Toll-like receptor 9 gene polymorphism in chronic and aggressive periodontitis patients.

AIM: Periodontitis is a multifactorial disease, with microbial dental plaque as the primary etiological factor. However, the manifestation and progression of periodontitis is influenced by a wide variety of other determinants and factors such as social and behavioral factors, systemic factors, microbial composition of dental plaque, genetic, and many other emerging risk factors. The aim of this study was to analyze genetic polymorphisms in the toll-like receptor 9 (TLR9) gene at - 1237C/T and its association with chronic and generalized aggressive periodontitis (GAgP) in an Indian population.
MATERIALS AND METHODS: This study was carried out on 90 subjects, which included 30 GAgP and 30 chronic periodontitis patients and 30 healthy controls. Within the limitations of our study, only 30 subjects were included in each group due to the low prevalence of GAgP patients. Blood samples were drawn from the subjects and analyzed for TLR9 genetic polymorphism at - 1237C/T by using polymerase chain reaction-restriction fragment length polymorphism method.
RESULTS: No significant difference was found in genotype and allele frequency of TLR9 genetic polymorphism (- 1237C/T) in generalized aggressive and chronic periodontitis patients and healthy controls.
CONCLUSION: Toll-like receptor 9 genetic polymorphism at - 1237C/T may not be associated with GAgP and chronic periodontitis patients in Indian population.

INTRODUCTION

Periodontal diseases are considered to be multifactorial diseases, where putative periodontopathogens trigger inflammatory and immune responses.[1] Though plaque biofilm is the key etiologic factor involved in the pathogenesis of periodontitis, the quantity and types of periodontal pathogens cannot fully explain the severity of the disease. The interactions of these microbes with the host immune system determine the extent of periodontal tissue destruction.[2]

The primary response to pathogens in the innate immunity system is triggered by pattern recognition receptors (PRRs) that bind pathogen associated molecular patterns (PAMPs). Among the most important families of PRRs are the toll-like receptors (TLRs), which recognize a large number of varied and complex PAMPs.[3] A total of 13 mammalian TLR paralogs and 11 in humans are identified.[45]

Immunohistochemical analysis has revealed that there is a differential expression of all TLRs except TLR7 and TLR8 in the epithelial layer and connective tissue of gingiva in periodontitis and health.[6]

Toll-like receptor 9 alerts the immune system of viral and bacterial infections by binding to DNA rich in CpG motifs.[7] TLR9 signals leads to activation of the cells initiating proinflammatory reactions that result in the production of cytokines such as type-I interferon (IFN) and interleukin-12 (IL-12). TLR9 senses herpes simplex viruses 1 and 2 and human cytomegalovirus.[3458]

Viral DNA has been detected in gingival tissues, gingival crevicular fluid and subgingival plaque from periodontal pockets. Viruses are believed to play an important role in the pathogenesis of periodontal disease.[9] TLR9 is involved in the recognition of viruses and hence may influence the inflammatory response in periodontitis.[3]

Recently, the search for genetic markers associated with the severity, as well as the susceptibility of periodontal disease has been receiving considerable attention.[10] The role of TLRs in both adaptive and innate immunity signifies that genetic variations within the genes encoding them may have an important influence on the pathogenesis of periodontal diseases.

Toll-like receptor-9 genetic polymorphism at - 1237C/T has been associated with inflammatory disease like asthma and atopic eczema.[1112] A recent study carried out by Holla et al., have concluded that TLR9 haplotypes may be associated with patient's susceptibility to chronic periodontitis.[13] The present study was undertaken to investigate a possible association between TLR9 genetic polymorphism at the promoter region - 1237C/T and susceptibility to chronic and generalized aggressive periodontitis (GAgP) in a south Indian population.

MATERIALS AND METHODS

The present study was carried out between March 2008 and April 2011 on 90 subjects who visited the outpatient Department of Periodontics, P.M.N.M. Dental College and Hospital at Bagalkot, in accordance with the Helsinki declaration of 1975, as revised in 2002. Subjects were included in the study after obtaining an informed consent. The ethical approval was obtained from the Institutional Review Board of P.M.N.M Dental College and Hospital, Bagalkot, Karnataka, India.

Method of collection of data

A sample of 90 unrelated subjects from the southern region of India were included in the study which were divided into three groups based on the criteria defined by the International Workshop for Classification of Periodontal Disease:[14] Group I: 30 subjects with healthy periodontium. Group II: 30 patients with chronic periodontitis. Group III: 30 patients with GAgP. Clinical parameters recorded were oral hygiene index simplified,[15] gingival index (GI),[16] probing depth (PD) measurement using William's graduated periodontal probe and clinical attachment loss (CA loss).

