biotechnology Information (NCBI) (Fargier et al., 2012) and alanine-155 corresponds to one of the putative NAD(P) binding sites featured in the MDR2 family.

In addition to antibiotic resistance, an nfxC-type mutation has been linked to reduced levels of homoserine lactone-dependent quorum sensing (QS) -regulated virulence factors, including pyocyanin, elastase, rhamnolipids, and Pseudomonas Quinolone Signal (PQS), and to reduced expression of type-III secretion system (TTSS) effector proteins (Kohler et al., 2001; Linares et al., 2005). QS is a cell-to-cell communication mechanism employing diffusible signal molecules (Jimenez et al., 2012), and the TTSS is a mechanism by which bacterial pathogens can deliver effectors directly into the cytoplasm of eukaryotic host cells (Hauser, 2009). We found that PA7 had reduced level of pyocyanin production, rhamnolipid production, and swarming activity compared to DSM 1128 and PAO1 (data not shown), consistent with the typical nfxC mutant phenotype (Jin et al., 2011). However, PA7 derivatives including PA7 mexS also showed almost the same activities of the QS regulated virulence factors with PA7 (data not shown), which suggests that the impaired QS-related phenotype is not derived from the nfxC-like phenotype in PA7. We presume that this lack of correlation reflects the absence from PA7 of TTSS-encoding genes and of the mvfR (pqsR) gene, which is known to encode a LysR-type transcriptional regulator that modulates the expression of multiple QS-regulated virulence factors (Deziel et al., 2005; Roy et al., 2010). These deficiencies might be the source of the mexS mutation and increased mexEF-oprN expression under oxidative stress, sulfide stress, or nitrosative stress (Juhas et al., 2004; Fetar et al., 2011; Fargier et al., 2012).

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.