Healthy controls included subjects who visited the dental college for regular checkups and demonstrated the absence of clinical and radiographic manifestations of periodontal disease. Only subjects above 21 years were included as controls, since they need to be old enough to give the greatest likelihood possible of exhibiting signs of periodontal disease.[17] They had at least 20 teeth present and had no evidence of CA loss or probing pocket depth >3 mm. Chronic periodontitis patients had at least 20 natural teeth and a minimum of six periodontal pockets ≥5 mm or loss of attachment of ≥3 mm and also, local factors correlated with the loss of periodontal structures. GAgP patients showed generalized interproximal attachment loss, affecting at least three permanent teeth other than first molars and incisors, absence of large accumulations of plaque and calculus, rapid rate of disease progression in an otherwise healthy individual and a family history of aggressive periodontitis. All the patients were systemically healthy and none had received periodontal treatment for at least 6 months prior to sampling and recording.

Exclusion criteria

Current and former smokers who had smoked 100 or more cigarettes in their life time

Systemic diseases like diabetes mellitus and HIV infection, which are known to influence the periodontal disease

Diseases of oral hard and soft-tissue except caries and periodontitis

Chronic usage of anti-inflammatory drugs and medication within 3 months prior to study

Pregnant and lactating female.

Collection of samples

A volume of 5 ml of venous blood sample was collected from the cubital fossa of each subject. Blood samples were sent to laboratory in an ethylenediaminetetraacetic acid (EDTA) containing tube for DNA amplification by polymerase chain reaction (PCR).

Laboratory procedures

DNA extraction

DNA extraction was done by modified proteinase K method. About 500 μl of blood sample was taken in a 2 ml tube and centrifuged for 10,000 rpm for 3-4 min. Supernatant was discarded and to the sediment, 500 μl of Tris-EDTA buffer was added which is to be mixed well and centrifuged again for 10,000 rpm for 3-4 min. Supernatant was discarded. This step was repeated 4 times. To this 500 μl of lysis buffer I (4 M GuSCN, 0.5% N-lauroyl sarcosine, 1 mM dnhiothretiol, 25 mM sodium citrate and 40 μg of glycogen/tube) was added, centrifuged and supernatant was discarded. 50 μl of lysis buffer II was added (Trish-HCL nonidetp40, tween 20). To this, 5 μl of proteinase K was added. This was kept in a water bath at 75°C for 2 h and then in boiling water bath for 10 min and stored at – 80°C.[18]

DNA amplification by polymerase chain reaction

Primer pair (Bioserve, USA) used in the study to analyze TLR9 genetic polymorphism at - 1237T/C (rs5743836)[11] was:

Sense: ATGGGAGCAGAGACATAATGGA

Antisense: CTGCTTGCAGTTGACTGTGT.

The contents of PCR mixture (25 μl) included 100 ng of genomic DNA, ×1 PCR buffer (Chromous Biotech, Bangalore, India), 5 mM of a dNTP mix, 0.5 units of Taq DNA polymerase (Chromous Biotech, Bangalore, India), 3 pmol of each primer, 2 mM of MgCl2. Amplification was performed with PCR system (palm- cycler, Corbett research, Sydney, Australia). Amplification cycles consisted of an initial denaturation step at 95°C for 15 min, denaturation step of 35 cycles at 94°C for 30 s, annealing step of 35 cycles at 57°C for 30 s, extension step of 35 cycles at 72°C for 30 s, and a final extension step at 72°C for 10 min.

Treatment with restriction enzymes (BSTNI)

Restriction enzyme used in the study was BSTNI (Mval) (Fermentas, U.S.A). Concentration of restriction enzyme used was 10 unit/μl. To 10 μl of PCR reaction mixture, 18 μl of nuclease free water, 2 μl of ×10 buffer R and 1-2 μl of MvaI was added. It was mixed gently and spinned down for a few seconds. The mixture was then incubated at 37°C for 6 h for agarose gel electrophoresis on 3.5% agarose containing 1 μg of ethidium bromide/ml in ×1 Tris-borate-EDTA buffer and was visualized under an ultraviolet transilluminator.

Statistical analysis

Statistical power of the study was 85%. Chi-square test was used to find the association between two attributes. Kruskal-Wallis one-way ANOVA was used to find the statistical significance between clinical parameters of more than two groups. Chi-square analysis was used to test for deviation of genotype distribution from Hardy-Weinberg equilibrium and for comparison of differences in genotype combinations among groups. Statistical significance was set at P < 0.05.

RESULTS

The mean age of healthy subjects, chronic periodontitis patients and GAgP patients were 27.17 ± 3.66 (age range of 24-40), 37.30 ± 8.13 (age range of 25-51), and 24.43 ± 5.41 (age range of 18-32), respectively. Gender (male/female) of GAgP patients, chronic periodontitis patients and healthy subjects were 14/16, 13/17, and 15/15, respectively. There was no significant difference.

Table 1 shows the distribution of genotype in three study groups. There was no statistically significant difference between genotype distribution of chronic periodontitis, GAgP patients and healthy subjects respectively. Genotype frequencies were within Hardy-Weinberg equilibrium.

Table 1

Distribution of study subjects according to genotypes and study groups

Table 2 shows the distribution of allele T and C in study groups. It was observed that, there was no statistically significant difference in distribution of alleles among chronic periodontitis patients, GAgP patients and healthy subjects.

Table 2

Distribution of study subjects according to alleles and study groups

Clinical parameters of 3 different genotypes were compared in GAgP [Table 3] and chronic periodontititis patients [Table 4] using Kruskal-Wallis one-way ANOVA. Clinical parameters included PD, CA loss, and GI. There was no statistically significant difference in clinical parameters of three genotypes in whole subjects.

Table 3

Comparison of genotypes with respect to different clinical variables in generalized aggressive periodontitis patients by Kruskal-Wallis one-way ANOVA

Table 4

Comparison of genotypes with respect to different clinical variables in chronic periodontitis patients by Kruskal-Wallis one-way ANOVA

DISCUSSION

Inter individual variations in the periodontal disease have been explained by variations in the genetically determined immunoinflammatory response. TLRs activate nuclear factor-κB (NF-κB), which results in the synthesis and release of proinflammatory cytokines, thereby augmenting the local inflammatory response.[19]

A number of genetic polymorphisms have been found to be associated with risk for periodontitis in various populations. Many polymorphic genes with relatively small but significant associations with disease risk may interact to contribute to overall risk for periodontitis in patients.[20]

Toll-like receptor 9 plays a pivotal role in the induction of first line defense mechanisms of the innate immune system and triggers an effective adaptive immune response to different bacterial and viral pathogens.[6] Activation of TLR9 in peripheral dendritic cells induces T-helper 1 (Th1) cytokines such as IFN-α or IL-12 and Th1 based immune response.[12] The expression of TLR9 is significantly upregulated in periodontitis lesions compared with gingivitis lesions.[21]

There are at least 41 known single nucleotide polymorphisms (SNP) in the TLR9 gene. Five common SNP are identified in the promoter, intron, and exon region of TLR9 gene.[22] The TLR9 genetic polymorphism at - 1237C/T region creates an additional binding site for NF-κB.[1112] Novak et al. concluded that the TT allelic variant sequence of the T - 1237C gene had a higher promoter activity than the CC genotype.[12] Hence, we assumed that a difference in transcriptional regulation of the TLR9 gene can be important for patient's susceptibility to periodontitis.

To the best of our knowledge, only one study has been done to investigate the role of TLR9 polymorphisms in chronic periodontitis. Three variants in TLR9 gene (-1486C/T, -1237C/T and + 2848A/G) were analyzed in chronic periodontitis patients and healthy controls.[13] This is the first study conducted to investigate a possible association between TLR9 genetic polymorphism at the promoter region - 1237C/T and susceptibility to chronic and GAgP in a randomly sampled south Indian population. Within the limitations of our study, we included only 30 subjects each of healthy, chronic periodontitis and GAgP patients. Our sample size is relatively small for a genetic study because GAgP has a very low prevalence. Previously, genetic studies involving aggressive periodontitis were done with a similar sample size.[2324]

Even though TLR9 plays an important role of recognition of pathogens in periodontium, we observed that TLR9 genetic polymorphism at - 1237C/T is not associated with chronic and GAgP (χ2 = 1.0681 and P = 0.8992). Furthermore, there was no statistically significant difference in distribution of alleles in chronic periodontitis, GAgP and healthy subjects (χ2 = 0.3379 and P = 0.8450). We concluded that neither C allele nor T allele is associated with increased risk of GAgP and chronic periodontitis.

In a study done by Holla et al.,[13] no significant association was seen between TLR9 genetic polymorphism at - 1486C/T, -1237C/T, and + 2848A/G and chronic periodontitis, but a complex analysis revealed differences in TLR9 haplotype frequencies in chronic periodontitis patients and healthy subjects. The haplotype T(−1486)/T(-1237)/A(2848) was significantly more and the haplotype T(-1486)/T(-1237)/G(2848) was less frequent in chronic periodontitis patients.

In our study, there was no association between individual genotypes (CC, CT, and TT) and clinical parameters, i.e. PD, CA loss, and GI in chronic periodontitis patients and GAgP patients. This suggests that TLR9 genetic polymorphism at − 1237C/T does not have any significant influence on gingival inflammation and attachment loss.

Periodontitis is a multifactorial disease in which there is an interaction between multiple genes and environmental factors. Hence, the effect of every single gene is small. There are at least 41 known SNPs in TLR9 gene. Smirnova et al., proposed the necessity for the congregation of numerous independent rare mutations to impart disease susceptibility.[25]

Prevalence of CC genotype is much higher in south Indian population when compared to other populations.[1112132226] This can be attributed to genetic difference in this population.

CONCLUSION

Within the limitations of this study, the authors conclude that TLR9 genetic polymorphism at - 1237C/T may not be associated with GAgP and chronic periodontitis in south Indian population. However, as the sample size of this study was small, further studies need to be carried out on a larger sample size to confirm the role TLR9 genetic polymorphism at - 1237C/T in chronic and aggressive periodontitis.